CA15-3 antibody-streptavidin fusion protein, chemiluminescence detection kit and application of CA15-3 antibody-streptavidin fusion protein

Abstract

The invention belongs to the technical field of immunodetection, and particularly relates to a CA15-3 antibody-streptavidin fusion protein, a chemiluminescence detection kit and application of the CA15-3 antibody-streptavidin fusion protein. According to the CA15-3 antibody-streptavidin fusion protein provided by the invention, a streptavidin gene sequence is fused with an Fc end of a CA15-3 antibody through a gene engineering technology, and a novel CA15-3 antibody-streptavidin fusion bifunctional fusion protein which has biotin binding activity and an antigen binding function is constructed; the compound can be combined with biotinylated acridinium ester and is used for chemiluminescence immunodetection. The CA15-3 antibody-streptavidin fusion protein provided by the invention solves the problems that a traditional chemical coupling method affects antibody binding sites, batch difference is large and reagent stability is large, gene recombination expression can ensure product uniformity and large-scale production, batch-to-batch difference control of reagent components is facilitated, and the CA15-3 antibody-streptavidin fusion protein is suitable for industrial production. The accuracy and stability of the detection kit can be improved, and the batch-to-batch difference of the kit is reduced.

Description

Technical Field

[0001] This application belongs to the field of immunoassay technology, specifically involving CA15-3 antibody-streptavidin fusion protein, chemiluminescent detection kit and its application. Background Technology

[0002] Genetically engineered antibodies are obtained by designing and modifying antibody genes and then transfecting them into suitable host cells. This technology reduces the murine component of the antibody, increases its humanization, and thus reduces immunogenicity. Genetically engineered antibodies provide new therapeutic avenues for tumors, autoimmune diseases, and infectious diseases, and have significant clinical value. This particular antibody belongs to the third generation of antibodies and is produced through transcription and translation in suitable host cells using antibody gene modification, DNA recombination, and protein expression technologies. It has advantages such as high plasticity, short preparation cycle, simple operation, and low production cost.

[0003] Monoclonal antibody modification technology is a key technological system for optimizing antibody performance through genetic engineering and protein engineering. Its main applications currently aim to reduce immunogenicity, enhance targeting, and improve pharmacodynamic properties. This technology holds an important position in the biomedical field and is relatively mature.

[0004] In the field of immunoassay, chemiluminescence immunoassay (CLIA) is a mainstream clinical detection technology with advantages such as high sensitivity and automation, but some key issues still exist. Traditional chemical conjugation technology is the core method for linking specific recognition molecules and signal molecules in immunoluminescence analysis. Its advantages and disadvantages are closely related to conjugation efficiency, stability, preservation of biological activity, and operating costs, and it can easily lead to the following risks:

[0005] 1. The coupling sites are highly random, easily damaging biological activity. If coupling occurs in the Fab region (antigen-binding region) of the antibody or the epitope region of the antigen, it will directly block the specific binding of "antigen-antibody," leading to a decrease in the efficiency of the immune response or even its failure. Even if it occurs in the Fc region, steric hindrance may affect the binding conformation. 2. Self-crosslinking is prone to occur, forming polymeric impurities. Multiple reactive groups exist on the surface of antibody / antigen molecules. During coupling, multiple signal molecules may bind simultaneously, or different antibody molecules may crosslink through signal molecules to form "antibody-signal molecule-antibody" polymers. 3. The coupling ratio is uneven, making batch-to-batch variation difficult to control. Due to the randomness of the coupling sites, the number of reporter molecules bound to each antibody / antigen molecule (i.e., the coupling ratio) varies. This uneven coupling ratio leads to different signal output intensities for different molecules: molecules with too low a coupling ratio have weak signals, while molecules with too high a coupling ratio may have reduced binding efficiency due to steric hindrance, ultimately increasing the batch-to-batch variation of the kit. Fourth, it is difficult to meet the high-end requirements of precise conjugation. Modern immunoluminescence technology has extremely high requirements for the "precision of conjugation sites": for example, in double antibody sandwich, it is necessary to ensure that the detection antibody only conjugates the signal molecule and the capture antibody does not conjugate, which cannot be achieved by traditional random conjugation; in multiplex detection, it is necessary to control the conjugation ratio of different antibodies to ensure signal comparability, which is also difficult to meet by traditional methods.

[0006] CA15-3 (Carbohydrate Antigen 15-3) chemiluminescence immunoassay is a commonly used clinical tumor marker detection technology, mainly used for the auxiliary diagnosis, efficacy monitoring, and prognostic assessment of malignant tumors such as breast cancer. The CA15-3 chemiluminescence assay essentially combines a double-antibody sandwich immunoassay technique with chemiluminescence signal detection. Using traditional conjugation methods can lead to problems such as poor correlation, poor stability, and difficulty in controlling batch-to-batch variations. Summary of the Invention

[0007] Based on this, one embodiment of this application provides the CA15-3 antibody-streptavidin fusion protein, a chemiluminescent detection kit, and their applications.

[0008] This application provides a CA15-3 antibody-streptavidin fusion protein, comprising: an anti-CA15-3 monoclonal antibody and streptavidin protein;

[0009] The heavy chain constant region of the anti-CA15-3 monoclonal antibody is linked to the streptavidin protein via a linker peptide.

[0010] The anti-CA15-3 monoclonal antibody can specifically bind to the CA15-3 antigen, and the streptavidin protein can bind to biotin.

[0011] In some embodiments, the linker peptide includes a flexible linker peptide.

[0012] In some embodiments, the flexible linker peptide has the structure (GGGGS)n, where n is a positive integer;

[0013] In some embodiments, the amino acid sequence of the flexible linker peptide is shown in SEQ ID NO.2. Another aspect of this application provides a CA15-3 chemiluminescent detection kit comprising the aforementioned CA15-3 antibody-streptavidin fusion protein.

[0014] In some embodiments, the kit further includes one or more of acridinium ester-biotin conjugate and a coating that captures the antibody and magnetic microspheres;

[0015] In some embodiments, the surface of the coating to which the magnetic microspheres are attached has active groups.

