A (+)-naltrexone derivative and its use in the treatment of amphetamine-type drug addiction

Abstract

The application discloses a (+) -naltrexone derivative and application thereof in treatment of amphetamine drug addiction. The (+) -naltrexone derivative has significantly improved anti-neuroinflammatory activity compared with (+) -naltrexone, the anti-inflammatory activity of most derivatives is improved by more than 1000 times, and the highest activity is even improved by more than 10000 times.

Description

Technical Field

[0001] This invention belongs to the field of medicinal chemistry technology, specifically relating to a (+)-naltrexone derivative and its application in the treatment of amphetamine addiction. Background Technology

[0002] Amphetamines are a class of synthetic organic amine stimulants with the basic chemical structure of β-phenylethylamine. Substitution of different groups on the phenylethylamine core produces various derivatives with different pharmacological activities and toxicities. Methamphetamine (METH), also known as crystal meth, is a colorless, transparent crystalline substance resembling ice. It has an extremely strong stimulating effect on the central nervous system and is highly addictive. Methamphetamine has become one of the most abused drugs globally, prevalent to varying degrees in Asia, the Americas, and Europe. Especially in drug production and trafficking hotspots, such as the Golden Triangle region of Southeast Asia and parts of South America, methamphetamine manufacturing and smuggling activities are rampant. According to a report by the United Nations Office on Drugs and Crime (UNODC), the number of methamphetamine addicts worldwide is increasing year by year. Methamphetamine addiction not only causes great harm to the physical and mental health of individuals but also places a heavy burden on families and society. In recent years, methamphetamine abuse has become increasingly prominent in China, surpassing heroin to become the most abused drug. The abusers are increasingly younger and more diverse, encompassing different professions and social classes.

[0003] Currently, there are no marketed drugs specifically for amphetamine addiction. Clinically, monoamine neurotransmitter replacement therapy is mainly used, such as Adderall: its main component is amphetamine salt, which has a similar mechanism of action to methamphetamine. It can regulate dopamine levels in the brain and theoretically alleviate symptoms such as poor concentration and fatigue after detoxification. However, it is addictive itself, and improper use can lead to new drug dependence. Amantadine can promote dopamine release and enhance dopamine function. Although it can alleviate withdrawal symptoms in methamphetamine addicts to some extent, such as depression and weakness, the efficacy varies greatly from person to person, and the effect is not significant for some patients. Therefore, there is an urgent need to develop drugs specifically for amphetamine addiction. Summary of the Invention

[0004] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0005] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0006] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a (+)-naltrexone derivative and its application in the treatment of amphetamine addiction.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a (+)-naltrexone derivative, characterized in that: the general structural formula of the (+)-naltrexone derivative is shown in formula (I): (I) The skeletal structure is an opioid structure containing rings A, B, C, D, and E, wherein the C6 position is a ketone carbonyl group, the C7 and 8 positions are alkenyl groups, and the C14 position is a hydroxyl group. R1 is selected from straight-chain alkanes such as ethyl, propyl, and butyl; branched alkanes such as isopropyl and isobutyl; alkyl chains such as ethyl and propyl with halogen atoms at the end; alkyl chains such as ethyl and propyl with hydroxyl atoms at the end; and one of allyl, propargyl, acryloyl, sulfonyl fluoride, cyclopropylmethyl, glycidyl, cyclobutylmethyl, oxacyclobutylmethyl, cyclopentylmethyl, acetyl, and propionyl. R2 is selected from C1-C6 alkyl groups, or C1-C6 alkyl groups with cyclopropyl, glycidyl, cyclobutyl, glycidyl, cyclopentyl, glycidyl, cyclohexyl, or benzene rings at the end; aromatic rings with different substituents; and heteroatom-containing aromatic rings such as pyridine, indole, quinoline, and benzofuran.

[0008] Another object of the present invention is to overcome the deficiencies in the prior art and provide a (+)-naltrexone derivative drug comprising the o-phenylenediamine borane derivative shown in formula (I).

[0009] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of (+)-naltrexone derivatives in the treatment of neuroinflammation.

[0010] Another object of the present invention is to overcome the shortcomings of the prior art and provide an application of (+)-naltrexone derivative in the treatment or prevention of addiction caused by amphetamine drugs.

[0011] As a preferred embodiment of the application described in this invention, the formula (I) is administered at a dose of 0.01 to 100 mg / kg.

[0012] As a preferred embodiment of the application described in this invention, the amphetamine-type drugs include, but are not limited to, methamphetamine, amphetamine, 3,4-methylenedioxyamphetamine, 3,4-methylenedioxymethamphetamine, and their chiral enantiomers, derivatives, and precursors.

[0013] As a preferred embodiment of the application described in this invention, formula (I) can be used in conjunction with a pharmacologically acceptable excipient.

[0014] As a preferred embodiment of the application described in this invention, the administration methods include, but are not limited to, oral, subbuccal, sublingual, rectal, vaginal, intravenous, intra-arterial, intramedullary, intramuscular, intracerebral, intraventricular, intraspinal, subcutaneous, intraperitoneal, intraocular, intranasal, transdermal, epidural, intracranial, intrauterine, intravitreal, mucosal, and inhaler-mediated administration.

[0015] Beneficial effects of this invention: This invention relates to the application of a (+)-naltrexone derivative in the treatment of neuroinflammation. The invention discovers that the C3 hydroxyl site is a key site for regulating the neuroinflammation treatment of (+)-naltrexone derivatives. By introducing different short-chain alkanes, cyclic alkanes, etc., into the C3 hydroxyl site, its anti-neuroinflammatory activity is significantly improved compared to the parent nucleus structure (+)-naltrexone, with an improvement of 1000 to 10000 times or more. This invention also relates to the application of the (+)-naltrexone derivative CIAC101 in anti-neuroinflammatory and amphetamine addiction treatment. This compound exhibits potential for treating methamphetamine addiction at extremely low doses (0.2 mg / kg or even 0.02 mg / kg) at the individual level. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein: Figure 1 The synthetic routes for compounds 1-4 in the embodiments of the present invention are shown below.

[0017] Figure 2 The chemical structures of compounds 1-6 in the embodiments of the present invention are shown.

[0018] Figure 3 The chemical structures of compounds 7-25 in the embodiments of the present invention are shown.

[0019] Figure 4 Examples of compound CIAC101: 1H NMR and 1C NMR spectra.

[0020] Figure 5This is a high-resolution mass spectrum of compound CIAC101 from an embodiment of the present invention.

[0021] Figure 6 This is a high-performance liquid chromatogram of compound CIAC101 from an embodiment of the present invention.

[0022] Figure 7 This is a dose-dependent inhibition diagram of the anti-inflammatory factor NO by a representative compound from the embodiments of the present invention; wherein, Figure 7 (A) is compound 8. Figure 7 (B) is compound 17 (CIAC101). Figure 7 (C) is compound 18. Figure 7 (D) is compound 21. Figure 7 (E) is compound 22. Figure 7 (F) is compound 25.

[0023] Figure 8 In this embodiment of the invention, compound CIAC101 inhibits lipopolysaccharide (LPS)-induced pro-inflammatory gene expression in BV-2 microglia; wherein, Figure 8 (A) is the inducible nitric oxide synthase (iNOS) in cells treated with LPS (200 ng / mL). Figure 8 (B) is interleukin-1β (IL-1β). Figure 8 (C) represents tumor necrosis factor-α (TNF-α). Figure 8 (D) represents interleukin-6 (IL-6). ((+)-Naltrexone ((+)-NTX) served as the control group. Data are expressed as mean ± standard error. Compared with the blank control group, ***p<0.001, ****p<0.0001; compared with the LPS treatment group, #p<0.05, ##p<0.01, ###p<0.001, ####p<0.0001, ns indicates no significant difference.) Figure 9 In this embodiment of the invention, compound CIAC101 can alleviate methamphetamine (METH)-induced behavior; wherein, Figure 9 (A) is a schematic diagram of the behavioral sensitization experimental protocol. Figure 9 (B, C) show the effects of CIAC101 on METH-induced sensitization in the developmental (B) and expression (C) stages. Figure 9 (D) is a schematic diagram of the conditional position preference (CPP) experimental design. Figure 9(E) Effect of CIAC101 on METH-induced CPP. (Data are expressed as mean ± standard error, N = 6-8 mice per group; ***P < 0.001, ****P < 0.0001 compared with saline group; ns indicates no significant difference compared with control group; compared with METH group, ...) ## P<0.01, ### P<0.001, #### P < 0.0001; NS indicates no significant difference compared to the METH group; when comparing the control group and the METH group, the following method was used. t Statistical analysis was performed. One-way ANOVA was used to compare the METH group with different drug treatment groups; (+)-NTX refers to (+)-Naltrexone (2 mg / kg). Detailed Implementation

[0024] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0025] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0026] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0027] Unless otherwise specified, all raw materials and reagents used in this invention are reagent-grade and require no further purification before use. The products were characterized by nuclear magnetic resonance spectroscopy (NMR) and high-resolution mass spectrometry (HRMS). 1 H and 13¹H NMR spectra were recorded on a Bruker Ultra Shield™ spectrometer (300 MHz or 500 MHz) in deuterated chloroform (CDCl3) or deuterated methanol (MeOD). Chemical shifts are expressed as δ in parts per million (ppm), using tetramethylsilane or solvent as internal standards. The coupling constant of ¹H is expressed in J (Hz). Splitting modes in the spectra are represented as follows: singlet (s), doublet (d), triplet (t), quartet (q), doublet (dd), doubletuplet (dt), tripletuplet (td), and overlapping signals are denoted as multiplets (m). High-resolution mass spectrometry was performed using an LTQ Orbitrap Velos Pro mass spectrometer. Purification was performed using rapid column chromatography with reagent-grade silica gel (200-300 mesh) and a methanol / dichloromethane mixture containing 0.5% ammonium hydroxide as the eluent. The reaction progress was monitored on analytical silica gel thin-layer plates by UV light or iodine fuming. The purity of all tested compounds was greater than 95% by Waters Alliance 2695 series high-performance liquid chromatography (HPLC) equipped with a reversed-phase column (Symmetry C18 5 µm, 4.6 × 250 mm). The mobile phase was a methanol / water mixture (9:1 v / v), and detection was performed at 280 nm using a 2489 detector. The flow rate was maintained at 0.5 mL / min, and the column temperature was maintained at 30 °C.

[0028] Cell culture: BV-2 cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The incubator was maintained at 37°C, 95% humidity, and 5% CO2.

