Isocitrate dehydrogenase kinase mutant and its use in the production of l-tryptophan
Patent Information
- Application Number
- CN202512019395.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-09-22
- Estimated Expiration
- 2045-12-30
AI Technical Summary
杆菌发酵生产 L-色氨酸中存在产量不稳定的技术问题,因此,仍需对大肠杆菌进行改造,以在提高 L-色氨酸产量
[0015]有益效果:表达异柠檬酸脱氢酶激酶突变体的菌种产L-色氨酸的产量较野生型增加15.96%。
Smart Images

Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an isocitrate dehydrogenase kinase mutant and its application in the production of L-tryptophan. Background Technology
[0002] L-Tryptophan is an important amino acid with a unique structure and function. It is an essential amino acid and plays many important physiological roles in the human body. Currently, L-Tryptophan is mostly produced using microbial fermentation, and *E. coli* is one of the most commonly used microbial strains in this process. However, utilizing *E. coli*... There are technical problems with unstable yield in the fermentation of Escherichia coli for L-tryptophan production. Therefore, it is still necessary to modify Escherichia coli to improve the yield of L-tryptophan.
[0003] In *E. coli*, isocitrate dehydrogenase kinase / phosphatase (AceK) controls the branching point between two central metabolic pathways: the TCA cycle and the glyoxylate cycle. The aceK protein has bifunctional activity: as an isocitrate dehydrogenase kinase, it phosphorylates and inactivates IDH; simultaneously, as a phosphatase, it dephosphorylates and activates IDH. Improvements can be made from the perspective of isocitrate dehydrogenase kinase / phosphatase. Summary of the Invention
[0004] The purpose of this invention is to increase the production of L-tryptophan.
[0005] This invention provides an isocitrate dehydrogenase kinase mutant, which is obtained by mutating E to G at position 26 of the amino acid sequence starting from SEQ ID NO.25.
[0006] The present invention provides a nucleotide sequence encoding the above-mentioned isocitrate dehydrogenase kinase mutant.
[0007] Further specifying, the nucleotide sequence is as shown in SEQ ID NO.23.
[0008] The present invention provides a recombinant vector containing the above-described nucleotide sequence.
[0009] The present invention provides a recombinant microbial cell containing the above-mentioned nucleotide sequence.
[0010] The present invention provides the application of the above-mentioned isocitrate dehydrogenase kinase mutant, the above-mentioned nucleotide sequence, the above-mentioned recombinant vector, or the above-mentioned recombinant microbial cell in the preparation of L-tryptophan or in providing sugar-acid conversion.
[0011] The present invention provides a method for producing L-tryptophan or providing sugar-acid conversion rate, which is obtained by fermenting Escherichia coli containing the above-mentioned nucleotides for at least 20 hours.
[0012] To further specify, the accession number for Escherichia coli is CGMCC NO.11073.
[0013] Furthermore, the carbon source of the fermentation medium is glucose, and the nitrogen source is yeast extract.
[0014] Further specifying, the fermentation medium consists of: 3.5 g / L potassium dihydrogen phosphate, 3.5 g / L dipotassium hydrogen phosphate, 6 g / L disodium hydrogen phosphate, 4 g / L ammonium sulfate, 0.1 g / L ferrous sulfate, 2.25 g / L citric acid monohydrate, 2 g / L yeast extract, 50 g / L propanesulfonic acid, 0.4 g / L magnesium sulfate, 28 g / L glucose, and 2 mL of component 3, with the remainder being water; component 3 consists of: 0.003 g / L manganese sulfate, 0.005 g / L zinc sulfate, 0.0005 g / L copper sulfate pentahydrate, and 0.003 g / L cobalt chloride hexahydrate, with the remainder being water; Alternatively, the solution could be 5.5 g / L magnesium sulfate heptahydrate, 5.5 g / L potassium dihydrogen phosphate, 4 g / L potassium chloride, 2 g / L diammonium hydrogen phosphate, 2 g / L yeast extract, 2 g / L citric acid, 1 g / L succinic acid, 2 g / L amino acids, 1 g / L polypeptide powder, 2.5 mL / L trace element stock solution, and 2.5 mL / L vitamin stock solution, with the remainder being water. The trace element stock solution could be composed of 38.08 g / L ferrous sulfate heptahydrate, 2.37 g / L manganese sulfate monohydrate, 10 g / L sodium sulfate, 3.2 g / L zinc sulfate, 2 g / L cobalt chloride hexahydrate, and 0.3 g / L anhydrous copper sulfate. The vitamin stock solution could be composed of 0.025 g / L VB12, 0.055 g / L VH, and 0.255 g / L VB1, with the remainder being water.