[0016] In some embodiments, the biotin in the acridine ester-biotin conjugate is linked to the acridine ester via an amide bond.

[0017] In some embodiments, the kit includes one or more of the following: standards, dilution buffer, protein protectant, washing solution, pre-excitation solution, and luminescence excitation solution.

[0018] This application also provides a method for preparing the CA15-3 antibody-streptavidin fusion protein, comprising:

[0019] Screening for anti-CA15-3 monoclonal antibodies; using genetic engineering techniques to link the gene of the anti-CA15-3 monoclonal antibody with the gene of streptavidin via a linker peptide; and,

[0020] The fusion gene was cloned into an expression vector, transformed into host cells for expression, and the CA15-3 antibody-streptavidin fusion protein was prepared.

[0021] In some embodiments, the expression vector includes the eukaryotic expression vector pCDNA3.1;

[0022] In some embodiments, the host cell includes CHO cells;

[0023] In some embodiments, purification includes: preliminary purification using affinity chromatography; desalting the preliminary purified product; and fine purification using molecular sieve chromatography.

[0024] This application also provides a CA15-3 chemiluminescence detection method, comprising:

[0025] The sample to be tested was mixed with the CA15-3 antibody-streptavidin fusion protein, the acridinium ester-biotin conjugate, and the coating of the capture antibody bound to the magnetic microspheres, and incubated. The incubated mixture was then tested.

[0026] In some embodiments, the CA15-3 chemiluminescence detection method includes:

[0027] S1. Provides magnetic microspheres coated with capture antibodies;

[0028] S2. The sample to be tested, the magnetic microspheres coated with the capture antibody, and the detection antibody complex are mixed to form a reaction mixture, and the reaction is incubated at 36℃-38℃; the detection antibody complex contains CA15-3 antibody-streptavidin fusion protein and biotin-acridone ester conjugate;

[0029] S3. Solid-phase separation and cleaning of the system after reaction S2;

[0030] S4. Add acid and base reagents sequentially to the system after cleaning in S3 to induce a chemiluminescent reaction; and

[0031] S5. Detect the chemiluminescent signal generated in S4, and calculate the content of CA15-3 antigen in the sample based on the signal.

[0032] This application provides a CA15-3 antibody-streptavidin fusion protein. Through genetic engineering, the streptavidin gene sequence is fused to the Fc terminus of the CA15-3 antibody, constructing a novel bifunctional CA15-3 antibody-streptavidin fusion protein. This protein possesses both biotinylate-binding and antigen-binding activities, can bind to biotinylated acridine esters, and can be used for chemiluminescent immunoassay. The CA15-3 antibody-streptavidin fusion protein provided in this application solves the problems of traditional chemical conjugation methods affecting antibody binding sites, large batch-to-batch variability, and reagent stability. Furthermore, gene recombination expression ensures product uniformity and large-scale production, which is beneficial for batch-to-batch control of reagent components, improving the accuracy and stability of the detection kit, and reducing batch-to-batch variability. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0034] Figure 1 This is a schematic diagram illustrating the principle of the combination of the components;

[0035] Figure 2 Reduced SDS-PAGE of CA15-3 fusion protein;

[0036] Figure 3 Purity identification of CA15-3 fusion protein. Detailed Implementation

[0037] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0038] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0039] the term

[0040] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0041] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0042] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0043] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0044] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0045] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0046] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0047] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0048] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0049] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0050] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0051] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0052] Recombinant genetic engineering technology can directionally insert a streptavidin (SA) sequence into the Fc terminus of an antibody. The expressed recombinant protein does not affect the binding site at the Fab terminus of the antibody, thus solving the problem of random conjugation in traditional chemical conjugation methods that easily block antibody binding sites. Furthermore, gene expression products have higher chemical stability because they need to maintain their structure and function over a long period of time, while substances formed by chemical conjugation are mostly temporary intermediates that need to participate in reactions or transmit signals quickly, and therefore have lower stability.

[0053] Based on this, this application provides a CA15-3 antibody-streptavidin fusion protein, comprising: an anti-CA15-3 monoclonal antibody and streptavidin protein; this fusion protein integrates the specific recognition function of the antibody with the high affinity binding function of streptavidin to biotin. One fusion protein molecule can bind multiple biotinylated signal molecules (such as acridinium ester), achieving significant amplification of the detection signal, thereby greatly improving the detection sensitivity.

[0054] The heavy chain constant region of the anti-CA15-3 monoclonal antibody is linked to the streptavidin protein via a linker peptide.

[0055] The anti-CA15-3 monoclonal antibody can specifically bind to the CA15-3 antigen, and the streptavidin protein can bind to biotin.

[0056] In some embodiments, the linker peptide includes a flexible linker peptide;

[0057] In some embodiments, the flexible linker peptide has the structure (GGGGS)n, where n is a positive integer. The flexible linker peptide (such as (GGGGS)n) acts as a flexible "hinge," providing sufficient spatial freedom for both the antibody and streptavidin functional domains. This prevents unfavorable interactions or steric hindrance between the two domains, ensuring they can fold independently and correctly and perform their optimal functions. Furthermore, the flexible linker allows streptavidin to more freely adjust its orientation to optimally capture the biotin-acridone conjugate in solution, thereby improving binding efficiency and further enhancing signal strength.

[0058] In some embodiments, the amino acid sequence of the flexible linker peptide is shown in SEQ ID NO.2.

[0059] Another aspect of this application provides a CA15-3 chemiluminescence detection kit, the kit comprising the CA15-3 antibody-streptavidin fusion protein.

[0060] In some embodiments, the kit further includes an acridinium ester-biotin conjugate and a coating that captures the antibody and binds to the magnetic microspheres;

[0061] In some embodiments, the surface of the coating to which the magnetic microspheres are attached has active groups.

[0062] In some embodiments, biotin in the acridine ester-biotin conjugate is linked to the acridine ester via an amide bond. Amide bonds are highly stable and reliable chemical bonds found in nature and in chemical synthesis. This linkage ensures that the acridine ester-biotin conjugate is not easily broken or degraded under reagent storage and detection conditions, guaranteeing the stability of the signal marker and the reliability of the detection results.