[0029] Nitric oxide (NO) detection: BV-2 cells were stored at 5 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates. After 24 hours, the medium was removed and replaced with DMEM medium free of FBS and penicillin-streptomycin. LPS (200 ng / mL) and a series of compound concentrations were added. After 24 hours of treatment, 100 µL of medium was transferred to flat-bottomed black 96-well microplates. 10 µL of 0.05 mg / mL 2,3-diaminonaphthalene was introduced, followed by incubation in the dark for 15 minutes. The reaction was terminated by adding 5 µL of 3 M NaOH to each well. NO inhibition rate was measured using a SYNERGY H1 microplate reader (BioTek Instruments) at excitation and emission wavelengths of 360 nm and 430 nm, respectively. The fluorescence values ​​of the group treated with LPS only were used as a 100% reference.

[0030] Quantitative real-time polymerase chain reaction (qRT-PCR): Total RNA was extracted from cells or mouse brain using the RNeasy Mini kit. Following the manufacturer's instructions, the isolated RNA was reverse transcribed into cDNA using the RT2 Easy First Strand cDNA synthesis kit. Subsequent PCR amplification employed synthetic primers, SYBR Green assay, and the TOptical real-time qPCR thermal cycler from Analytick Jena in Jena, Thuringia, Germany. Data analysis was performed using the ΔΔCt method, with Rpl7l1 as an internal control gene.

[0031] The primer sequences for qRT-PCR are as follows: Rpl7l1 (forward: ACGGTGGAGCCTTATGTGAC; reverse: TCCGTCAGAGGACTGTCTT), TNF-α (forward: CCCTCCAGAAAAGACACCATG; reverse: GAGATTGAAGCTGGATGCT), IL-1β (forward: CCACCTTTTGACAGTGATGA; reverse: GAGATTGAAGCTGGATGCT), IL-6 (forward: TAGTCCTTCCTACCCCAATTTCC; reverse: TTGGTCCTTAGCCACTCCTTC).

[0032] Animal housing: Male C57 mice aged 6-8 weeks and weighing 20-28 g were housed in a temperature-controlled environment (21-24°C) following a 12-hour day-night cycle, with lights turned on at 08:00 AM. Mice had free access to standard rodent food and water and were allowed at least one week to acclimatize to the environment before any experimental procedures were performed.

[0033] Behavioral sensitization testing: All mice underwent behavioral sensitization testing in a 40cm × 40cm × 40cm gray acrylic open field chamber. The testing process was recorded by a camera suspended two meters above the mice, and the distance each mouse moved during the test was analyzed using EthoVision XT computer software. Based on the preliminary experimental results, the mice were randomly divided into groups of eight.

[0034] Days 1-3: For three consecutive days, each group of mice was placed in an open field for 1 hour to acclimatize to the environment.

[0035] Days 4-10: All mice were randomly assigned to groups and treated accordingly: saline + saline, saline + methamphetamine (METH, 1 mg / kg), METH + CIAC101 (0.2, 0.02, and 0.005 mg / kg), and METH + (+)-naltrexone (2 mg / kg). Mice in each group were pretreated with saline or different doses of the compounds (CIAC101 and (+)-naltrexone) for 30 minutes before being intraperitoneally injected with saline or methamphetamine. Immediately after injection, the mice were placed in an open field for observation for 1 hour.

[0036] Days 11-17 (withdrawal period): Mice in all groups received no treatment.

[0037] Day 18: Mice were injected with 1 mg / kg of METH. After injection, the mice were placed in an open field for observation for 1 hour.

[0038] Conditioned Place Preference (CPP) Test: CPP was evaluated using an unbiased protocol in a three-chamber PVC apparatus. The apparatus consisted of two large chambers (15 cm × 15 cm × 40 cm) and a smaller central chamber (5 cm × 5 cm × 40 cm); the large chambers had different floor textures (stripes or grids) and wall colors (black or white) to provide different environmental cues. Mouse behavior was recorded by an overhead camera positioned 2 meters above the apparatus and analyzed using an EthoVision XT.

[0039] Days 1-2: Allow the mice to acclimatize to the device for 15 minutes each day.

[0040] Day 3: Each mouse was allowed to freely explore all compartments for 15 minutes to determine its baseline preference; drug pairing compartments were balanced among different animals.

[0041] Days 4-11: Mice were then randomly divided into groups of 6-8 mice each, and immediately after treatment, underwent 30 minutes of conditioning training, as follows: (i) On the day of medication, administer METH (2.0 mg / kg) intraperitoneally, and on the next day, administer saline.

[0042] (ii) On the first day of medication, administer an intraperitoneal injection of CIAC101 or (+)-naltrexone (0.2 mg / kg), followed by an injection of METH (2.0 mg / kg) 30 minutes later. On the next day, administer the same compound followed by an injection of saline.

[0043] (iii) On the first day of medication, administer an intraperitoneal injection of CIAC101 or (+)-naltrexone (0.2 mg / kg), followed by an injection of normal saline 30 minutes later. On the next day, administer only normal saline.

[0044] Day 12: Mice were allowed free access to all compartments for 15 minutes in a drug-free state. The time (in seconds) each mouse spent in each compartment was recorded. The CPP score was calculated by subtracting the time spent in the saline-paired compartment from the time spent in the drug-paired compartment.

[0045] Example 1: Synthesis and characterization data of compounds 1-4 Synthesis of compound B: (+)-sinomenine (A, 35.00 g, 95.67 mmol) was dissolved in MeOH (600 mL), and 5% palladium on carbon (2.00 g, 0.94 mmol) was added. The mixture was stirred at room temperature under H2 balloon bubbling. After the reaction was completed as detected by TLC, the mixture was filtered and the solvent was removed under reduced pressure to give crude white solid product B (33.43 g). Compound B was directly added to the next step without purification.

