Inhibitory lactic acidification site of sod1 protein and application thereof

Abstract

The application discloses an inhibitory lactoylation site of SOD1 protein and application thereof, the site is a lysine at the 123th position of wild type SOD1 protein with an amino acid sequence as shown in SEQ ID NO.1, namely K123. The application has high specificity, high sensitivity and repeatability, the screened SOD1-K123 lactoylation site can be used as a potential biomarker for IVDD diagnosis and a potential target for treatment, and provides a new technical direction and experimental basis for precise diagnosis and treatment of IVDD.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and provides an inhibitory lactation site of SOD1 protein and its application. Background Technology

[0002] Discogenic low back pain is closely related to intervertebral disc degeneration (IVDD), a leading cause of disability and productivity decline in the global working population. Epidemiological studies have shown that over 400 million people worldwide suffer from IVDD, and its incidence continues to rise with population aging, imposing a significant burden on society and the economy. IVDD is characterized by impaired function of nucleus pulposus cells (NPCs), and its development is closely related to the unique microenvironment of the intervertebral disc, including low blood supply and restricted metabolic waste clearance.

[0003] Studies have shown that in the nucleus pulposus of degenerated intervertebral discs, glucose metabolism disorders and decreased endplate osmotic function lead to the abnormal accumulation of various metabolites. In particular, lactate concentration is significantly elevated, exceeding 10 mM, far higher than normal levels. In recent years, a novel post-translational modification—lysine lactylation—has been found to participate in various pathological processes. Lactate can further form lactoyl-CoA and modify specific sites on proteins. Lactylation is prevalent in high-lactate microenvironments and has been shown to regulate key biological processes such as oxidative stress and cellular senescence. However, the mechanism of action of lactylation in oxidative damage of NPC (periodontal inflammatory disease) remains poorly understood.

[0004] SOD1 is a key enzyme in the body that scavenges superoxide anions and inhibits oxidative stress damage. Previous studies have reported that lactylation can occur in NPC (oxidative stress disorder), but whether SOD1 protein can undergo lactylation modification, and the key lysine residues involved in SOD1 and lactylation modification, remain unclear. Therefore, elucidating whether lactate-induced SOD1 lactylation drives oxidative damage in NPC, its key functional sites, and regulatory mechanisms will provide an important theoretical basis and potential targets for IVDD intervention. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide an inhibitory lactation site of the SOD1 protein and its application. Addressing the unclear mechanisms and unknown key lactylation sites in existing technologies regarding the role of SOD1 lactation in NPC oxidative stress damage and intervertebral disc degeneration, this invention clarifies the mechanism of lactate-induced protein lactylation in IVDD, constructs a nucleus pulposus tissue lactylation proteome, and screens and verifies key proteins and sites that undergo specific lactylation changes during intervertebral disc degeneration. This invention reveals the role of key lactylation modification sites (such as K10 and K123) of the antioxidant enzyme SOD1 in IVDD and verifies the pathogenic function of these sites through gene mutation. This invention aims to solve the problems in existing technologies such as insufficient understanding of the pathogenesis of IVDD, the unclear association between lactate-induced protein lactylation and IVDD, and the lack of precise research techniques for the key lactylation modification protein SOD1 and its lactylation sites in IVDD.

[0006] To achieve the above objectives, the present invention provides the following technical solution: 1. The present invention provides an inhibitory lactation site for SOD1 protein, which is lysine 123 of the wild-type SOD1 protein as shown in SEQ ID NO.1, i.e., K123.

[0007] 2. This invention provides the application of a reagent targeting an inhibitory lactation site of the aforementioned SOD1 protein in the preparation of an early diagnostic kit or therapeutic drug for intervertebral discogenic low back pain and intervertebral disc degeneration (IVDD).

[0008] 3. The present invention provides an early diagnostic kit or therapeutic drug for discogenic low back pain and intervertebral disc degeneration (IVDD), which contains a reagent targeting an inhibitory lactation site of the aforementioned SOD1 protein.

[0009] 4. The present invention provides a mutant SOD1 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0010] As one of the preferred technical solutions, the mutant is based on the wild-type SOD1 protein with an amino acid sequence as shown in SEQ ID NO.1, and contains the K123R mutation site, that is, the 123rd position is mutated from lysine to arginine.