[0063] In some embodiments, the CA15-3 antigen to be tested can specifically bind to the coating of the capture antibody and magnetic microspheres and the CA15-3 antibody-streptavidin fusion protein.

[0064] Acridinium esters, as chemiluminescent labeling agents, offer advantages such as rapid luminescence, low background, and no need for catalysts. Conjugating them with biotin allows the signaling system to be efficiently integrated into immune complexes via the biotin-streptavidin bridge.

[0065] Specifically, the kit includes the following components: 1. A novel CA15-3 detection antibody-streptavidin fusion protein was constructed by fusing the streptavidin gene sequence with the Fc segment of an antibody using genetic engineering technology; 2. An acridinium ester-biotin conjugate was obtained by directly coupling an amino-containing biotin to an acridinium ester-biotin conjugate containing N-hydroxysuccinimide (NHS); 3. A coating that captures the antibody and binds to magnetic microspheres with active groups on their surface. The CA15-3 detection antibody-streptavidin fusion protein and the acridinium ester-biotin conjugate form a detection antibody complex by utilizing the specific binding of biotin-streptavidin. This complex binds to the site of the target antigen CA15-3 and then to the site of the capture antibody on the magnetic beads, forming a sandwich structure of magnetic bead coating-analyte-detection antibody complex. The luminescence signal is detected by a luminescence analyzer.

[0066] In some embodiments, the kit includes one or more of the following: standards, dilution buffer, protein protectant, washing solution, pre-excitation solution, and luminescence excitation solution.

[0067] This application also provides a method for preparing the CA15-3 antibody-streptavidin fusion protein, comprising:

[0068] Screening for anti-CA15-3 monoclonal antibodies; using genetic engineering techniques to link anti-CA15-3 monoclonal antibodies with streptavidin via a linker peptide; and,

[0069] The fusion gene was cloned into an expression vector, transformed into host cells for expression, and the CA15-3 antibody-streptavidin fusion protein was prepared. This application utilizes genetic engineering technology to design at the DNA level, enabling precise control over the amino acid sequence, linker peptide length, and structure of the fusion protein, fundamentally ensuring the uniformity and high purity of the product.

[0070] In some embodiments, the expression vector includes the eukaryotic expression vector pCDNA3.1.

[0071] In some embodiments, the host cell includes CHO cells. This application employs a CHO (Chinese hamster ovary) cell expression system, and obtains stable expression cell lines through a GS (glutamine synthase) selection system. The use of eukaryotic expression systems such as CHO cells enables correct folding, disulfide bond formation, and glycosylation of the expressed recombinant protein, which is crucial for maintaining the biological activity and stability of the antibody.

[0072] In some embodiments, purification includes: preliminary purification using affinity chromatography; desalting of the preliminary purified product; and fine purification using molecular sieve chromatography. Employing a multi-step chromatographic purification strategy (affinity chromatography to capture the target protein, and molecular sieve chromatography to remove aggregates and debris) can effectively separate the fusion protein from host cell proteins, nucleic acids, and other impurities, obtaining a high-purity, active protein. This is crucial for achieving high specificity and low background detection.

[0073] This application also provides a CA15-3 chemiluminescence detection method, comprising:

[0074] The sample to be tested was mixed with the CA15-3 antibody-streptavidin fusion protein, the acridinium ester-biotin conjugate, and the coating of the capture antibody bound to the magnetic microspheres, and incubated. The incubated mixture was then tested.

[0075] In some embodiments, the CA15-3 chemiluminescence detection method includes the following steps:

[0076] S1. Provides magnetic microspheres coated with capture antibodies;

[0077] S2. The sample to be tested, the magnetic microspheres coated with the capture antibody, and the detection antibody complex are mixed to form a reaction mixture, and the reaction is incubated at 36℃-38℃; the detection antibody complex contains CA15-3 antibody-streptavidin fusion protein and biotin-acridone ester conjugate;

[0078] S3. Solid-phase separation and cleaning of the system after reaction S2;

[0079] S4. Add acid and base reagents sequentially to the system after cleaning in S3 to induce a chemiluminescent reaction; and

[0080] S5. Detect the chemiluminescent signal generated in S4, and calculate the content of CA15-3 antigen in the sample based on the signal.

[0081] In some embodiments, the acid reagent includes HNO3-H2O2 solution, and the base reagent includes NaOH.

[0082] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0083] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0084] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0085] Unless otherwise specified, the following embodiments do not include components other than unavoidable impurities. Unless otherwise specified, the reagents and instruments used in the examples are conventionally selected in the art. Experimental methods not specifying particular conditions in the examples were performed under conventional conditions, such as those described in literature, books, or manufacturer-recommended methods. Unless otherwise specified, all reagents used below were purchased from Thermo Fisher Scientific (hereinafter referred to as Thermo Fisher) and Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Sangon) and were of analytical grade. The luminescence instruments, diluents, acridinium esters, and monoclonal antibodies used below were provided by Shenzhen Yahuilong Biotechnology Co., Ltd.

[0086] Example 1

[0087] This application uses the detection of carbohydrate antigen 15-3 (CA15-3) as an example to verify the relevance, stability and batch-to-batch variation of the detection method proposed in this application.

[0088] The specific experimental steps are as follows:

[0089] I. Preparation of CA15-3 antibody-streptavidin fusion protein

[0090] Step 1: Design of fusion genes

[0091] The structural design of fusion proteins needs to take into account both the CA15-3 binding activity of the antibody and the biotin binding activity of SA4. The key is to add a flexible linker to avoid steric hindrance.

[0092] 1. Obtaining the CA15-3 monoclonal antibody gene: Go to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), click "GenBank" or "Nucleotide" at the top to access the nucleotide database. Enter accession numbers AF043107 (mouse anti-MUC1 monoclonal antibody heavy chain gene) and AF043108 (light chain gene) to obtain the gene sequence of the CA15-3 monoclonal antibody.