[0046] Synthesis of Compound C: Crude product B (33.43 g) was dissolved in chloroform (320 mL), and methanesulfonic acid (165 mL) was slowly added at room temperature. The mixture was heated to 70 °C and refluxed for 3 h. After the reaction was monitored by TLC and mass spectrometry, the mixture was cooled to 0 °C and then alkalized with 30% ammonia in an ice bath. The above mixed solution was extracted using a separatory funnel, and the aqueous phase was extracted with chloroform. The resulting organic phase was washed with water and saturated brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to give a yellow oily liquid. The crude product was dissolved in a mixture of ethanol: water (70%, 100 mL) and (+)-tartaric acid (14.36 g, 95.67 mmol). The mixture was heated until dissolved, and then the homogeneous solution was cooled to 0 °C in an ice-water bath. The resulting solid was filtered and washed with cold ethanol. The solution obtained in the above steps was recrystallized, and the solid was collected. The collected solid was dissolved in DCM, washed with sodium hydroxide (1 N) and water, dried with sodium sulfate, and concentrated under reduced pressure to obtain white solid C (16.5 g, 57%). 1 H NMR (300 MHz, CDCl3) δ 6.63 (dd, J = 20.0, 8.2 Hz, 2H), 4.64 (s,1H), 3.86 (s, 3H), 3.19 (dd, J = 5.3, 2.8 Hz, 1H), 3.00 (d, J = 18.6 Hz, 1H),2.68 – 2.49 (m, 2H), 2.42 (s, 3H), 2.40 – 2.00 (m, 5H), 1.88 – 1.71 (m, 2H),1.35 – 1.05 (m, 1H).13 C NMR (75 MHz, CDCl3) δ 207.76, 145.30, 142.80, 127.04,125.89, 119.74, 114.40, 91.26, 59.22, 56.63, 46.81, 46.71, 42.72, 42.32,40.10, 35.23, 25.44, 19.95. HRMS (ESI + ) m / z calc'd for [M+H] + : 300.1594; found 300.1585. Synthesis of Compound D: Compound C (1.0 g, 3.34 mmol) and trimethyl orthoformate (1.46 mL, 13.38 mmol) were dissolved in 12 mL of methanol. Concentrated sulfuric acid (0.27 mL, 5.02 mmol) was slowly added dropwise to the mixture. The mixture was heated under reflux for 2 h. After the reaction was monitored by TLC and mass spectrometry, the mixture was cooled to room temperature and alkalized with 30% ammonia. DCM was added to the mixture and extracted three times. The organic phase was collected, washed with water and saturated sodium chloride, and dried over sodium sulfate. The solvent was removed under reduced pressure to obtain a crude intermediate. The crude intermediate, trimethyl orthoformate (0.56 mL, 5.18 mmol), and p-toluenesulfonic acid (1.34 g, 7.78 mmol) were added to 25 mL of dichloroethane. The reaction mixture was heated, and the solvent was slowly distilled until the solvent volume was half of the initial volume. After the reaction was monitored by TLC and mass spectrometry, the mixture was cooled to 0°C and alkalized with 30% ammonia solution. The mixture was then separated, and the aqueous phase was extracted with DCM. The organic phase was collected, washed with water and saturated sodium chloride, and dried with sodium sulfate. The solvent was removed by vacuum distillation, and the crude product was purified by rapid chromatography (MeOH / DCM solution, gradient: 0→10%) to give compound D (0.51 g, 69%) as a white solid. 1 H NMR (300 MHz, CDCl3) δ 6.69 (d, J = 8.2 Hz, 1H), 6.59 (d, J = 8.2 Hz, 1H), 4.83 (d, J = 1.3 Hz, 1H), 4.71 (dd, J=6.7, 1.8 Hz, 1H), 3.83 (s, 3H), 3.47 (s, 3H), 3.18 – 2.92 (m, 2H), 2.63 –2.14 (m, 7H), 2.07 – 1.72 (m, 3H), 1.66 – 1.44 (m, 1H). 13 C NMR (75 MHz, CDCl3)δ 152.23, 145.14, 143.09, 129.18, 126.77, 118.56, 113.52, 98.00, 88.52,59.06, 56.43, 54.35, 46.50, 43.02, 42.42, 39.66, 35.62, 23.57, 20.25. HRMS(ESI + ) m / z calc'd for [M+H] + : 314.1751; found 314.1742. Synthesis of Compound E: Compound D (1.0 g, 3.19 mmol) was dissolved in 20 mL MeOH, and the solution was cooled to -20 °C in an ethanol bath. Methylsulfonic acid (0.25 mL, 3.84 mmol) was added dropwise, and the mixture was cooled in an ethanol bath for 5 min. Then, N-bromosuccinimide (0.68 g, 3.84 mmol) was slowly added, and the mixture was stirred at -20 °C for 0.25 h. After the reaction was monitored by TLC and mass spectrometry, the solvent was concentrated under reduced pressure. The resulting solid was dissolved in DCM and washed with sodium hydroxide (1 M). The mixture was separated, and the organic layer was washed with water and saturated sodium chloride, and dried with sodium sulfate. The solvent was removed by reduced pressure distillation, and the crude product was purified by rapid chromatography (MeOH / DCM solution, gradient: 0→10%) to obtain a white amorphous solid, compound E (1.1 g, 81%). 1 H NMR (300 MHz, CDCl3) δ 6.65 (dd, J =31.9, 8.2 Hz, 2H), 4.70 (s, 1H), 4.19 – 3.96 (t, 1H), 3.86 (s, 3H), 3.49 (s, 3H), 3.21 (s, 3H), 3.14 – 2.96 (m, 2H), 2.96 – 2.79 (m, 1H), 2.52 (dd, J =11.9, 4.2 Hz, 1H), 2.46 – 2.28 (m, 4H), 2.20 (td, J= 12.1, 3.4 Hz, 1H), 2.07 –1.79 (m, 2H), 1.77 – 1.48 (m, 2H). 13 C NMR (75 MHz, CDCl3) δ 146.01, 141.97,129.73, 126.51, 118.94, 114.65, 98.31, 91.15, 59.09, 56.99, 50.76, 49.31,46.85, 42.96, 42.74, 38.45, 36.80, 20.06. HRMS (ESI + ) m / z calc'd for [M+H] + :424.1118; found 424.1107. Synthesis of compound F: E (2.20 g, 5.20 mmol) and potassium tert-butoxide (1.75 g, 15.60 mmol) were dissolved in 55 mL DMSO. The mixture was heated to 100 °C. After the reaction was monitored by TLC and mass spectrometry, the solution was cooled to room temperature. The mixture was separated by extraction with DCM and water. The aqueous phase was washed three times with DCM, and the organic layers were combined and dried over sodium sulfate. The solvent was removed by vacuum distillation to obtain a brown solid. The crude product was dissolved in a sulfuric acid solution of formic acid, and hydrogen peroxide was slowly added dropwise. After the reaction was monitored by TLC and mass spectrometry, the reaction mixture was alkalized with saturated sodium carbonate and extracted three times with DCM. The collected organic layer was then washed with water and saturated sodium chloride and dried over sodium sulfate. The solvent was removed by vacuum distillation to obtain the crude product, which was then purified by rapid chromatography (MeOH / DCM solution, gradient: 0→10%) to obtain a white solid F (530 mg, 51%). 1 H NMR (300 MHz, CDCl3) δ 6.68 (d, J = 8.3 Hz, 1H), 6.61 (d, J = 9.7 Hz, 2H), 6.18 (d, J = 10.3 Hz, 1H), 5.14 (s, 1H), 4.70 (s, 1H), 3.83 (s, 3H), 3.23 (d, J = 18.3 Hz, 1H), 3.03 (d, J = 5.3 Hz, 1H), 2.58-2.47 (m, 2H), 2.44 (s, 4H), 2.27 (td, J =11.5, 3.9 Hz, 1H), 1.71-1.66 (m, 1H);13 C NMR (75 MHz, CDCl3) δ 194.36, 147.42,144.36, 142.71, 134.72, 130.05, 124.99, 119.59, 115.02, 87.09, 67.82, 64.19,56.84, 46.65, 45.17, 42.60, 29.46, 22.41; HRMS (ESI + ) m / z calc'd for [M+H] + :314.1387; found 314.1378. Synthesis of compound G: Compound F (1.5 g, 4.8 mmol) was dissolved in 30 mL MeOH, and 5% palladium on carbon (770 mg, 0.36 mmol) was added. The mixture was stirred under H2 balloon for 2 h. After the reaction was monitored by TLC and mass spectrometry, the mixture was filtered, and the solvent was removed under reduced pressure to obtain a crude solid product. The crude product was dissolved in 30 mL acetic anhydride. The mixture was heated to 100 °C and stirred for 0.5 h. After the reaction was monitored by TLC and mass spectrometry, the solvent was removed under reduced pressure, and the resulting solid was washed with saturated sodium bicarbonate and filtered. Purification was performed by rapid chromatography (MeOH / DCM solution, gradient: 0→10%) to give a white solid G (1.12 g, 90%). 1 H NMR (400 MHz, CDCl3) δ 6.68 (dd, J = 25.8, 8.2 Hz, 2H), 4.68 (s, 1H), 4.19 (d, J = 5.4 Hz, 1H), 3.89 (s, 3H), 3.21 (d, J = 18.6 Hz, 1H), 2.81 (ddd, J =14.3, 5.0, 2.7 Hz, 1H), 2.64 (td, J = 14.7, 5.2 Hz, 1H), 2.57 – 2.39 (m, 3H), 2.36 – 2.23 (m, 4H), 2.21 – 2.09 (m, 4H), 1.63 (td, J = 14.4, 3.7 Hz, 1H), 1.52(dd, J = 11.6, 3.4 Hz, 1H). 13C NMR (101 MHz, CDCl3) δ 207.32, 170.24, 144.89,142.92, 128.42, 125.80, 119.56, 114.94, 90.00, 82.46, 57.74, 56.77, 50.47,45.60, 42.69, 35.65, 29.96, 27.01, 22.26. LRMS (ESI + ) m / z calc'd for [M+H] + :358.16; found 358.39. Synthesis of compound H: Compound G (1.02 g, 2.82 mmol) was dissolved in 15 mL of acetonitrile, and anhydrous potassium carbonate (1.96 g, 14.20 mmol) and cyanogen bromide (0.90 g, 8.46 mmol) were added. The mixture was stirred at 85 °C for 2.5 h. After the reaction was monitored by TLC and mass spectrometry, the reaction solution was poured into an ice-water mixture. The mixture was extracted three times with DCM, and the organic layers were combined and washed with water and saturated sodium chloride, and dried over sodium sulfate. The solvent was removed under reduced pressure to give a white solid intermediate. The intermediate was dissolved in freshly prepared HCl solution (3 mol / L, 20 mL). The mixture was stirred at 100 °C for 5 h. After the reaction was monitored by TLC and mass spectrometry, the mixture was cooled to room temperature and alkalized with saturated sodium carbonate. The mixture was extracted three times with DCM, the organic layers were combined and washed with water and saturated sodium chloride, and dried over sodium sulfate. The solvent was removed under reduced pressure. The mixture was purified by rapid chromatography (MeOH / DCM solution, gradient: 0→10%) to give a white solid H (0.59 g, 72%). 1 H NMR (300MHz, CDCl3) δ 6.66 (dd, J = 21.0, 8.2 Hz, 2H), 4.66 (s, 1H), 3.86 (s, 3H), 3.21(d, J = 3.9 Hz, 1H), 3.14 – 2.89 (m, 3H), 2.86 – 2.56 (m, 2H), 2.47 – 2.17 (m,2H), 1.95 – 1.76 (m, 1H), 1.69 – 1.42 (m, 2H). 13C NMR (75 MHz, CDCl3) δ208.74, 144.91, 142.94, 129.35, 125.11, 119.42, 114.55, 90.51, 70.15, 57.32,56.67, 51.04, 37.17, 36.20, 32.59, 31.47, 29.91. LRMS (ESI + ) m / z calc'd for [M+H] + 302.13; found 302.29. Synthesis of Compound Ia: Compound H (100 mg, 0.33 mmol), anhydrous K₂CO₃ (92 mg, 0.66 mmol), and 3-bromopropene (60.3 mg, 0.50 mmol) were dissolved in 1.5 mL of DMF solution. The mixture was heated to 80 °C and stirred continuously for 4 h. After the reaction was monitored by TLC and mass spectrometry, water (5 mL) and DCM (10 mL) were added for extraction and separation, and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 15 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain a yellow oily liquid. The crude product was purified by column chromatography to obtain 96.8 mg of the yellow oily liquid, with a yield of 86%. 1 H NMR (300MHz, CDCl3) δ 6.70 (d, J = 8.2 Hz, 1H), 6.63 (d, J = 8.2 Hz, 1H), 5.82 (ddt, J =16.6, 10.1, 6.4 Hz, 1H), 5.37 – 5.12 (m, 3H), 4.67 (s, 1H), 3.89 (s, 3H), 3.27 – 2.90 (m, 6H), 2.67 – 2.47 (m, 2H), 2.49 – 2.21 (m, 2H), 2.14 (td, J =12.1, 3.7 Hz, 1H), 1.87 (ddd, J = 13.3, 4.9, 3.0 Hz, 1H), 1.75 – 1.47 (m, 2H)ppm. 13C NMR (75 MHz, CDCl3) δ 208.58, 144.97, 142.96, 135.15, 129.42, 124.85,119.43, 118.15, 114.79, 90.36, 70.27, 62.24, 57.66, 56.78, 50.76, 43.31,36.15, 31.42, 30.54, 22.67ppm. LRMS (m / z): [M + H]+ calcd for C 20 H 24 NO4 + 342.17, found 342.12. Synthesis of Compound Ib: Compound H (140 mg, 0.41 mmol), anhydrous K₂CO₃ (113.3 mg, 0.82 mmol), bromophenylethane (105.3 mg, 0.62 mmol), and 18-crown-6 (32.5 mg, 0.12 mmol) were dissolved in 1.5 mL of acetone solution. The mixture was stirred at room temperature for 5 h. After the reaction was monitored by TLC and mass spectrometry, water (5 mL) and DCM (10 mL) were added for extraction and separation, and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 15 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain a brown oily liquid. The crude product was purified by column chromatography to obtain 150 mg of yellow oily liquid Ib, with a yield of 85%. 