[0011] 5. This invention provides the application of reagents that promote the expression of the aforementioned SOD1 protein mutants in the preparation of IVDD drugs for the prevention or treatment of discogenic low back pain and disc degeneration.

[0012] As one of the preferred technical solutions, the SOD1 protein mutant inhibits the damage of lactate to the function of SOD1 enzyme, improves the antioxidant capacity of nucleus pulposus cells, and inhibits the accumulation of superoxide anions in nucleus pulposus cells.

[0013] 6. An IVDD drug for the prevention or treatment of discogenic low back pain and disc degeneration, comprising an agent that promotes the expression of the aforementioned SOD1 protein mutant.

[0014] 7. The method for constructing the SOD1-K123R point mutation rat model is as follows: S1. Specific sgRNAs were designed targeting the 5th exon region of the Sod1 gene and prepared via in vitro transcription; S2. Design a single-stranded oligonucleotide donor ssODN containing a mutation site and two homologous arms; S3. Cas9 mRNA, sgRNA and ssODN were mixed and microinjected into rat zygotes, then transplanted into the oviducts of pseudopregnant rats. After the pups were born, they were sequenced and identified to obtain an SOD1-K123R point mutant rat model.

[0015] 8. The SOD1-K123R point mutation rat model was obtained through the aforementioned construction method.

[0016] The beneficial effects of this invention are: This invention provides an inhibitory lactation site for the SOD1 protein and its application. Specifically, this invention involves two steps: I. Elucidation of the mechanism of action of lactylation in IVDD and construction and screening of key targets of the lactylation proteome in nucleus pulposus tissue 1. Sample preparation: Normal nucleus pulposus tissue samples from SD rats and IVDD degenerated nucleus pulposus tissue samples were selected as research subjects. All samples were identified and grouped by imaging and histology. Total protein of the two groups of samples was extracted by low-temperature grinding combined with RIPA lysis buffer (with added protease inhibitors, deacetylase inhibitors and lactylase inhibitors). Protein concentration was determined by BCA method and standardized to ensure the consistency and reliability of subsequent experimental samples.

[0017] 2. Enrichment of lactylated peptides: Standardized total protein was subjected to trypsin digestion to obtain a peptide mixture; lactylated peptides were enriched by immunoprecipitation using an anti-lactyllysine antibody; non-specifically bound impurities were removed by gradient washing with washing solution to finally obtain a high-purity lactylated peptide sample.

[0018] 3. Lactylation proteomics detection: The enriched lactylated peptides were detected by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS / MS). Appropriate mass spectrometry parameters (such as scan range, collision energy, and resolution) were set to obtain the mass spectrometry data of the peptides. Qualitative analysis of the mass spectrometry data was performed using a database search (such as the UniProt database) combined with MaxQuant software to identify the lactylated modified proteins and their corresponding modification sites. Label-free quantitative analysis was used to compare the expression levels of lactylated proteins and the abundance of modification sites between the normal group and the IVDD group.

[0019] 4. Bioinformatics Analysis: GO functional annotation (including biological processes, cellular components, and molecular functions), KEGG pathway enrichment analysis, and protein-protein interaction (PPI) network construction were performed on the identified lactylated proteins to clarify the core pathways and regulatory networks of lactylated proteins in the IVDD process. Based on the quantitative analysis results, specific lactylated proteins and their corresponding sites that showed significant differences in lactylation levels in the IVDD group (e.g., upregulation or downregulation ≥ 1.5, P < 0.05) were screened as key targets for subsequent validation.

[0020] 5. Validation of key proteins: Western blotting was used to validate the differences in the total expression level and lactylation modification level of the key lactylated proteins screened in the two groups of samples. It was preliminarily determined that the lactylation modification of SOD1 was significantly different and functionally important.

[0021] 6. Identification of SOD1 lactylation modification sites: Mass spectrometry data from lactylated proteomics were retrieved to identify K10 and K123 lactylation modification sites in the SOD1 protein. These sites will be used for subsequent research.