[0093] 2. Obtaining the SA gene: Go to the NCBI website, enter the login number AAA26667.1, and obtain the mature SA gene sequence encoding 128 amino acids. The four segments are tandemly linked with flexible peptide sequences to form the SA4 gene sequence.

[0094] 3. Integrated structural design

[0095] The SA was fused to the C-terminus (after the Fc segment) of the IgG heavy chain, resulting in the following structure:

[0096] IgG heavy chain: signal peptide-VH-CH1-CH2-CH3-Linker-SA4;

[0097] The IgG light chain is the ordinary IgG light chain: signal peptide-VL-CL, which does not require SA fusion and is assembled into complete IgG after co-expression with the heavy chain;

[0098] Signal peptide sequence:

[0099] ATGGTGCTGCTGCTGGCCTCCGCCCTGGCCGCCCTGGTGGTGGAGGTGCTG (SEQ ID NO. 1).

[0100] Linker selection: A flexible glycine-serine linker was adopted.

[0101] (G4S)4 sequence: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO.2), which is long enough to avoid spatial interference between the heavy chain and SA4;

[0102] Primer design:

[0103] (1) Amplify the CA15-3 monoclonal antibody heavy chain gene (including signal peptide and constant region).

[0104] Upstream primer (heavy chain 5' end): 5'-CGGAATTCATGGAGTTTGGGCTGAGCTGGGTTTT-3' (SEQ ID NO.3)

[0105] Function: Contains EcoRI restriction site (GAATTC) + protective base (CG) + mouse IgG1 signal peptide initiation sequence.

[0106] Downstream primer (3' end of heavy chain, with the first half of the linker):

[0107] 5'-GGTGGCGGTGGCTCCGGTGGCGGTGGCTCCACCGTGACCGTGGTCCCTT-3' (SEQ ID NO.4)

[0108] Function: The 3' end is complementary to the CH3 end of the heavy chain constant region CACCGTGACCGTGGTCCCTT (SEQ ID NO.5), and the 5' end contains the first half of Linker (G4S)4: GGTGGCGGTGGCTCCGGTGGC (SEQ ID NO.6), which is used to overlap with the second half of the Linker of the SA gene.

[0109] (2) Amplification of the streptavidin (SA4) gene

[0110] Upstream primer (SA5' end, with the linker tail):

[0111] 5'-GGAGCCACCGCCACCGGAGCCACCGCCACCATGTCTAAAGATTTAAAG-3' (SEQ ID NO.7)

[0112] Function: The 5' end contains the latter half of Linker(G4S)4 (complementary to the Linker of the downstream primer of the heavy chain), and the 3' end is complementary to the SA gene start sequence: ATGTCTAAAGATTTAAAG (SEQ ID NO.8), based on the SA gene accession number AAA26667.1).

[0113] Downstream primer (SA 3' end): 5'-CCGCTCGAGTTATTTCGGTTCAAATTTGTC-3' (SEQ ID NO.9)

[0114] Function: Contains XhoⅠ restriction site (CTCGAG) + protective base (CC) + SA gene termination sequence TTATTTCGGTTCAAATTTGTC (SEQ ID NO.10).

[0115] Flexible peptide sequence: The flexible glycine-serine linker was used, and the (G4S)4 sequence was: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO.11).

[0116] (3) Connect the heavy chain and SA4

[0117] Using the PCR products of (1) and (2) as templates, fusion PCR was performed using the upstream primer of the heavy chain and the downstream primer of SA4. The two gene segments were connected by the complementary sequence of the Linker to obtain the complete "heavy chain-Linker-SA4" fusion gene.

[0118] (4) Light chain gene primers (need to be amplified separately and co-expressed with the fusion protein)

[0119] Upstream primer (5' end of light chain): 5'-CGGAATTCATGAAATGCAGCTGGGTTATC-3' (SEQ ID NO.12)

[0120] The initiation sequence of the mouse IgG light chain (k-type) signal peptide containing the EcoRI site is ATGAAATGCAGCTGGGTTATC (SEQ ID NO.13).

[0121] Downstream primer (3' end of light chain): 5'-CCGCTCGAGTTATTAACACTCTCCCCTGTTGAA-3' (SEQ ID NO. 14)

[0122] The XhoI site + light chain constant region CL termination sequence TTATTAACACTCTCCCCTGTTGAA (SEQ ID NO. 15).

[0123] Step 2: Fusion gene synthesis

[0124] The optimized "heavy chain-Linker-SA4" fusion gene and light chain gene were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0125] Step 3: Construction of eukaryotic expression vector

[0126] The heavy chain-SA4 fusion gene vector and the light chain gene vector need to be constructed separately, and then assembled into a complete fusion protein after co-transfection into CHO cells.

[0127] 1. Double enzyme digestion of vector and gene

[0128] (1) Take 10 μg of pCDNA3.1 vector and 5 μg of synthesized “heavy chain-SA4” fusion gene, and perform the operation according to the enzyme digestion kit (Thermo Fisher catalog number FD0275 and FD0695). Add EcoRI (10 U), XhoI (10 U) and 10× enzyme digestion buffer respectively, and incubate at 37℃ for 4 h.

[0129] (2) Separate the enzyme digestion products by 1% agarose gel electrophoresis, and recover the "linearized vector" and "enzyme digestion fusion gene" using a gel recovery kit (Sangon Biotech product number B518146).

[0130] (3) The enzyme digestion steps for light chain genes and vectors are the same as above.

[0131] 2. Ligation of genes and vectors

[0132] (1) Mix according to “vector:gene = 1:3 (molar ratio)”, add T4 DNA ligase (1 U) and 10× ligation buffer, and ligate overnight at 16℃.

[0133] (2) The ligation product was transformed into DH5α competent cells (ice bath for 30 min → heat shock at 42℃ for 90 s → ice bath for 2 min).

[0134] (3) Add LB medium (37℃ shaking culture for 1h), spread on LB plates containing ampicillin (Amp+), and culture at 37℃ for 16h.

[0135] 3. Identification of positive clones

[0136] (1) Pick a single colony and place it in Amp+LB liquid medium and incubate at 37°C with shaking for 8 hours.