1 H NMR (500 MHz, CDCl3) δ 7.41 – 7.25 (m, 2H), 7.25 – 7.05(m, 3H), 6.56 (d, J = 8.2 Hz, 1H), 6.41 (d, J = 8.2 Hz, 1H), 5.14 (d, J = 12.3 Hz, 1H), 5.06 (d, J = 12.1 Hz, 1H), 4.54 (s, 1H), 3.03 (d, J = 5.9 Hz, 1H), 2.97 –2.82 (m, 2H), 2.54 (dd, J = 12.0, 4.7 Hz, 1H), 2.41 (dd, J = 18.6, 6.0 Hz, 1H),2.33 – 2.20 (m, 3H), 2.16 (dt, J= 14.3, 3.1 Hz, 1H), 1.98 (td, J = 12.2, 3.7 Hz,1H), 1.73 (ddd, J = 13.3, 4.9, 3.0 Hz, 1H), 1.58 – 1.32 (m, 2H), 0.79 – 0.60 (m, 1H), 0.52 – 0.28 (m, 2H), 0.11 – -0.12 (m, 2H) ppm. 13 C NMR (126 MHz, CDCl3) δ 208.52, 145.55, 141.79, 137.52, 129.85, 128.39, 127.79, 125.67,119.45, 118.00, 90.45, 72.12, 70.16, 62.03, 59.21, 50.77, 43.60, 36.25,31.51, 30.75, 22.70, 9.45, 4.02, 3.86 ppm. LRMS (m / z): [M + H]+ calcd forC 27 H 30 NO4 + 432.22, found 432.12. Synthesis of Compound Ic: Compound H (100 mg, 0.33 mmol), anhydrous K₂CO₃ (92 mg, 0.66 mmol), and 1-bromohexane (81.7 mg, 0.50 mmol) were dissolved in 1.5 mL of DMF solution. The mixture was heated to 80 °C and stirred continuously for 4 h. After the reaction was monitored by TLC and mass spectrometry, water (5 mL) and DCM (10 mL) were added for extraction and separation, and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 15 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain a yellow oily liquid. The crude product was purified by column chromatography to obtain 57.1 mg of the yellow oily liquid Ic, with a yield of 45%. 1 H NMR (300MHz, CDCl3) δ 6.69 (d, J = 8.2 Hz, 1H), 6.62 (d, J = 8.3 Hz, 1H), 4.66 (s, 1H), 3.89 (s, 3H), 3.16 – 2.84 (m, 3H), 2.70 – 2.21 (m, 6H), 2.15 (dd, J= 12.0, 3.6Hz, 1H), 1.94 – 1.79 (m, 1H), 1.70 – 1.41 (m, 4H), 1.33 (d, J = 15.2 Hz, 7H), 0.90 (t, J = 6.3 Hz, 3H) ppm. 13 C NMR (75 MHz, CDCl3) δ 208.63, 144.95, 142.90,129.46, 124.97, 119.39, 114.75, 90.38, 70.24, 62.80, 56.77, 54.29, 50.81,43.39, 36.17, 31.68, 31.47, 30.72, 27.55, 26.94, 22.81, 22.63, 14.08 ppm.LRMS (m / z): [M + H]+ calcd for C 23 H 32 NO4 + 386.23, found 386.12. Synthesis of compound Ja (compound 4): Compound Ia (100 mg, 0.28 mmol) was dissolved in DMSO (1.0 mL), followed by the addition of Pd(TFA)₂ (112 mg, 0.34 mmol) and trifluoroacetic acid (TFA, 42 μL, 0.56 mmol). The mixture was heated to 65 °C and stirred under a nitrogen atmosphere for 5 hours. The reaction progress was monitored by TLC. After the reaction was complete, the reaction solution was alkalized with ammonia (1.0 mL) and extracted with dichloromethane (3 × 5 mL). The organic layers were combined, washed with brine (2 × 10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give a pale yellow oil. The crude product was purified by column chromatography to give the colorless oily target product Ja (54 mg, 55%). 1 H NMR (300 MHz, CDCl3) δ6.66 (dt, J = 11.6, 8.2 Hz, 3H), 6.20 (d, J = 10.1 Hz, 1H), 4.73 (s, 1H), 3.85(s, 3H), 3.38 (d, J = 5.9 Hz, 1H), 3.15 (d, J = 18.6 Hz, 1H), 2.76 (dd, J= 11.8, 4.6 Hz, 1H), 2.57 (dd, J = 18.6, 6.1 Hz, 1H), 2.51 – 2.34 (m, 3H), 2.26 (td, J =12.0, 3.5 Hz, 1H), 1.71 (dd, J = 12.6, 2.3 Hz, 1H), 1.00 – 0.77 (m, 1H), 0.58(dd, J = 7.8, 4.5 Hz, 2H), 0.17 (t, J = 4.8 Hz, 2H). 13 C NMR (75 MHz, CDCl3) δ194.40, 147.68, 144.37, 142.69, 134.73, 130.67, 124.99, 119.54, 115.00,87.15, 67.61, 61.70, 59.08, 56.84, 47.25, 43.55, 29.63, 23.08, 9.35, 4.07,3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 354.1700; found 354.1695. Synthesis of compound Jb: Jb was prepared using the same steps as Ja, except that Ia was replaced with Ib. The reaction was carried out by dissolving Ib (100 mg, 0.26 mmol), Pd(TFA)₂ (102 mg, 0.31 mmol), and TFA (39 μL, 0.52 mmol) in DMSO (1.0 mL). The crude product was purified by column chromatography to obtain the colorless oily target product Jb (65 mg, 65%). 1 H NMR (300 MHz, CDCl3) δ 7.44 – 7.11 (m, 7H), 6.71 (d, J = 8.2 Hz, 1H), 6.64 (d, J = 8.2 Hz, 1H), 4.65 (s, 1H), 3.96 – 3.76 (m, 4H), 3.19 – 2.51(m, 10H), 2.45 – 2.09 (m, 3H), 1.90 – 1.74 (m, 1H), 1.71 – 1.46 (m, 2H). 13CNMR (101 MHz, CDCl3) δ 195.23, 172.97, 148.14, 142.72, 138.89, 134.26,129.87, 128.65, 128.60, 126.49, 120.09, 118.06, 87.14, 67.85, 63.38, 55.79,47.30, 34.11, 29.29, 23.98, 22.68. MS for [M+H] + Found 404.21. Synthesis of compound Jc: Jc was prepared using the same steps as Ja, except that Ia was replaced with Ic. The reaction was carried out by dissolving Ic (100 mg, 0.26 mmol), Pd(TFA)2 (102 mg, 0.31 mmol), and TFA (39 μL, 0.52 mmol) in DMSO (1.0 mL). The crude product was purified by column chromatography to obtain the colorless oily target product Jb (50 mg, 50%). 1 H NMR (500 MHz, CDCl3) δ 6.69 (d, J = 8.2 Hz, 1H), 6.61 (dd, J = 9.1, 4.6 Hz, 2H), 6.19 (d, J = 10.1 Hz, 1H), 4.71 (s, 1H), 3.84 (s, 3H), 3.15 (dd, J =25.6, 12.3 Hz, 2H), 2.69 – 2.45 (m, 4H), 2.41 (td, J = 12.6, 5.1 Hz, 1H), 2.25(td, J = 12.2, 3.7 Hz, 1H), 1.70 (dd, J = 12.8, 2.4 Hz, 1H), 1.51 (dd, J = 14.9,7.5 Hz, 2H), 1.41 – 1.22 (m, 7H), 0.91 (t, J = 6.9 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 194.33, 147.55, 144.41, 142.72, 134.73, 130.67, 125.05, 119.52,115.13, 87.12, 67.70, 62.55, 56.89, 54.22, 47.24, 43.36, 31.69, 29.68, 27.57,26.96, 23.35, 22.63, 14.06. HRMS (ESI + ) m / z calc'd for [M+H] + : 384.2170; found 384.2165. Synthesis of Compound 1: Compound 4 (50 mg, 0.14 mmol) was dissolved in 1.0 mL of anhydrous dichloromethane. This solution was then added dropwise at -20 °C to a mixture of boron tribromide (94 μL, 1.0 mmol) dissolved in 1.0 mL of anhydrous dichloromethane. The mixture was stirred at -20 °C, and the reaction progress was monitored by TLC. After the reaction was complete, the mixture was alkalized with 1.0 mL of ammonia and extracted with dichloromethane (3 × 5 mL). The organic layers were combined, washed with brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give compound 1 (22 mg, 42%) as a colorless oil. 1 H NMR (300MHz, CDCl3) δ 6.82 – 6.64 (m, 2H), 6.59 (t, J = 7.2 Hz, 1H), 6.20 (d, J = 10.1Hz, 1H), 4.76 (s, 1H), 3.40 (d, J = 5.9 Hz, 1H), 3.28 – 2.99 (m, 2H), 2.88 –2.67 (m, 1H), 2.66 – 2.39 (m, 5H), 2.38 – 2.12 (m, 2H), 1.80 – 1.51 (m, 2H), 0.90 (d, J = 4.5 Hz, 1H), 0.67 – 0.43 (m, 2H), 0.25 – 0.05 (m, 2H). 13C NMR (75MHz, CDCl3) δ 195.32, 148.29, 142.75, 138.56, 134.40, 130.06, 124.24, 120.05,117.89, 87.32, 67.74, 61.70, 59.06, 47.45, 43.60, 29.43, 23.12, 9.32, 4.09,3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 340.1544; found 340.1541. Synthesis of Compound 2: The synthesis method of Compound 2 is the same as that of Compound 1, except that the starting material is replaced by Compound Jb (50 mg, 0.12 mmol) instead of Compound 4, and finally a colorless oily compound 2 (15 mg, 33%) is obtained. 1 H NMR (300 MHz, CDCl3) δ 7.44 – 7.11 (m, 7H), 6.71 (d, J = 8.2 Hz, 1H), 6.64 (d, J = 8.2 Hz, 1H), 4.65 (s, 1H), 3.96 – 3.76 (m, 4H), 3.19 – 2.51 (m,10H), 2.45 – 2.09 (m, 3H), 1.90 – 1.74 (m, 1H), 1.71 – 1.46 (m, 2H). 13 C NMR(101 MHz, CDCl3) δ 195.23, 172.97, 148.14, 142.72, 138.89, 134.26, 129.87,128.65, 128.60, 126.49, 120.09, 118.06, 87.14, 67.85, 63.38, 55.79, 47.30,34.11, 29.29, 23.98, 22.68. HRMS (ESI + ) m / z calc'd for [M+H] + : 390.1700; found390.1696. Synthesis of compound 3: The synthesis method of compound 3 is the same as that of compound 1, except that the starting material is replaced by compound Jc (45 mg, 0.12 mmol) instead of compound 4, and finally colorless oily compound 3 (16 mg, 38%) is obtained. 1H NMR (500 MHz, CDCl3) δ 6.75 – 6.64 (m, 2H), 6.58 (dd, J = 8.1, 5.7 Hz, 1H), 6.17 (d, J = 10.1 Hz, 1H), 4.73 (s, 2H), 3.20 – 3.08 (m, 1H), 3.01 – 2.89(m, 2H), 2.70 – 2.47 (m, 3H), 2.42 (td, J = 12.6, 5.1 Hz, 1H), 2.26 (tt, J =11.8, 10.1 Hz, 1H), 1.74 – 1.58 (m, 2H), 1.58 – 1.42 (m, 2H), 1.38 – 1.00 (m,11H), 0.96 – 0.53 (m, 5H). 13 C NMR (75 MHz, CDCl3) δ 195.32, 148.29, 142.75,138.56, 134.40, 130.06, 124.24, 120.05, 117.89, 87.32, 67.74, 61.70, 59.06,47.45, 43.60, 29.43, 23.12, 9.32, 4.09, 3.84. LRMS (ESI + ) found 370.18. Example 2: Synthesis and characterization data of compounds 5 and 6 Synthesis of Compound 5: Compound 1 (50 mg, 0.147 mmol), anhydrous potassium carbonate (41 mg, 0.295 mmol), and benzyl bromide (30 mg, 0.176 mmol) were dissolved in 1 mL of DMF, and the reaction mixture was stirred at room temperature. After the reaction was monitored by TLC and mass spectrometry, water was added to quench the reaction. The above mixture was extracted and separated by DCM (2 × 10 mL), and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a yellow oily liquid. The crude product was purified by column chromatography to obtain the target product, compound 5. 1 H NMR (500 MHz, CDCl3)δ 7.22 (d, J = 7.3 Hz, 2H), 7.16 (t, J = 7.4 Hz, 2H), 7.13 – 7.07 (m, 1H), 6.54(d,J = 8.2 Hz, 1H), 6.47 (d, J = 10.1 Hz, 1H), 6.38 (d, J = 8.2 Hz, 1H), 6.02 (d, J = 10.1 Hz, 1H), 4.99 (s, 2H), 4.57 (s, 1H), 3.95 (q, J = 7.1 Hz, 1H), 3.19(d, J = 6.0 Hz, 1H), 2.94 (d, J = 18.6 Hz, 1H), 2.58 (dd, J = 12.0, 4.8 Hz, 1H),2.37 (dd, J = 18.6, 6.1 Hz, 1H), 2.32 – 2.19 (m, 3H), 2.07 (td, J = 12.2, 3.7 Hz,1H), 1.85 (d, J = 21.5 Hz, 1H), 1.53 (dd, J = 12.9, 2.7 Hz, 1H), 1.07 (dt, J =11.1, 7.1 Hz, 1H), 0.80 – 0.62 (m, 1H), 0.41 (qd, J = 4.4, 1.5 Hz, 2H), 0.09 –-0.10 (m, 2H). 13 C NMR (126 MHz, CDCl3) δ 194.36, 147.76, 144.95, 141.47,137.25, 134.69, 130.96, 128.39, 127.85, 127.76, 125.68, 119.62, 118.17,87.17, 72.07, 67.62, 61.69, 60.41, 59.10, 47.20, 43.55, 29.67, 23.18, 14.23,9.36, 4.08, 3.86. HRMS (m / z): [M+H] + calc’d for 430.2013; found 430.2011. Synthesis of Compound 6: Compound 1 (50 mg, 0.147 mmol), anhydrous potassium carbonate (41 mg, 0.295 mmol), and 1,1'-(3-bromopropylidene)diphenyl (49 mg, 0.176 mmol) were dissolved in 1 mL of DMF. The reaction mixture was stirred at room temperature. After the reaction was monitored by TLC and mass spectrometry, water was added to quench the reaction. The above mixture was extracted and separated by DCM (2 × 10 mL), and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a yellow oily liquid. The crude product was purified by column chromatography to obtain the target product, compound 6. 1 H NMR (500 MHz, CDCl3) δ 7.09 (dd, J = 6.8, 3.8 Hz, 9H), 6.99 (dt, J = 9.0, 4.6 Hz, 2H), 6.44 (dd, J = 15.3, 9.1 Hz, 2H), 6.36 (d, J = 8.2 Hz, 1H), 6.01 (d, J = 10.1Hz, 1H), 4.54 (s, 1H), 4.04 (t, J = 7.9 Hz, 1H), 3.85 (dt, J = 9.6, 6.4 Hz, 1H),3.80 – 3.69 (m, 1H), 3.18 (d, J = 5.9 Hz, 1H), 2.94 (d, J = 18.6 Hz, 1H), 2.57(dd, J = 11.9, 4.7 Hz, 1H), 2.44 – 2.16 (m, 6H), 2.08 (dt, J = 12.2, 6.1 Hz, 1H), 1.51 (dd, J = 12.8, 2.5 Hz, 1H), 0.71 (dd, J = 9.1, 3.7 Hz, 1H), 0.41 (d, J = 7.9Hz, 2H), 0.00 (t, J = 4.9 Hz, 2H). 13C NMR (126 MHz, CDCl3) δ 194.37, 147.70,144.74, 144.39, 144.36, 141.75, 134.73, 130.79, 128.49, 128.01, 127.97,126.23, 126.22, 125.19, 119.53, 116.93, 87.10, 67.86, 67.63, 61.72, 59.11,47.23, 47.03, 43.57, 35.00, 29.67, 29.35, 23.15, 9.38, 4.10, 3.86. HRMS (m / z): [M+H) + calc'd for 534.2639; found 534.2633. Example 3: Evaluation of TLR4 antagonistic activity of (+)-Naltrexone derivatives 1-6 The TLR4 antagonistic activity of (+)-Naltrexone derivatives 1-6 was evaluated using a NO inhibition model, as follows: BV-2 microglia were grown in DMEM medium supplemented with 10% FBS, 50 units / mL penicillin, and 50 μg / mL streptomycin. When ~80% confluence was reached, BV-2 cells were separated from the flasks using a cell lifter. Cells were seeded at a density of 4 × 10⁴ cells per well in 96-well plates. After overnight incubation, the medium was aspirated and replaced with DMEM. LPS (200 ng / mL) and the specified concentration of (+)-Naltrexone derivatives 1-6 were added and incubated with the cells for 24 h. After treatment, 100 μL of the supernatant from each well was transferred to a flat, black 96-well microfluorescent plate (Thermo Scientific, MA, USA) for NO measurement. Add 10 μL of 2,3-diaminonaphthalene (0.05 mg / mL in 0.62 M HCl) to each well and incubate for 15 min. Quench the reaction by adding 5 μL of NaOH (3 mol / L) and read the plate on a SYNERGY H1 microplate reader (BioTek Instruments, Carlsbad, CA, USA) at an excitation wavelength of 360 nm and an emission wavelength of 430 nm. Normalize the NO release to the LPS (200 ng / mL) treatment group.