[0015] Beneficial effects: The strains expressing the isocitrate dehydrogenase kinase mutant produced 15.96% more L-tryptophan than the wild type. Detailed Implementation
[0016] The starting strain CGMCC NO.11073 Escherichia coli used in this invention is disclosed in the invention patent with authorization announcement number CN118389394B. The p118 plasmid gene is shown in SEQ ID NO.27, and the p26D plasmid gene is shown in SEQ ID NO.28.
[0017] Example 1. Method for preparing isocitrate dehydrogenase kinase mutant 1. Preparation method of isocitrate dehydrogenase kinase mutant: The genome of the preserved strain CGMCC NO.11073 was extracted, and PCR amplification of the repair template was performed using two pairs of primers, aceK-up-F and aceK-up-R, and aceK-down-F and aceK-down-R, respectively. The resulting samples were 521 bp and 517 bp in size. Using the p26D gene editing vector as a template, the vector fragment was amplified using vector-aceK-F and Vetor-aceK-R primers, with a size of 3198 bp; PCR amplification was performed using Vazyme 2*Phanta Flash Master Mix under the following conditions: 98°C for 5 min 1×, 98°C for 10 s, 56°C for 25 s, 72°C for 5 s / kb, 30×, 72°C for 5 min 1×, 4°∞.
[0018] aceK-up-F: aaacaaataggggttccgcgTCTTGAAGCATTGCCCAGCC (SEQ ID NO.1); aceK-up-R: GTAAAGCTTCCATATAATTTTTCTCCGCAATG (SEQ ID NO.2); aceK-down-F: CATTGCGGAGAAAAATTATATGGAAGCTTTACTTAGCGCCCTCATCAGGAG (SEQ ID NO.2) NO.3); aceK-down-R: GCGTATTGGTCCGCTGTTTGactagtattatacctaggactgagctagctgtcaaAATATCCGGGCAAACTGCTG (SEQ ID NO.4); p26D-Vetor-F: cagtcctaggtataatactagtCAAACAGCGGACCAATACGCGTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.5); p26D-Vetor-R: cgcggaacccctatttgttt (SEQ ID NO.6); p26D-test-F: gcgacacggaaatgttgaatac (SEQ ID NO.7); p26D-test-R: gggatccttaatGATCCTTACTCG (SEQ ID NO.8); aceK-genome-test-F: CTGGCCGCAACACATCATTT (SEQ ID NO.9); aceK-genome-test-R: TTCCAACCCTGCTGGTTGC (SEQ ID NO.10).
[0019] After amplification, the fragments were recovered using the OmegaE.ZNA Gel Extraction Kit. During vector fragment amplification, the fragments were digested with Thermo DpnI at 37°C for 15 min followed by gel extraction. The three fragments were ligated using the NEBUILDER HiFi DNA assembly master mix according to the manufacturer's instructions to obtain the recombinant vector. This vector was then chemically transformed into TOP10 or DH5α competent cells and cultured upside down at 30°C on LB solid medium containing ampicillin for 12-16 h. Single colonies were selected using an ampicillin antibiotic concentration of 50 mg / ml and validated using p26D-test-F and p26D-test-R. The PCR reaction program using Novizan P131-02 Green Taq Mix was as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 20 s, 57°C annealing for 20 s, 72°C extension for 1 min 30 s, for a total of 35 cycles; 72°C extension for 5 min. Cells with a size of 1338 were selected. The bp fragment was sent to Sangon Biotech for sequencing. The correctly sequenced transformants were preserved and plasmids were extracted and named pXY801. CGMCC NO.11073 strain was prepared into electrochemically competent cells and transformed into the p118 plasmid. Correct transformants were screened and further prepared into electrochemically competent cells, which were then transformed into the pXY801 plasmid. The cells were incubated upside down at 30°C in culture media containing tetracycline (50 mg / ml), ampicillin (50 mg / ml), and kanamycin (50 mg / ml) antibiotics. After 12-16 h of incubation, single colonies were inoculated into 5 ml of double-antibiotic LB agar, and IPTG (1 mM) and L-arabinose (20 mM) were added for induction at 30°C and 220 rpm for 5 h. The bacterial culture was then diluted to 10⁻⁶. -6 Take 200 μL and spread it evenly on double-antibiotic solid LB medium. After incubation for 12-16 h, take single colonies for colony PCR verification. Using aceK-genome-test-F and aceK-genome-test-R primers, amplify to a size of 1556 bp. Select PCR products with the correct fragment size and send them to Sangon Biotech for sequencing. Preserve the correctly sequenced transformants. Then, perform gene editing plasmid loss. Inoculate the correctly sequenced strain into 5 mL of medium, add 200 μL of 50% sucrose to 5 mL of tetracycline-resistant medium, and incubate at 37°C and 220 rpm for 12-16 h. Dilute the bacterial culture to 10... -6Take 200 μL and spread it evenly on tetracycline-resistant solid LB medium. After incubation for 12-16 h, take single colonies for point verification. Streak single colonies on tetracycline-resistant medium, tetracycline-resistant and kanamycin-resistant solid medium, and tetracycline-resistant and ampicillin-resistant solid medium respectively. Select colonies that do not grow on tetracycline, ampicillin and tetracycline-resistant and kanamycin plates but grow on tetracycline-resistant medium and name the preserved strain XYWb227.