[0137] (2) The plasmid (B611253) was extracted using a kit and verified by colony PCR and double enzyme digestion.

[0138] (3) Sequencing of the plasmids that tested positive confirmed that the fusion gene sequence was free of mutations and the reading frame was correct, and the recombinant vectors “pCDNA3.1-heavy chain-SA4” and “pCDNA3.1-light chain” were obtained.

[0139] Step 3: CHO cell transfection and stable cell line selection

[0140] 1. Cell pretreatment

[0141] (1) Follow the CHO transfection kit (Thermo Fisher Scientific catalog number A29130) to seed CHO-S cells into 6-well plates 24 h in advance and culture them in DMEM containing 10% fetal bovine serum until the cell confluence reaches 70%-80% at the time of transfection.

[0142] (2) Replace with serum-free Opti-MEM medium 1 hour before transfection.

[0143] 2. Co-transfection

[0144] (1) Preparation of transfection complex: Take 2 μg of “pCDNA3.1-heavy chain-SA4” + 2 μg of “pCDNA3.1-light chain” plasmid, add 500 μL of Opti-MEM and mix well.

[0145] (2) Take 10 μL of Lipofectamine 3000, add 500 μL of Opti-MEM, and incubate at room temperature for 5 min.

[0146] (3) Mix the two solutions and incubate at room temperature for 20 min (to form a DNA-liposome complex).

[0147] (4) The complex was slowly added dropwise to cells in a 6-well plate and incubated at 37°C with 5% CO2. Incubate in an incubator for 6 hours, then replace with DMEM containing 10% fetal bovine serum and continue incubation for 48 hours.

[0148] 3. Screening of stable cell lines

[0149] (1) 48 h after transfection, the cells were digested, diluted 1:10 and seeded into a new 6-well plate. Selection medium containing 800 μg / mL LG418 (Thermo Fisher Scientific catalog number A3711001) was added (preliminary experiments were conducted to determine the lethal concentration of G418 in CHO cells, which is usually 600-1000 μg / mL).

[0150] (2) Change the screening medium every 3 days for 2 weeks until all untransfected cells die and the surviving cells are resistant clones.

[0151] (3) Single clone screening: The surviving cells were seeded into 96-well plates (1 cell per well) using the "limiting dilution method" and cultured for 2-3 weeks. When the clones grew to 1 / 3 of the bottom of the well, the supernatant was collected.

[0152] 4. Identification of high-expression clones

[0153] The expression level of the fusion protein in the supernatant was detected by ELISA:

[0154] (1) Coating CA15-3 recombinant antigen (1 μg / well, overnight at 4°C).

[0155] (2) Seal (5% skim milk, incubate at 37°C for 1 hour).

[0156] (3) Add cell supernatant (1:10 dilution) and incubate at 37°C for 1 h.

[0157] (4) Add HRP-labeled anti-SA antibody (1:5000 dilution) and incubate at 37°C for 1 h.

[0158] (5) TMB color development, absorbance (OD value) measured at 450 nm, select the clone with the highest OD value (high expression strain), and expand the culture to shake flask (serum-free medium).

[0159] Step 4: Purification of the fusion protein

[0160] The core of purifying target proteins from CHO cell culture supernatant is utilizing the dual affinity properties of the "antibody Fc fragment" and "SA4".

[0161] 1. Supernatant pretreatment

[0162] (1) Centrifuge the cell supernatant from the expanded culture (8000×g, 10 min, 4℃) to remove cell debris.

[0163] (2) Filter the supernatant with a 0.22μm filter membrane to remove macromolecular impurities.

[0164] 2. Protein A affinity chromatography

[0165] (1) Equilibrate the column: Rinse the Protein A column with Binding Buffer (20 mM Tris-HCl, pH 7.4) at a flow rate of 1 mL / min until the baseline is stable.

[0166] (2) Sample loading: The filtered supernatant was slowly loaded onto the column at a flow rate of 0.5 mL / min, and the breakthrough liquid was collected.

[0167] (3) Washing: Rinse the column with Binding Buffer until the OD280 value drops below 0.05 to remove contaminating proteins.

[0168] (4) Elution: Elute the target protein with Elution Buffer (0.1 M Glycine-HCl, pH 3.0), collect 1 mL from each tube, and immediately neutralize to pH 7.0 with 1 M Tris-HCl (pH 8.0) to avoid protein denaturation.

[0169] (5) Detection: The OD280 value of each tube was detected by ultraviolet spectrophotometer, and the components with OD280>0.1 were combined to contain fusion protein.

[0170] 3. Desalination and Concentration

[0171] (1) Equilibrate the desalting column: Rinse the Sephadex G-25 column with PBS (pH 7.4) at a flow rate of 1 mL / min.

[0172] (2) Loading: Load the combined solution eluted with Protein A onto the desalting column at a flow rate of 0.5 mL / min.

[0173] (3) Elution and collection: Elute with PBS, collect the component corresponding to the OD280 peak, and remove small molecules such as Glycine and Tris.

[0174] (4) Concentration: Protein was concentrated using ultrafiltration centrifuge tubes with a molecular weight cutoff of 30 kDa (4°C, 5000×g).

[0175] 4. Molecular sieve chromatography

[0176] (1) Further remove non-recombinant expressed monoclonal antibody-related contaminants and purify using GE's AKTA purification equipment with a Superdex 200 Increase 10 / 300 pre-packed column.

[0177] (2) After equilibrating the column with 50mM PBS (pH 7.2) buffer, load the sample. The larger molecular weight peaks will elute first. Collect the first peaks in separate tubes, concentrate them using a 30kDa ultrafiltration centrifuge tube to obtain the CA15-3 antibody-streptavidin fusion protein. Dilute with preservation solution and store at a concentration of 0.1mg / mL. The preservation dilution solution is 50mM phosphate buffer (pH 7.4) containing 0.1% Tween-20, 0.02% Na3N, and 0.2% Proclin 300. Unless otherwise specified, the preservation solution described below is the same as this preservation solution.

[0178] Step 5: Identification of the fusion protein

[0179] The target protein was verified from two aspects: molecular weight and purity.