[0047] The activity evaluation results are shown in Table 1. The anti-inflammatory activity of the compounds was evaluated using the half-maximal inhibitory concentration (IC50). 50 ) indicates that IC 50The lower the value, the better the anti-inflammatory activity of the compound; the higher the therapeutic index, the lower the cytotoxicity of the compound. Table 1 shows that the anti-inflammatory activities of (+)-Naltrexone derivatives 1-3 are comparable to those of the control compound (+)-14-hydroxymorphinone. This indicates that the activity of the derivatives can be maintained regardless of the introduction of small cyclic substituents (cyclopropylmethyl), sterically hindered cyclic substituents (phenethyl), or long-chain alkanes (n-hexyl) at the N17 position of (+)-14-hydroxymorphinone. This demonstrates the high tolerance of the functional group at the N17 position, allowing for the introduction of different types of substituents without affecting the anti-inflammatory activity of the compound.

[0048] The anti-inflammatory activity of (+)-Naltrexone derivatives 4-6 gradually decreased, indicating that the substitution of the methyl group at the C3 position, followed by sterically hindered benzyl groups and then 3,3-diphenylpropyl groups, significantly affected the anti-inflammatory activity of the compounds. Therefore, the C3 site exhibits good tolerance to the introduction of small functional groups.

[0049] Since the functional group at the N17 position has good tolerance, in order to ensure the drug-likeness of the compound, the design of subsequent derivatives preferentially selects cyclopropylmethyl with the same structure as (+)-Naltrexone for activity evaluation, but this is not a structural limitation of the present invention.

[0050] Table 1. TLR4 antagonistic activity of (+)-Naltrexone derivatives 1-6

[0051] a (+)-Naltrexone derivatives inhibit the half-maximal inhibitory concentration (IC50) of LPS-induced excessive NO production in microglia BV-2 cells. 50 ); b The therapeutic index (TI) is calculated using the following formula: TI = IC50 of cell viability 50 / NO generates IC 50 .

[0052] Example 4: Synthesis and characterization data of compounds 7-25 The synthesis methods for compounds 7-25 are the same as those for compounds 5 and 6, all using compound 1 as the starting material, the difference being that the reactants are replaced with different brominated reactants. Compound 1 (100 mg, 0.293 mmol), anhydrous potassium carbonate (82 mg, 0.586 mmol), and the brominizing reagent were dissolved in 1 mL of DMF, and the reaction mixture was stirred at room temperature. After the reaction was monitored by TLC and mass spectrometry, water was added to quench the reaction. The above mixed solution was extracted and separated using DCM (2 × 10 mL), and the organic phase was collected. The obtained organic phase was washed with saturated brine (2 × 10 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography to obtain the target product. The bromine derivatives are, in order, bromoethane, bromopropane, bromobutane, bromopropene, bromopropyne, bromomethylcyclopropane, bromomethylepoxypropane, bromomethylcyclobutane, 3-(bromomethyl)oxetane, bromomethylcyclopentane, bromoisobutane, sulfonyl fluoride, acryloyl bromide, 1-fluoro-3-iodopropane, 1-bromo-4-fluorobutane, 1-chloro-3-iodopropane, 1-bromo-4-chlorobutane, 1,2-dibromoethane, and 1,3-dibromopropane.