[0020] 2. Preparation method of aceK E26G mutant: Using the genome of CGMCC NO.11073 as template DNA, PCR amplification of the repair template was performed using two pairs of primers, mbhA-up-F and mbhA-up-R and mbhA-down-F and mbhA-down-R, with sizes of 549 bp and 573 bp, respectively. Using the aceK E26G mutant sequence as a template (gene sequence shown in SEQ ID NO.23), the target gene was amplified using aceKE26G-F and aceK E26G-R primers, with a size of 1792 bp. Using the p26D gene editing vector as a template, the vector fragment was amplified using vector-mbhA-F and Vetor-mbhA-R primers to obtain the p26D gene editing vector backbone, which was 3185 bp in size. PCR amplification was performed using Vazyme 2*Phanta Flash Master Mix under the following conditions: 98°C for 5 min 1×, 98°C for 10 s, 56°C for 25 s, 72°C for 5 s / kb, 30×, 72°C for 5 min 1×, 4°∞.
[0021] mbhA-up-F:aaaaataggggttccgcggtcagttgcagctcgttgaag(SEQ ID NO.11;mbhA-up-R:ATCCGCTCACAATTCCACACATTATACGCCGGATGATTAATTGTCAAatgctgaatctctctcg(SEQ ID NO.11; NO.12);aceK E26G-F:CTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCCGCGTGGCCTGGAATTATTG(SEQ ID NO.13;aceK E26G-R:TCAAAACCATACATGGGAATTAQG: NO.14);mbhA-down-F:CGGTATGGGGAGATGCTTTTTTGAgctgttgacaatcaactttattgtcg(SEQ ID NO.15);mbhA-down-R:actagtattatacctaggactgagctagctgtcaacgccagcacgaa SEQ(ID) NO.16);p26D-Vetor-F:cagtcctaggtataatactagtAATCAGCACGCGTAATCCCTGTTTTAGAGCTAGAAATAGCAAG(SEQ ID NO.17);p26D-Vetor-R:cgcggaacccctatttgttt(SEQ ID NO.18);p26D-test-F:cagggttattgtctcatgagcg(SEQ IDNO.19;p26D-test-R:ctcacaaggcaaatatagagattagcc(SEQ ID NO.20);mbhA-genome-test-F:aaccaagcagggcgctgaac(SEQ ID NO.21;mbhA-genome-test-R:cgttcgctgttaacatcgcg(SEQ ID NO.22)。
[0022] After amplification, the fragments were recovered using the OmegaE.ZNA Gel Extraction Kit. During vector fragment amplification, the fragments were digested with Thermo DpnI at 37°C for 15 min before gel extraction. Four fragments were ligated using the NEBUILDER HiFi DNA assembly master mix according to the manufacturer's instructions to obtain the recombinant vector. This vector was then chemically transformed into TOP10 or DH5α competent cells and cultured upside down at 30°C on LB solid medium containing ampicillin for 12-16 h. Single colonies were selected using an ampicillin antibiotic concentration of 50 mg / ml. Single colonies were validated using p26D-test-F and p26D-test-R. The PCR reaction program using Novizan P131-02 Green Taq Mix was as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 20 s, 57°C annealing for 20 s, 72°C extension for 1 min 30 s, for a total of 35 cycles; 72°C extension for 5 min. Cells with a size of 3105 were selected. The bp fragment was sent to Sangon Biotech for sequencing. The correctly sequenced transformants were preserved and plasmids were extracted and named pXY810.