[0180] 1. Molecular weight determination (SDS-PAGE)

[0181] (1) Prepare 10% SDS-PAGE gel and perform reducing electrophoresis.

[0182] (2) Reduction: β-mercaptoethanol (final concentration 5%) was added to the protein sample, and the protein was denatured at 95°C for 5 min to break disulfide bonds. The heavy chain-SA4 fusion protein was approximately 115 kDa, and the light chain was approximately 25 kDa. The detection results are as follows: Figure 2 As shown.

[0183] 2. Purity identification (SEC-HPLC)

[0184] (1) A size exclusion column MAbPac SEC-1 was used, with PBS (pH 7.4) as the mobile phase and a flow rate of 0.5 mL / min.

[0185] (2) Load 20 μL of the concentrated fusion protein (1 mg / mL) and detect the absorption peak at 280 nm.

[0186] (3) Calculate the area ratio of the main peak, purity > 98%, and the test results are as follows: Figure 3 As shown.

[0187] II. Preparation of Biotin-Acridine Ester Conjugate

[0188] Step 1: Coupling of biotin and acridine ester

[0189] 1. Take 0.1 mg of biotin-PEG4-amine and add it to PBS solution (50 mM, pH 7.2) to a concentration of 0.5 mg / mL. Add 60 μL of DMSO solution of acridine ester NSP-DMAE-NHS (5 mg / mL). The molar ratio of biotin-PEG4-amine to acridine ester NSP-DMAE-NHS is approximately 1:2. React in a constant temperature incubator at 25℃ for 2 h.

[0190] 2. Add 100 μL of PBS solution containing 10 g / L glycine to quench the reaction.

[0191] Step 2: Purification of the conjugate

[0192] 1. Purification was performed using the AKTA purification system from GE, with a Superdex 30 10 / 300 pre-packed column. 50 mM PBS (pH 7.2) buffer was used as the equilibration buffer to remove unreacted acridine ester and biotin, yielding the biotin-acidine ester conjugate. The conjugate was diluted with storage solution and stored at a concentration of 10 μg / mL.

[0193] III. Preparation of Magnetic Bead-CA15-3 Capture Antibody Conjugate

[0194] (1) Take 1 mL of carboxyl nanomagnetic beads (particle size 2 μm, 10 mg / mL, 600 nmol / mg) solution, process it in a magnetic separator for 3 minutes, remove the supernatant with a pipette, and wash 3 times with 10 mL of 100 mM MES solution (pH 6.0).

[0195] (2) Add 2 mL of 50 mM MES solution (pH 6.0) to the washed carboxyl nanomagnetic beads, add 0.3 mL of LEDC solution (concentration 10 mg / mL) and 0.3 mL of Sulfo-NHS solution (concentration 8 mg / mL), and react at 25 °C (40 rpm) for 1 h to obtain activated carboxyl magnetic beads.

[0196] (3) Prepare 1 mL of 100 mM phosphate buffer (pH 8.0) for CA15-3 capture antibody, with a CA15-3 capture antibody concentration of 0.1 mg / mL. Heat in a water bath to 37°C and maintain this temperature for 2 h.

[0197] (4) Add the phosphate buffer of CA15-3 capture antibody to the activated carboxyl magnetic beads, control the pH of the mixed solution to 7.2, add 80 μL of DMAP in DMSO solution (10 mg / mL), and rotate (60 rpm) at 37 °C for 24 h.

[0198] (5) Magnetic separation: Remove the supernatant with a pipette. Wash three times with 50mM PBS solution containing 0.1% Tween-20, 2 mL each time. Store the washed CA15-3 capture antibody-magnetic nanobeads in 1 mL of storage solution, with a storage concentration of 10 mg / mL based on the magnetic beads.

[0199] Example 2

[0200] The gene sequence of the CA15-3 monoclonal antibody and the sequence of the flexible linker were modified, and the components of the detection kit were obtained according to the experimental method described in Example 1 above.

[0201] 1. Obtaining the CA15-3 monoclonal antibody gene: Go to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), click "GenBank" or "Nucleotide" at the top to access the nucleotide database. Enter accession numbers PC405482 (monoclonal antibody heavy chain gene) and PC405483 (light chain gene) to obtain the gene sequence of the CA15-3 monoclonal antibody.

[0202] 2. Flexible Linker Sequence: A flexible glycine-serine linker was used, (G4S)2 sequence: GGGGSGGGGS (SEQ ID NO.16).

[0203] Example 3

[0204] The gene sequence of the CA15-3 monoclonal antibody and the sequence of the flexible linker were modified, and the components of the detection kit were obtained according to the experimental method described in Example 1 above.

[0205] 1. Obtaining the CA15-3 monoclonal antibody gene: Go to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), click "GenBank" or "Nucleotide" at the top to access the nucleotide database. Enter accession numbers OF199153 (monoclonal antibody heavy chain gene) and OF199154 ​​(light chain gene) to obtain the gene sequence of the CA15-3 monoclonal antibody.

[0206] 2. Flexible Linker Sequence: A flexible glycine-serine linker was used, with the (G4S)6 sequence: GGGGSGGGGSGGGGSGGGGSGGGGSGGGS (SEQ ID NO.17).

[0207] Comparative Example 1

[0208] I. The conjugates of CA15-3 antibody and SA4 were obtained using a traditional chemical conjugation method. The preparation steps are as follows:

[0209] (1) Take 100 μg of CA15-3 detection antibody and add it to a phosphate buffer solution with a pH of 7.4. The reaction concentration is 0.5 mg / mL. Add 100 mM DTT to the CA15-3 detection antibody solution, mix gently, and react at 4°C in the dark for 30 minutes.

[0210] (2) After the reaction was completed, a 2 mL desalting column with a molecular weight cutoff of 7 KD (Thermo Fisher Scientific) was used with 150 mM PBS (pH 7.4) buffer as the column buffer and the column was passed through twice to remove free DTT.

[0211] (3) Take 100 μg of SA4 and add it to a phosphate buffer solution with a pH of 7.4. The reaction concentration is 0.5 mg / mL. Add 5 mM SMCC stock solution to the CA15-3 antibody solution, mix gently, and react at 4°C in the dark for 1 hour.