[0053] Characterization data of compound 7: 1 H NMR (300 MHz, CDCl3) δ 6.78 – 6.53 (m, 3H), 6.20(d, J = 10.1 Hz, 1H), 4.72 (s, 1H), 4.21 – 4.03 (m, 2H), 3.38 (d, J = 5.9 Hz, 1H), 3.14 (d, J = 18.6 Hz, 1H), 2.76 (dd, J = 11.7, 4.5 Hz, 1H), 2.65 – 2.36 (m,4H), 2.26 (td, J = 12.0, 3.6 Hz, 1H), 1.71 (dd, J = 12.7, 2.3 Hz, 1H), 1.36 (t, J =7.0 Hz, 3H), 0.90 (tdd, J = 7.9, 7.2, 2.3 Hz, 1H), 0.67 – 0.50 (m, 2H), 0.26 –0.08 (m, 2H). 13C NMR (75 MHz, CDCl3) δ 194.59, 147.77, 144.47, 141.78, 134.70,130.69, 124.98, 119.56, 116.64, 87.01, 67.61, 65.39, 61.66, 59.07, 47.19,43.55, 29.62, 23.09, 15.12, 9.37, 4.09, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 368.1856; found 368.1852. Characterization data of compound 8: 1 H NMR (300 MHz, CDCl3) δ 6.65 (dt, J = 19.2, 8.2 Hz, 3H), 6.21 (d, J = 10.1 Hz, 1H), 4.73 (s, 1H), 4.02 (dd, J = 11.9, 6.6 Hz, 2H), 3.38 (d, J = 6.0 Hz, 1H), 3.15 (d, J = 18.6 Hz, 1H), 2.77 (dd, J = 11.7, 4.5 Hz, 1H), 2.60 (d, J = 6.1 Hz, 1H), 2.45 (dd, J = 12.1, 7.2 Hz, 3H), 2.27 (d, J = 3.6Hz, 1H), 1.85 – 1.64 (m, 3H), 1.00 (t, J = 7.4 Hz, 3H), 0.94 – 0.77 (m, 1H), 0.60 (dd, J = 5.3, 2.8 Hz, 2H), 0.18 (d, J = 5.0 Hz, 2H). 13C NMR (75 MHz, CDCl3) δ194.57, 147.72, 144.58, 141.97, 134.70, 130.72, 124.95, 119.54, 116.92,86.99, 71.54, 67.63, 61.69, 59.09, 47.18, 43.58, 29.62, 23.12, 22.77, 10.41,9.35, 4.08, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 382.2013; found 382.2011. Characterization data for compound 9: 1 H NMR (300 MHz, CDCl3) δ 6.63 (dt, J = 19.1, 8.2 Hz, 3H), 6.19 (d, J = 10.1 Hz, 1H), 4.70 (s, 1H), 4.17 – 3.92 (m, 2H), 3.36 (d, J =5.9 Hz, 1H), 3.12 (d, J = 18.6 Hz, 1H), 2.74 (dd, J = 11.7, 4.4 Hz, 1H), 2.64 –2.32 (m, 4H), 2.24 (td, J = 12.0, 3.5 Hz, 1H), 1.80 – 1.56 (m, 3H), 1.44 (dq, J =14.5, 7.3 Hz, 2H), 1.01 – 0.72 (m, 4H), 0.57 (dt, J = 5.4, 4.8 Hz, 2H), 0.16(q, J = 4.8 Hz, 2H). 13C NMR (75 MHz, CDCl3) δ 194.56, 147.71, 144.57, 142.02,134.73, 130.71, 124.92, 119.52, 116.77, 86.99, 69.70, 67.62, 61.67, 59.08,47.19, 43.56, 31.53, 29.62, 23.10, 19.13, 13.91, 9.37, 4.09, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 396.2169; found 396.2166. Characterization data of compound 10: 1 H NMR (500 MHz, CDCl3) δ 6.53 (d, J = 8.2 Hz, 1H), 6.47 (d, J = 10.1 Hz, 1H), 6.40 (d, J = 8.2 Hz, 1H), 6.01 (d, J = 10.1 Hz, 1H),5.89 – 5.75 (m, 1H), 5.16 (dq, J = 17.2, 1.6 Hz, 1H), 5.03 (ddd, J = 10.5, 2.7,1.3 Hz, 1H), 4.54 (s, 1H), 4.45 (dt, J = 5.6, 1.4 Hz, 2H), 3.19 (d, J = 6.0 Hz, 1H), 2.95 (d, J = 18.6 Hz, 1H), 2.57 (dd, J = 12.0, 4.8 Hz, 1H), 2.38 (dd, J =18.7, 6.1 Hz, 1H), 2.32 – 2.18 (m, 3H), 2.08 (td, J = 12.2, 3.7 Hz, 1H), 1.52(dd, J = 12.9, 2.5 Hz, 1H), 0.82 – 0.63 (m, 1H), 0.49 – 0.31 (m, 2H), 0.08 – -0.09 (m, 2H). 13C NMR (126 MHz, CDCl3) δ 194.37, 147.73, 144.74, 141.34,134.69, 133.65, 130.91, 125.51, 119.57, 117.80, 87.11, 70.95, 67.62, 61.70,59.10, 47.19, 43.55, 29.66, 23.17, 9.37, 4.07, 3.85. HRMS (ESI + ) m / z calc'dfor [M+H] + : 380.1856; found 380.1853. Characterization data of compound 11: 1 H NMR (500 MHz, CDCl3) δ 6.80 (d, J = 8.2 Hz, 1H), 6.62 (dd, J = 18.5, 9.1 Hz, 2H), 6.18 (d, J = 10.1 Hz, 1H), 4.76 (dd, J = 8.0, 2.4Hz, 2H), 4.72 (d, J = 2.7 Hz, 1H), 3.36 (d, J = 6.0 Hz, 1H), 3.13 (d, J = 18.6 Hz, 1H), 2.75 (dd, J = 12.0, 4.8 Hz, 1H), 2.56 (dd, J = 18.7, 6.1 Hz, 1H), 2.50 –2.36 (m, 4H), 2.24 (td, J = 12.2, 3.7 Hz, 1H), 1.69 (dd, J = 12.9, 2.6 Hz, 1H), 0.99 – 0.80 (m, 1H), 0.65 – 0.50 (m, 2H), 0.24 – 0.09 (m, 2H). 13C NMR (126MHz, CDCl3) δ 194.06, 147.73, 144.95, 140.23, 134.71, 131.10, 126.50, 119.64,118.42, 87.33, 78.85, 75.47, 67.59, 61.66, 59.10, 57.96, 47.19, 43.50, 29.64,23.21, 9.36, 4.08, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 378.1700; found378.1695. Characterization data of compound 12: 1 H NMR (300 MHz, CDCl3) δ 6.65 (dt, J = 21.6, 8.2 Hz, 3H), 6.20 (d, J = 10.1 Hz, 1H), 4.72 (s, 1H), 4.01 – 3.80 (m, 2H), 3.38 (d, J =5.9 Hz, 1H), 3.14 (d, J = 18.6 Hz, 1H), 2.76 (dd, J = 11.7, 4.4 Hz, 1H), 2.67 –2.34 (m, 4H), 2.25 (td, J = 12.0, 3.5 Hz, 1H), 1.70 (dd, J = 12.6, 2.2 Hz, 1H),1.22 (dqd, J = 9.6, 7.5, 4.8 Hz, 2H), 1.01 – 0.78 (m, 1H), 0.70 – 0.46 (m, 4H), 0.37 – 0.23 (m, 2H), 0.23 – 0.07 (m, 2H). 13C NMR (75 MHz, CDCl3) δ 194.56,147.78, 144.64, 141.82, 134.68, 130.77, 125.20, 119.58, 117.55, 86.99, 75.03,67.61, 61.64, 59.07, 47.16, 43.54, 29.62, 23.11, 10.60, 9.36, 4.09, 3.85,3.22, 3.20. HRMS (ESI + ) m / z calc'd for [M+H] + : 394.2013; found 394.2011. Characterization data of compound 13: 1 H NMR (500 MHz, CDCl3) δ 6.74 (dd, J = 8.2, 3.0 Hz, 1H), 6.65 (dd, J = 10.1, 1.8 Hz, 1H), 6.59 (dd, J = 8.2, 0.5 Hz, 1H), 6.19 (d, J =10.0 Hz, 1H), 4.71 (d, J = 2.0 Hz, 1H), 4.37 (ddd, J = 21.3, 11.5, 3.2 Hz, 1H),4.06 (dt, J = 11.6, 5.9 Hz, 1H), 3.36 (d, J = 6.0 Hz, 1H), 3.30 (dddt, J = 13.0,5.9, 4.1, 3.0 Hz, 1H), 3.13 (d, J = 18.6 Hz, 1H), 2.90 – 2.80 (m, 1H), 2.79 –2.64 (m, 2H), 2.55 (dd, J = 18.7, 6.1 Hz, 1H), 2.51 – 2.37 (m, 3H), 2.34 – 2.17(m, 1H), 1.69 (d, J = 12.9 Hz, 1H), 0.95 – 0.81 (m, 1H), 0.59 (dtd, J= 7.8, 4.4,1.6 Hz, 2H), 0.25 – 0.11 (m, 2H). 13 C NMR (126 MHz, CDCl3) δ 194.43, 194.37,147.78, 147.76, 144.56, 144.48, 141.35, 141.25, 134.67, 131.08, 125.98,125.93, 119.80, 119.78, 118.26, 118.15, 87.19, 87.16, 71.17, 71.06, 67.60,61.67, 59.10, 50.45, 50.38, 47.19, 44.67, 44.64, 43.54, 29.62, 23.19, 9.36, 4.08, 3.84. HRMS (ESI) + ) m / z calc'd for [M+H] + : 396.1805; found 396.1799. Characterization data of compound 14: 1 H NMR (500 MHz, CDCl3) δ 6.52 (d, J = 8.2 Hz, 1H), 6.46 (d, J = 10.1 Hz, 1H), 6.40 (d, J = 8.2 Hz, 1H), 6.01 (d, J = 10.1 Hz, 1H), 4.53 (s, 1H), 3.85 (qd, J = 9.6, 6.8 Hz, 2H), 3.18 (d, J = 6.0 Hz, 1H), 2.95 (d, J = 18.6 Hz, 1H), 2.54 (ddd, J = 22.4, 13.4, 6.4 Hz, 2H), 2.38 (dd, J = 18.6, 6.1Hz, 1H), 2.31 – 2.17 (m, 3H), 2.08 (td, J = 12.2, 3.7 Hz, 1H), 1.99 – 1.82 (m,2H), 1.79 – 1.57 (m, 4H), 1.53 (dd, J = 12.9, 2.7 Hz, 1H), 0.71 (td,J = 6.7, 3.3Hz, 1H), 0.45 – 0.32 (m, 2H), -0.01 (p, J = 5.0 Hz, 2H). 13 C NMR (126 MHz, CDCl3)δ 194.50, 147.69, 144.75, 142.14, 134.70, 130.79, 125.09, 119.52, 117.41,87.00, 74.34, 67.64, 61.73, 59.11, 47.19, 43.57, 34.89, 29.66, 24.89, 24.88,23.15, 18.59, 9.37, 4.07, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 408.2169; found 408.2163. Characterization data of compound 15: 1 H NMR (500 MHz, CDCl3) δ 6.70 (d, J = 8.2 Hz, 1H), 6.64 (d, J = 10.1 Hz, 1H), 6.59 (d, J = 8.2 Hz, 1H), 6.18 (d, J = 10.1 Hz, 1H), 4.82 (ddd, J = 7.8, 6.2, 5.4 Hz, 2H), 4.70 (s, 1H), 4.51 (q, J = 5.9 Hz, 2H), 4.32 (qd, J = 9.8, 7.0 Hz, 2H), 3.36 (ddd, J = 6.9, 2.7, 0.9 Hz, 2H), 3.13 (d, J =18.6 Hz, 1H), 2.75 (dd, J = 12.0, 4.7 Hz, 1H), 2.55 (dd, J = 18.7, 6.1 Hz, 1H),2.50 – 2.34 (m, 3H), 2.24 (td, J = 12.2, 3.7 Hz, 1H), 1.69 (dd, J= 12.9, 2.6 Hz,1H), 0.96 – 0.80 (m, 1H), 0.67 – 0.50 (m, 2H), 0.24 – 0.09 (m, 2H). 13 C NMR(126 MHz, CDCl3) δ 194.47, 147.81, 144.63, 141.49, 134.65, 131.07, 125.83,119.76, 117.78, 87.12, 74.42, 74.37, 71.66, 67.60, 61.67, 59.10, 47.19,43.55, 34.84, 29.61, 23.19, 9.37, 4.09, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 410.1962; found 410.1958. Characterization data of compound 16: 1 H NMR (500 MHz, CDCl3) δ 6.52 (d, J = 8.2 Hz, 1H), 6.46 (d, J = 10.1 Hz, 1H), 6.40 (d, J = 8.2 Hz, 1H), 6.01 (d, J = 10.1 Hz, 1H), 4.53 (s, 1H), 3.78 (dd, J = 9.3, 7.1 Hz, 1H), 3.72 (dd, J = 9.2, 7.2 Hz, 1H), 3.18 (d, J = 6.0 Hz, 1H), 2.95 (d, J = 18.6 Hz, 1H), 2.57 (dd, J = 11.9, 4.8 Hz, 1H), 2.38 (dd, J = 18.6, 6.1 Hz, 1H), 2.33 – 2.18 (m, 3H), 2.18 – 2.02 (m, 2H),1.61 (dt, J = 11.4, 4.8 Hz, 2H), 1.53 (dd, J = 12.8, 2.7 Hz, 1H), 1.49 – 1.31 (m,4H), 1.13 (ddd,J = 21.4, 14.0, 7.1 Hz, 3H), 0.78 – 0.64 (m, 1H), 0.46 – 0.35 (m, 2H), 0.04 – -0.06 (m, 2H). 