[0023] CGMCC strain NO.11073 was prepared into electrochemically competent cells, and its preserved strain was named XYWb227. The cells were transformed into the p118 plasmid, and correct transformants were screened. These were then further prepared into electrochemically competent cells and transformed into the pXY810 plasmid. The cells were cultured upside down at 30°C in culture media containing tetracycline (50 mg / ml), ampicillin (50 mg / ml), and kanamycin (50 mg / ml) antibiotics. After 12-16 h of culture, a single colony was inoculated into 5 ml of double-antibiotic LB agar. IPTG (working concentration 1 mM) and L-arabinose (working concentration 20 mM) were added for induction at 30°C and 220 rpm for 5 h. The bacterial culture was then diluted to 10⁻⁶. -6 Take 200 μL and spread it evenly on double-antibiotic solid LB medium. After incubation for 12-16 h, take single colonies for colony PCR verification. Use mbhA-genome-test-F and mbhA-genome-test-R primers to amplify a size of 2108 bp. Select PCR products with the correct fragment size and send them to Sangon Biotech for sequencing. Store the correctly sequenced transformants. Then, perform gene editing plasmid loss analysis. Inoculate the correctly sequenced strain into 5 mL of medium, add 200 μL of 50% sucrose to 5 mL of tetracycline-resistant medium, and incubate at 37°C and 220 rpm for 12-16 h. Dilute the bacterial culture to 10⁻⁶. -6Take 200 μL and spread it evenly on tetracycline-resistant solid LB medium. After incubation for 12-16 h, take single colonies for point verification. Streak single colonies on tetracycline-resistant medium, tetracycline-resistant and kanamycin-resistant solid medium, and tetracycline-resistant and ampicillin-resistant solid medium respectively. Select colonies that do not grow on tetracycline, ampicillin and tetracycline-resistant and kanamycin plates but grow on tetracycline-resistant medium and name the preserved strain XYWb230.
[0024] aceK E26G gene: (SEQ ID NO.23); aceK E26G amino acid: (SEQ ID NO.24); wild-type aceK amino acid (SEQ ID NO.25); wild-type aceK gene: (SEQ ID NO.26).
[0025] Example 2. Method for obtaining L-tryptophan 1. Strain activation: After removing the XYWb230 and CGMCC NO.11073 bacterial strains from the -80℃ freezer and allowing them to thaw naturally, use an inoculation loop to apply two loops of the strains to a plate culture medium under sterile conditions. Incubate at 36.5℃ upside down for 16 hours.
[0026] 2. Preparation of shake flask culture medium: Sterilization of baffle bottles: Seal 500 ml baffle bottles tightly with ten layers of gauze and long-staple cotton, wrap them securely with kraft paper, and then secure with rubber bands. Sterilize at 121℃ for 20 minutes, then dry in an oven. The formula is as follows: The seed culture medium formula is as follows: 22.5 g / L dipotassium hydrogen phosphate, 9 g / L potassium dihydrogen phosphate, 15 g / L yeast extract, 4 g / L ammonium sulfate, 2 g / L magnesium sulfate, 25 g / L glucose, with the balance being water, and the pH is 7.15. The fermentation medium used in this experiment consisted of the following components: potassium dihydrogen phosphate 3.5 g / L, dipotassium hydrogen phosphate 3.5 g / L, disodium hydrogen phosphate 6 g / L, ammonium sulfate 4 g / L, ferrous sulfate 0.1 g / L, citric acid monohydrate 2.25 g / L, yeast extract 2 g / L, propanesulfonic acid 50 g / L, 3.2 mL of feedstock, magnesium sulfate 0.4 g / L, and glucose 28 g / L. Formula for ingredient 3: 0.003 g / L manganese sulfate, 0.005 g / L zinc sulfate, 0.0005 g / L copper sulfate pentahydrate, 0.003 g / L cobalt chloride hexahydrate, with the balance being water.
[0027] 3. Inoculum: The shaker is pre-sterilized and preheated with UV light. The cultured plates are removed, and under aseptic conditions, a loopful of inoculum is scraped and inoculated into a seed culture flask. After inoculation, the flask opening is completely sealed with gauze and secured with a rubber band. The UV light on the shaker is turned off, and the seed culture flask is placed in the shaker and incubated at 36.5℃ and 170 rpm. OD 660nm Transplanting is possible after approximately 8-10 days.
[0028] 4. Proceed with fermentation: Remove the cultured seed flask from the shake flask, and under sterile conditions, aspirate 5 ml of bacterial culture into the fermentation shake flask, bringing the final volume to 50 ml. Wrap the fermentation shake flask and place it on a shaker, incubating at 36.5℃ and 200 rpm for approximately 20-24 hours.