[0212] (4) After the reaction is complete, a 2 mL desalting column with a molecular weight cutoff of 7KD is used with 150 mM PBS (pH 7.4) buffer as the column buffer and the column is passed through twice to remove free SMCC.

[0213] (5) Slowly add the desalted SA4 solution from (2) to the activated antibody solution (4), gently invert and mix, and react at 4°C in the dark for 2 hours.

[0214] (6) Add 50mM cysteine ​​aqueous solution to terminate the reaction, and react at 4°C in the dark for 30 minutes.

[0215] (7) The terminating reaction mixture was used with a Superdex 200 Increase 10 / 300 GL column and 50mM PBS (pH 7.2) buffer as equilibration buffer to remove unreacted CA15-3 detection antibody and SA4, and the CA15-3 antibody detection conjugate with SA4 was obtained. It was diluted with storage solution and stored at a concentration of 0.1 mg / mL.

[0216] II. The preparation of biotin-acridone ester conjugate and magnetic bead-CA15-3 capture antibody conjugate is the same as in Example 1.

[0217] Comparative Example 2

[0218] I. Preparation of CA15-3 detection antibody-conjugated acridine ester label is as follows:

[0219] Take 100 μg of unmodified CA15-3 detection antibody solution and add it to phosphate buffer solution at pH 7.4 to achieve a reaction concentration of 0.5 mg / mL. After mixing thoroughly, add 2 μL of acridine ester NSP-DMAE-NHS at a concentration of 5 mg / mL and react at 25°C for 2 hours. Then add L... The labeling reaction was terminated by reacting with lysine hydrochloride buffer at 25°C for 1 h. A 2 mL desalting column with a molecular weight cutoff of 7 KD was used with 150 mM PBS (pH 7.4) buffer as the column buffer. The column was run twice to remove unreacted acridine esters. The prepared CA15-3 antibody acridine-labeled ester was diluted with storage solution and stored at a concentration of 0.1 mg / mL.

[0220] II. The preparation of the magnetic bead-CA15-3 capture antibody conjugate is the same as in Example 1.

[0221] Performance testing

[0222] 1. Correlation test

[0223] The acrid ester labels obtained in Examples 1, 2, 3, Comparative Example 1, and Comparative Example 2 were applied to the chemiluminescent immunoassay of CA15-3, using an iFlash3000 chemiluminescent immunoassay analyzer (Yahuilong Biotechnology) and a CA15-3 chemiluminescent reagent kit semi-finished product. The reaction modes in Examples 1, 2, and 3 were consistent with Comparative Example 1, such as... Figure 1 As shown, Comparative Example 2 uses a traditional double-antibody sandwich reaction mode.

[0224] The specific test steps include: (1) Preparation of capture antibody-magnetic bead working solution: The magnetic bead component working solutions of Example 1, Example 2, Example 3, Comparative Example 1 and Comparative Example 2 are the same. The magnetic bead-CA15-3 capture antibody conjugate in Example 1 is diluted 50 times with a citrate-sodium citrate buffer system (0.1mol / L).

[0225] (2) Preparation of working solutions for CA15-3 antibody-streptavidin fusion protein, CA15-3 antibody-SA conjugate, and CA15-3 antibody-conjugated acridine ester label: The concentration of the detection antibody complex stock solution in Examples 1, 2, 3, Comparative Example 1, and Comparative Example 2 was the same, 0.1 mg / mL, and it was diluted 200 times with a disodium hydrogen phosphate (12 water)-sodium dihydrogen phosphate buffer system (0.2 mol / L). The biotin-acidine ester conjugate was diluted 500 times with a disodium hydrogen phosphate (12 water)-sodium dihydrogen phosphate buffer system (0.2 mol / L).

[0226] (3) Testing: Take 20 μL of different samples and add 50 μL of the working solution of the capture antibody-coated magnetic beads and 50 μL of the working solution prepared in Example 1, Comparative Example 1, and Comparative Example 2, respectively. After reacting at 37℃ for 10 min, perform magnetic separation and washing three times. Add 100 μL of HNO3-H2O2 solution and 100 μL of NaOH solution to each component successively. Measure the luminescence value using an iFlash3000 chemiluminescence immunoassay analyzer. Perform three parallel measurements and take the average value. The samples are clinical samples, and all samples were confirmed by Roche kit testing. The following are the test results verifying the reagent correlation.

[0227] Table 1

[0228]

[0229]

[0230] The correlation test data in Table 1 show that the correlations between the results of the fusion protein expressed using genetic engineering technology and those obtained using Roche reagents were 0.9839, 0.9749, and 0.9855, respectively, which is superior to the traditional conjugation labeling method. This indicates that in the traditional conjugation labeling method, when the signal molecule is randomly conjugated to the antibody, it has a certain impact on the binding site on the antibody. However, the fusion protein expressed using genetic engineering technology is directionally expressed at the Fc end of the antibody, which avoids interference with the binding site on the antibody, thereby improving the antibody's affinity and anti-interference ability, and improving the accuracy of reagent detection.

[0231] 2. Stability Test

[0232] In Examples 1, 2, 3, Comparative Example 1, and Comparative Example 2, the acridine reagent components were kept consistent with the methodology and testing procedures described above for the correlation test. The samples included calibrators, quality control samples, and prepared samples. The calibrators were derived from different diluents: finished product CAL1, finished product CAL2, finished product CAL3, HXH CAL2, HXH CAL3, HKJP CAL2, and HKJP CAL3. The antigen was provided by YHL Biotech Co., Ltd. Quality control samples were purchased from Beckman Coulter. The mixed samples were prepared by the experiment based on the test values ​​of the clinical samples. The antibody components from the first test were accelerated at 37°C for 10 days, including the CA15-3 antibody-streptavidin fusion protein and biotin-acridone ester conjugate from Examples 1, 2, and 3; the CA15-3 antibody-SA conjugate and biotin-acridone ester conjugate from Comparative Example 1; and the CA15-3 antibody conjugated with an acridinone ester label from Comparative Example 2. All components were accelerated simultaneously. After acceleration, the same methodology and testing procedures were repeated. The results are as follows:

[0233] Table 2

[0234]

[0235] Table 3

[0236]

[0237] The test results above show that Table 2 shows the test results for calibrators, quality control samples, and serum-prepared samples, and Table 3 shows the test results for the stability of the reagents after 10 days of accelerated testing at 37°C. In the stability test results after 10 days of accelerated testing at 37°C, Examples 1, 2, and 3 showed an average value drop of approximately 5%, while Comparative Example 1 showed an average value drop of 20%, and Comparative Example 2 showed an average value drop of 18%. This demonstrates that the preparation method of fusion proteins expressed by genetic engineering technology exhibits significant advantages. Traditional conjugation labeling methods are more prone to chemical bond breakage during long-term storage, resulting in less stable conjugates. This indicates that reagents prepared by traditional chemical conjugation methods are more prone to value drop and have poorer stability during long-term storage.

[0238] 3. Inter-batch difference test

[0239] Three batches of reagents were prepared according to the reagent preparation methods of Example 1, Comparative Example 1, and Comparative Example 2, respectively, with the magnetic bead coating material remaining consistent. The testing methodology and procedures were consistent with the experiments described above. The test samples were calibrators and clinical samples. Then, the CV value (the ratio of standard deviation to mean) of the test results for the three batches of each reagent was calculated. The test results are shown in Tables 4-6 below:

[0240] Table 4

[0241]

[0242] Table 5

[0243]

[0244] Table 6

[0245]

[0246] The results of the batch-to-batch variation test show that the reagent corresponding to Comparative Example 1 has the smallest batch-to-batch variation, with an average CV value of less than 5%. The average CV value of Comparative Example 1 is about 15%, and the average CV value of Comparative Example 2 is about 9%.

[0247] Therefore, fusion protein reagents expressed using genetic engineering techniques can overcome the problem of large batch-to-batch variations in reagents prepared by traditional chemical coupling methods.

[0248] In summary, the fusion protein expressed by recombinant antibody and streptavidin through genetic engineering possesses dual functional characteristics of biotin-binding activity and antigen-binding function. Compared with traditional diagnostic reagents, its application in diagnostic reagents utilizes the specific binding characteristic of biotin-streptavidin, eliminating the need for direct labeling with luminescent materials, avoiding the influence of traditional chemical conjugation labeling on the site, and improving reagent accuracy. Furthermore, it solves the problem of batch-to-batch variability and also improves reagent stability.

[0249] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A CA15-3 antibody-streptavidin fusion protein, characterized in that, include: Anti-CA15-3 monoclonal antibody and streptavidin protein; The heavy chain constant region of the anti-CA15-3 monoclonal antibody is linked to the streptavidin protein via a linker peptide. The anti-CA15-3 monoclonal antibody can specifically bind to the CA15-3 antigen, and the streptavidin protein can bind to biotin.

2. The CA15-3 antibody-streptavidin fusion protein according to claim 1, characterized in that, The linker peptide includes a flexible linker peptide; Optionally, the structure of the flexible linker peptide is (GGGGS)n, where n is a positive integer; Optionally, the amino acid sequence of the flexible linker peptide is shown in SEQ ID NO.

2.

3. A CA 15-3 chemiluminescent detection kit characterized in that, The kit comprises the CA15-3 antibody-streptavidin fusion protein as described in any one of claims 1 to 2.

4. The CA15-3 chemiluminescent detection reagent kit according to claim 3, characterized by, The kit also includes one or more of acridinium ester-biotin conjugate and coatings that capture antibodies and magnetic microspheres; Optionally, the surface of the coating material to which the magnetic microspheres are attached has active groups.

5. The CA15-3 chemiluminescent detection reagent kit according to claim 4, characterized by, In the acridine ester-biotin conjugate, biotin is linked to acridine ester via an amide bond.

6. The CA15-3 chemiluminescent detection reagent kit according to claim 4, characterized by, The kit includes one or more of the following: standards, dilution buffer, protein protectant, washing solution, pre-excitation solution, and luminescence excitation solution.

7. A method for preparing the CA15-3 antibody-streptavidin fusion protein according to claim 1 or 2, characterized by, include: Screening for anti-CA15-3 monoclonal antibodies; using genetic engineering techniques to link the gene of the anti-CA15-3 monoclonal antibody with the gene of streptavidin via a linker peptide; and, The fusion gene was cloned into an expression vector, transformed into host cells for expression, and the CA15-3 antibody-streptavidin fusion protein was prepared.

8. The method for preparing the CA15-3 antibody-streptavidin fusion protein according to claim 7, characterized in that, It meets one or more of the following conditions: (1) The expression vector includes the eukaryotic expression vector pCDNA3.1; (2) The host cells include CHO cells; (3) Purification includes: preliminary purification by affinity chromatography; desalting of the preliminary purified product; and fine purification by molecular sieve chromatography.

9. A CA 15-3 chemiluminescent assay method characterized in that, include: The sample to be tested is mixed with the CA15-3 antibody-streptavidin fusion protein according to any one of claims 1 or 2, the acrid ester-biotin conjugate according to any one of claims 3 to 6, and the coating of the capture antibody bound to the magnetic microspheres, and incubated. The incubated mixture is then tested.

10. The CA15-3 chemiluminescent assay method according to claim 9, wherein, include: S1. Provides magnetic microspheres coated with capture antibodies; S2. The sample to be tested, the magnetic microspheres coated with the capture antibody, and the detection antibody complex are mixed to form a reaction mixture, and the reaction is incubated at 36℃-38℃; the detection antibody complex contains CA15-3 antibody-streptavidin fusion protein and biotin-acridone ester conjugate; S3. Solid-phase separation and cleaning of the system after reaction S2; S4. Add acid and base reagents sequentially to the system after cleaning in S3 to induce a chemiluminescent reaction; and S5. Detect the chemiluminescent signal generated in S4, and calculate the content of CA15-3 antigen in the sample based on the signal.

Images