13 C NMR (126 MHz, CDCl3) δ 194.49, 147.67,144.75, 142.16, 134.71, 130.79, 125.01, 119.50, 117.31, 87.00, 74.41, 67.64,61.73, 59.11, 47.19, 43.58, 39.30, 29.66, 29.38, 29.36, 25.39, 23.15, 9.38,4.07, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 422.2326; found 422.2322. Characterization data of compound 17 (CIAC101): 1 H NMR (500 MHz, CDCl3) δ 6.68 (d, J = 8.2Hz, 1H), 6.63 (d, J = 10.1 Hz, 1H), 6.57 (d, J = 8.2 Hz, 1H), 6.19 (d, J = 10.0 Hz,1H), 4.70 (s, 1H), 3.81 (ddd, J = 32.0, 9.3, 6.7 Hz, 2H), 3.35 (d, J = 6.0 Hz, 1H), 3.12 (d, J = 18.6 Hz, 1H), 2.75 (dd, J = 11.9, 4.7 Hz, 1H), 2.55 (dd, J =18.6, 6.1 Hz, 1H), 2.49 – 2.35 (m, 3H), 2.32 – 2.18 (m, 1H), 2.01 (td, J =13.6, 7.0 Hz, 2H), 1.71 (dd, J = 12.8, 2.7 Hz, 2H), 0.97 (d, J= 6.7 Hz, 5H),0.91 – 0.80 (m, 2H), 0.58 (d, J = 7.9 Hz, 2H), 0.17 (t, J = 5.1 Hz, 2H). 13 C NMR(75 MHz, CDCl3) δ 194.56, 147.67, 144.65, 142.14, 134.72, 130.76, 124.94,119.51, 117.12, 86.97, 77.23, 67.63, 61.70, 59.09, 47.18, 43.58, 29.62,28.42, 23.12, 19.19, 19.16, 9.36, 4.08, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 396.2169; found 396.2164. Characterization data of compound 18: 1 H NMR (500 MHz, CDCl3) δ 6.73 (d, J = 8.2 Hz, 1H), 6.62 (dd, J = 29.7, 9.1 Hz, 2H), 6.18 (d, J = 10.1 Hz, 1H), 4.74 – 4.65 (m, 2H), 4.61 (dd, J = 9.0, 3.9 Hz, 1H), 4.36 (dt, J = 28.6, 4.2 Hz, 2H), 3.36 (d, J = 6.0Hz, 1H), 3.13 (d, J = 18.6 Hz, 1H), 2.75 (dd, J = 12.0, 4.7 Hz, 1H), 2.55 (dd, J =18.6, 6.0 Hz, 1H), 2.49 – 2.36 (m, 3H), 2.24 (td, J = 12.2, 3.7 Hz, 1H), 1.68(dd, J = 12.8, 2.5 Hz, 1H), 0.88 (td, J= 6.7, 3.4 Hz, 1H), 0.64 – 0.50 (m, 2H), 0.23 – 0.10 (m, 2H). 13 C NMR (126 MHz, CDCl3) δ 194.52, 147.85, 144.44, 141.00,134.59, 131.14, 126.06, 119.87, 118.66, 87.15, 83.00, 81.64, 69.64, 69.48,67.60, 61.65, 59.08, 47.15, 43.53, 29.57, 23.19, 9.36, 4.07, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 386.1763; found 386.1757. Characterization data of compound 19: 1 H NMR (500 MHz, CDCl3) δ 6.69 (d, J = 8.2 Hz, 1H), 6.64 (d, J = 10.1 Hz, 1H), 6.58 (d, J = 8.2 Hz, 1H), 6.18 (d, J = 10.1 Hz, 1H), 4.70 (s, 1H), 4.61 (dt, J = 47.1, 5.4 Hz, 2H), 4.25 – 4.12 (m, 2H), 3.37 (d, J =5.9 Hz, 1H), 3.13 (d, J = 18.6 Hz, 1H), 2.76 (dd, J = 11.9, 4.6 Hz, 1H), 2.56(dd, J = 18.6, 6.0 Hz, 1H), 2.50 – 2.37 (m, 3H), 2.25 (td, J = 12.2, 3.6 Hz, 1H), 2.10 (dp, J = 25.8, 6.0 Hz, 2H), 1.69 (dd, J = 12.8, 2.4 Hz, 1H), 0.93 – 0.82 (m,1H), 0.58 (d, J= 7.9 Hz, 2H), 0.17 (d, J = 4.6 Hz, 2H). 13 C NMR (126 MHz, CDCl3) δ194.49, 147.76, 144.57, 141.59, 134.66, 130.87, 125.42, 119.68, 117.09,87.08, 81.48, 80.18, 77.30, 77.05, 76.80, 67.61, 65.68, 65.64, 61.70, 59.10,47.20, 43.58, 30.69, 30.53, 29.59, 23.16, 9.33, 4.08, 3.85. + m / zcalc'd for [M+H] + : 400.1919; found 400.1913. Characterization data of compound 20: 1 H NMR (500 MHz, CDCl3) δ 6.73 (d, J = 8.2 Hz, 1H), 6.62 (dd, J = 27.6, 9.1 Hz, 2H), 6.18 (d, J = 10.1 Hz, 1H), 4.72 (s, 1H), 4.42 –4.28 (m, 2H), 3.78 – 3.65 (m, 2H), 3.36 (t, J = 4.6 Hz, 1H), 3.13 (d, J = 18.6Hz, 1H), 2.75 (dd, J = 12.0, 4.7 Hz, 1H), 2.55 (dd, J = 18.7, 6.1 Hz, 1H), 2.49 –2.36 (m, 3H), 2.31 – 2.15 (m, 1H), 1.69 (dd, J = 12.9, 2.6 Hz, 2H), 0.96 – 0.81(m, 1H), 0.64 – 0.51 (m, 2H), 0.17 (qd, J = 4.8, 1.8 Hz, 2H). 13C NMR (126 MHz, CDCl3) δ 194.48, 147.81, 144.50, 140.72, 134.62, 131.18, 126.22, 119.88,118.70, 87.18, 70.26, 67.59, 61.65, 59.09, 47.17, 43.53, 42.34, 29.56, 23.21,9.35, 4.07, 3.84. HRMS (ESI + ) m / z calc'd for [M+H] + : 402.1467; found 402.1464. Characterization data of compound 21: 1 H NMR (300 MHz, CDCl3) δ 6.67 (dt, J = 26.6, 8.2 Hz, 3H), 6.21 (d, J = 10.1 Hz, 1H), 4.73 (s, 1H), 4.22 (dd, J = 11.6, 5.8 Hz, 2H), 3.74 (t, J = 6.3 Hz, 2H), 3.39 (d, J = 5.8 Hz, 1H), 3.15 (d, J = 18.6 Hz, 1H), 2.77(dd, J = 11.5, 4.2 Hz, 1H), 2.51 (ddd, J = 21.5, 17.3, 5.4 Hz, 4H), 2.35 – 2.09(m, 4H), 1.72 (d, J = 11.1 Hz, 2H), 0.91 (s, 1H), 0.60 (d, J = 7.9 Hz, 2H), 0.19(d, J = 4.6 Hz, 2H). 13C NMR (126 MHz, CDCl3) δ 194.50, 147.76, 144.59, 141.53,134.68, 130.91, 125.52, 119.70, 117.19, 87.10, 67.61, 66.52, 61.69, 59.10,47.21, 43.56, 41.63, 32.51, 29.61, 23.16, 9.36, 4.08, 3.84. HRMS (ESI + m / zcalc'd for [M+H] + : 416.1624; found 416.1618. Characterization data of compound 22: 1 H NMR (300 MHz, CDCl3) δ 6.73 (d, J = 8.2 Hz, 1H), 6.62 (dd, J = 17.7, 9.2 Hz, 2H), 6.18 (d, J = 10.1 Hz, 1H), 4.75 (d, J = 17.4 Hz,1H), 4.52 – 4.28 (m, 2H), 3.69 – 3.46 (m, 2H), 3.36 (d, J = 5.9 Hz, 1H), 3.13(d, J = 18.7 Hz, 1H), 2.75 (dd, J = 11.7, 4.4 Hz, 1H), 2.48 (ddd, J = 20.3, 16.3,5.3 Hz, 5H), 2.23 (td, J = 12.0, 3.5 Hz, 1H), 1.69 (d, J = 10.6 Hz, 1H), 0.85(dd, J = 12.4, 5.7 Hz, 2H), 0.65 – 0.46 (m, 2H), 0.16 (d, J = 4.6 Hz, 2H). 13C NMR(126 MHz, CDCl3) δ 194.46, 147.81, 144.52, 140.62, 134.61, 131.18, 126.25,119.89, 118.72, 87.18, 70.06, 67.59, 61.64, 59.09, 47.17, 43.53, 29.76,29.55, 23.21, 9.35, 4.08, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 446.0962; found 446.0954. Characterization data of compound 23: 1 H NMR (500 MHz, CDCl3) δ 6.70 (d, J = 8.2 Hz, 1H), 6.64 (d, J = 10.1 Hz, 1H), 6.59 (d, J = 8.2 Hz, 1H), 6.19 (d, J = 10.1 Hz, 1H), 4.71 (s, 1H), 4.27 – 4.12 (m, 2H), 3.57 (tt, J = 5.3, 2.8 Hz, 2H), 3.37 (d, J =6.0 Hz, 1H), 3.13 (d, J = 18.6 Hz, 1H), 2.76 (dd, J = 12.0, 4.8 Hz, 1H), 2.56(dd, J = 18.6, 6.1 Hz, 1H), 2.49 – 2.35 (m, 3H), 2.30 – 2.16 (m, 3H), 1.70 (dd, J = 12.8, 2.8 Hz, 1H), 0.97 – 0.80 (m, 1H), 0.58 (d, J = 8.0 Hz, 2H), 0.17 (t, J =5.2 Hz, 2H). 13C NMR (126 MHz, CDCl3) δ 194.48, 147.75, 144.61, 141.51, 134.68,130.92, 125.54, 119.70, 117.26, 87.10, 67.61, 67.56, 61.69, 59.10, 47.20,43.57, 32.64, 30.21, 29.59, 23.17, 9.35, 4.08, 3.84. HRMS (ESI + ) m / z calc'dfor [M+H] + : 460.1116; found 460.1113. Characterization data of compound 24: 1 H NMR (300 MHz, CDCl3) δ 7.04 (dd, J = 8.4, 0.6 Hz, 1H), 6.70 (dd, J = 19.9, 9.3 Hz, 2H), 6.21 (d, J = 10.1 Hz, 1H), 4.86 (s, 1H), 3.42 (d, J = 5.9 Hz, 1H), 3.20 (d, J = 19.1 Hz, 1H), 2.79 (dd, J = 12.2, 4.7 Hz,1H), 2.68 – 2.39 (m, 4H), 2.21 (dt, J = 12.3, 6.1 Hz, 1H), 1.70 (dd, J = 13.0,2.6 Hz, 1H), 1.24 (s, 1H), 1.17 – 0.82 (m, 1H), 0.59 (dt, J = 5.3, 4.7 Hz, 2H), 0.17 (q, J = 4.8 Hz, 2H). 13C NMR (75 MHz, CDCl3) δ 192.24, 147.75, 147.23,134.96, 133.88, 132.95, 131.18, 122.54, 120.36, 88.55, 77.50, 77.08, 76.65,67.29, 61.22, 59.02, 47.54, 43.14, 29.59, 23.55, 9.25, 4.13, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + : 422.1068; found 422.1064. Characterization data of compound 25: 1 H NMR (300 MHz, CDCl3) δ 6.89 (d, J = 8.2 Hz, 1H), 6.65 (ddd, J = 18.5, 12.8, 1.9 Hz, 3H), 6.42 – 6.15 (m, 2H), 6.02 (dd, J = 10.4,1.2 Hz, 1H), 4.80 (s, 1H), 3.43 (d, J = 6.0 Hz, 1H), 3.20 (d, J = 18.8 Hz, 1H), 2.80 (dd, J = 11.8, 4.6 Hz, 1H), 2.62 (dd, J = 18.9, 6.1 Hz, 1H), 2.48 (tt, J =12.3, 6.1 Hz, 3H), 2.29 (td, J = 12.2, 3.6 Hz, 2H), 1.86 – 1.71 (m, 1H), 0.91(dd, J = 12.8, 6.6 Hz, 2H), 0.61 (dt, J = 5.4, 4.9 Hz, 2H), 0.20 (q, J = 4.9 Hz, 2H). 13C NMR (101 MHz, CDCl3) δ 193.45, 163.46, 147.73, 134.86, 133.04, 132.14,131.27, 130.41, 127.32, 122.93, 119.57, 87.70, 67.51, 61.52, 59.08, 47.32,43.43, 29.59, 23.46, 9.30, 4.14, 3.85. HRMS (ESI + ) m / z calc'd for [M+H] + :394.1649; found 394.1644. Example 5: Evaluation of TLR4 antagonistic activity of (+)-Naltrexone derivative 7-25 The TLR4 antagonistic activity evaluation of (+)-naltrexone derivative 7-25 was also conducted using the NO model, with the same procedures as in Example 3. The only difference was that the test compound was replaced with derivative 7-25. The activity evaluation results are shown in Table 2. Table 2 shows that the anti-inflammatory activity of the compounds was significantly improved by introducing a small functional group at the C3 position. The anti-inflammatory structure of most compounds was more than 500 times higher than that of the parent nucleus (+)-naltrexone (e.g., compounds 10, 11, 20, 23, 24), and the anti-inflammatory activity of representative compounds was increased by 5000 times (e.g., compounds 8, 17, 18, 21, 22), and even more than 10000 times (e.g., compound 25). Therefore, the (+)-naltrexone derivatives of this invention, having the general formula (I), exhibit superior anti-neuroinflammatory activity compared to the parent nucleus (+)-naltrexone, and the therapeutic index is significantly improved.