[0029] 5. Judgment based on the shaker: Shake the flask before the sugar is completely consumed; when shaking the flask, ensure that the pH is within a suitable range and that the residual sugar has not been completely consumed.
[0030] The tryptophan content was determined by HPLC, and the fermentation results are shown in Table 1 below: The two replicates of the bacterial culture with accession number CGMCC NO.11073 are CGMCC NO.11073-1 and CGMCC NO.11073-2. XYWb230-1 and XYWb230-2 are also two replicates.
[0031] Table 1
[0032] The formula for the increase rate of L-tryptophan concentration in XYWb230-1 is: XYWb230-1% = [XYWb230-1 - (CGMCCNO.11073-1 + CGMCC NO.11073-2) / 2] / (CGMCC NO.11073-1 + CGMCC NO.11073-2) / 2; The formula for the increase rate of L-tryptophan concentration in XYWb230-2 is: XYWb230-2% = [XYWb230-2 - (CGMCCNO.11073-1 + CGMCC NO.11073-2) / 2] / (CGMCC NO.11073-1 + CGMCC NO.11073-2) / 2.
[0033] Example 3. Production of L-tryptophan by 10 L fermentation of modified strain 1. Seed activation: Inoculate glycerol bacteria into seed culture medium at an inoculum size of 2% and incubate at 200 rpm until OD reaches 200%. 660nm Values 4-8; 2. Inoculation: Inoculate the seed culture and base sugar together into a 10 L fermenter. The inoculation amount is 5-10%, the base sugar is 20 g, and the pH is adjusted to 6.5-7.2.
[0034] 3. Fermentation control: After the base sugar is consumed, start adding sugar at a concentration of 50%, maintain the residual sugar concentration below 0.05%, and ferment for 60 hours.
[0035] Formula for a 10 L fermenter: 5.5 g / L magnesium sulfate heptahydrate, 5.5 g / L potassium dihydrogen phosphate, 4 g / L potassium chloride, 2 g / L diammonium hydrogen phosphate, 2 g / L yeast extract, 2 g / L citric acid, 1 g / L succinic acid, 2 g / L amino acids, 1 g / L polypeptide powder, 2.5 mL / L trace element stock solution and 2.5 mL / L vitamin stock solution; The trace element stock solution consists of: 38.08 g / L ferrous sulfate heptahydrate, 2.37 g / L manganese sulfate monohydrate, 10 g / L sodium sulfate, 3.2 g / L zinc sulfate, 2 g / L cobalt chloride hexahydrate and 0.3 g / L anhydrous copper sulfate.
[0036] The composition of the trace element mother liquor is as follows: 38.08 g / L ferrous sulfate heptahydrate, 2.37 g / L manganese sulfate monohydrate, 10 g / L sodium sulfate, 3.2 g / L zinc sulfate, 2 g / L cobalt chloride hexahydrate, 0.3 g / L anhydrous copper sulfate, balance water.
[0037] The composition of the vitamin stock solution is as follows: 0.025 g / L VB12, 0.055 g / L VH, 0.255 g / L VB1, with the balance being water.
[0038] Table 2
Claims
1. An isocitrate dehydrogenase kinase mutant, characterized in that, The isocitrate dehydrogenase kinase mutant was obtained by mutating glutamic acid at position 26 to glycine, starting with SEQ ID NO.
25.
2. The gene encoding the isocitrate dehydrogenase kinase mutant of claim 1.
3. The gene according to claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.
23.
4. A recombinant vector containing the gene described in claim 3.
5. A recombinant microbial cell containing the gene of claim 3, characterized in that, The starting microbial cell was Escherichia coli, and the preservation number of the Escherichia coli was CGMCC NO.11073.
6. The use of the recombinant microbial cells according to claim 5 in the preparation of L-tryptophan or in improving the sugar-acid conversion rate.
7. A method for producing L-tryptophan or improving the sugar-acid conversion rate, characterized in that, The Escherichia coli containing the gene described in claim 2 or 3 is obtained by fermenting for at least 20 hours, with the starting microbial cell being Escherichia coli and the preservation number of said Escherichia coli being CGMCC NO.11073.
8. The method according to claim 7, characterized in that, The carbon source of the fermentation medium is glucose, and the nitrogen source is yeast extract.
Citation Information
Patent Citations
A genetically engineered bacterium for increasing L-tryptophan production and its construction method and application
CN118389394B
An L-amino acid-producing bacterium and a method for producing an L-amino acid
CN101273054A
Isocitrate dehydrogenase kinase mutant and application thereof in preparation of aromatic amino acids
CN111286496A