[0054] Table 2. TLR4 antagonistic activity of (+)-Naltrexone derivative 7-25

[0055] a (+)-Naltrexone derivatives inhibit the half-maximal inhibitory concentration (IC50) of LPS-induced excessive NO production in microglia BV-2 cells. 50 ); b The therapeutic index (TI) is calculated using the following formula: TI = IC50 of cell viability 50 / NO generates IC 50 .

[0056] Example 6: Evaluation of the inhibitory activity of compound CIAC101 on lipopolysaccharide (LPS)-induced pro-inflammatory gene expression in BV-2 microglia. TLR4 activation of microglia initiates the nuclear factor-κB (NF-κB) and TIR domain adaptor proteins to induce the interferon-β (TRIF) signaling pathway, subsequently inducing the production of inducible nitric oxide synthase (iNOS), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6), all hallmarks of neuroinflammation. In a lipopolysaccharide (LPS)-stimulated BV-2 microglia model, this transcriptional program is strongly reproduced through NF-κB / TRIF-mediated gene activation. Figure 8 As shown, compound CIAC101 can reduce LPS-induced iNOS in a concentration-dependent manner. Figure 8 A), IL-1β Figure 8 B), TNF-α Figure 8 C) and IL-6 ( Figure 8 D) mRNA expression. Notably, 0.01 μM CIAC101 significantly inhibited the expression of IL-1β, TNF-α, and IL-6, while (+)-naltrexone showed weak inhibitory activity, or even no inhibitory activity, even at a concentration of 4 μM (400-fold). This indicates that CIAC101 has significantly more anti-neuroinflammatory activity than (+)-naltrexone.

[0057] Example 7: Compound CIAC101 can alleviate methamphetamine (METH)-induced addictive behavior. The evaluation of the activity of compound CIAC101 in alleviating methamphetamine (METH)-induced addictive behavior was mainly conducted using two standard preclinical experimental models: the motor sensitization model (…). Figure 9 A) and Conditional Place Preference Model (CPP, Figure 9 C). For example Figure 9 As shown in Figure B, during the sensitization phase, intraperitoneal injection of METH (1 mg / kg) significantly increased kinetic activity in animals compared to injection of saline. Combined administration of the compound CIAC101 alleviated this METH-induced hyperkinetic activity in a dose-dependent manner; 0.2 mg / kg CIAC101 produced a strong inhibitory effect, while ultra-low doses of 0.02 mg / kg and 0.005 mg / kg CIAC101 also produced partial inhibitory effects. In contrast, 2 mg / kg of (+)-naltrexone produced only a moderate inhibitory effect. During the sensitization expression phase ( Figure 9(C) 0.2 mg / kg CIAC101 significantly inhibited established methamphetamine-induced motor sensitization, while 2 mg / kg (+)-naltrexone produced almost no change. In conditioned position preference experiments, 2 mg / kg METH induced strong position preference compared to saline injection, while 0.2 mg / kg CIAC101 eliminated this position preference. Figure 9 E). 2 mg / kg of (+)-naltrexone failed to reverse conditioned positional preference. CIAC101 alone produced no significant effect in either model. Figure 9 E). In summary, these in vivo experimental results demonstrate that CIAC101 effectively combats METH-induced addictive behavior, while higher doses of (+)-naltrexone do not effectively inhibit METH-induced addictive behavior. Therefore, compound CIAC101 exhibits superior anti-METH addiction activity compared to (+)-naltrexone.

[0058] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. A (+)-naltrexone derivative, characterized in that: The general structural formula of the (+)-naltrexone derivative is shown in formula (I): （I） The skeletal structure is a (+)-opioid structure containing rings A, B, C, D, and E, wherein the C6 position is a ketone carbonyl group, the C7 and 8 positions are alkenyl groups, the C14 position is a hydroxyl group, and the C3 position is an oxygen substituent. R1 is selected from one of ethyl, propyl, isopropyl, isobutyl, ethyl or propyl with a halogen atom at the end, allyl, propargyl, acryloyl, sulfonyl fluoride, cyclopropylmethyl, glycidyl, and cyclobutylmethyl; R2 is selected from one of n-hexyl, cyclopropylmethyl, and phenethyl.

2. A (+)-naltrexone derivative drug, characterized in that: Includes (+)-naltrexone derivatives as shown in formula (I) as claimed in claim 1.

3. The application of a (+)-naltrexone derivative in the preparation of drugs for treating neuroinflammatory diseases.

4. The use of a (+)-naltrexone derivative in the preparation of drugs for the treatment or prevention of addiction to amphetamine-type drugs.

5. The application as described in claim 3 or 4, characterized in that: The formula (I) as described in claim 1 is administered at a dose of 0.01 to 100 mg / kg.

6. The application as described in claim 4, characterized in that: The amphetamine-type drugs include methamphetamine, amphetamine, 3,4-methylenedioxyamphetamine, 3,4-methylenedioxymethamphetamine, and their chiral enantiomers.

7. The application as described in claim 4, characterized in that: Formula (I) as described in claim 1 can be used with pharmacologically acceptable excipients.

8. The application as described in claim 3 or 4, characterized in that: This includes oral, subbuccal, sublingual, rectal, vaginal, intravenous, intra-arterial, intramedullary, intramuscular, intracerebral, intraventricular, intraspinal, subcutaneous, intraperitoneal, intraocular, intranasal, transdermal, epidural, intracranial, intrauterine, intravitreal, mucosal, and inhaler-mediated administration.

Images