[0022] II. The role and pathogenic function verification of the lactylation modification site of antioxidant enzyme SOD1 1. Construction of SOD1 gene variants: Based on the known sequence of the SOD1 gene, specific primers were designed, and the full-length SOD1 gene was amplified from cDNA of normal nucleus pulposus tissue using PCR technology; using site-directed mutagenesis, lysine was mutated to arginine to construct SOD1 delactylated mutants (K10R, K123R) at the K10 and K123 sites; wild-type SOD1 (SOD1-WT) or KR mutants were cloned into eukaryotic expression vectors (pcDNA3.1) to construct recombinant expression plasmids, and sequencing verification was performed to ensure the accuracy of the mutation sites.

[0023] 2. Cell model transfection: Rat nucleus pulposus cells were selected and divided into blank control group, lactate treatment group, SOD1-WT + lactate treatment group, SOD1-K10R + lactate treatment group, and SOD1-K123R + lactate treatment group. The corresponding recombinant expression plasmid or empty vector was transferred into the cells using liposome transfection and cultured for 48-72 hours after transfection.

[0024] 3. Effect of SOD1-K123 site lactylation modification on its function: The enzyme activity of SOD1 in cells of each group was detected to clarify the regulatory role of K123 site lactylation modification on the antioxidant function of SOD1; the intracellular SOD1 enzyme activity, total cellular antioxidant capacity, and intracellular superoxide anion level were detected to analyze the effect of this site lactylation modification on cellular oxidative stress.

[0025] This invention has the following advantages: 1. Filling research gaps and improving the theoretical system of IVDD pathogenesis: Current technology’s understanding of the pathogenesis of IVDD is limited to traditional pathways such as inflammatory response, oxidative stress, and matrix degradation, and the association between lactate-induced protein lactylation and IVDD has not yet been clarified.

[0026] This invention clarifies for the first time the mechanism of lactate-induced protein lactylation in IVDD, innovatively constructs a lactylated proteome of nucleus pulposus tissue, establishes a complete technical system of "sample preparation - lactylated peptide enrichment - mass spectrometry detection - bioinformatics analysis - target verification", identifies key proteins and sites of specific lactylation changes during IVDD, and achieves precise screening of key proteins and sites of specific lactylation changes during IVDD. It fills the gap in the existing technology for the study of the association between lactylation modification and IVDD, incorporates lactylation modification into the regulatory network of IVDD pathogenesis, enriches the theoretical connotation of IVDD pathogenesis, and provides a new research perspective and theoretical support for subsequent basic research on IVDD.

[0027] 2. Precisely locating key targets provides a new direction for the precise diagnosis and treatment of IVDD: Existing technologies lack specific diagnostic biomarkers and highly effective therapeutic targets for IVDD, resulting in limited clinical treatment outcomes. This invention is the first to clearly identify the K123 site of the antioxidant enzyme SOD1 as a key lactylation modification site in IVDD and verify the pathogenic function of this site. Specifically, a specific mutant was constructed using site-directed mutagenesis technology, and combined with cell function experiments, a technical method of "gene cloning-mutant construction-cell transfection-functional verification" was established. This clarified the regulatory role of K123 site lactylation modification on SOD1 enzyme function and the antioxidant capacity of nucleus pulposus cells, providing a new theoretical basis for the pathogenesis of IVDD. This site can serve as a potential specific diagnostic biomarker for IVDD, enabling early diagnosis and disease assessment of IVDD by detecting the level of SOD1-K123 lactylation in nucleus pulposus tissue or body fluids. At the same time, this site can serve as a potential target for IVDD treatment, providing a clear target for the development of targeted modification inhibitors or activators, breaking through the bottleneck of the lack of specificity in existing IVDD treatments, and promoting the development of precision treatment for IVDD.

[0028] 3. Establishing an efficient and reliable technical system with broad application value: The complete technical system established in this invention, encompassing "lactylation proteome construction - key target screening - site function verification," possesses advantages such as high specificity, high sensitivity, and reproducibility. This technical system can not only be used for research on lactylation modification in IVDD, but can also be extended to the study of other degenerative diseases related to abnormal lactate metabolism or protein modification (such as osteoarthritis), providing a standardized technical paradigm for mechanism exploration and target screening in similar diseases, and possessing broad academic promotion value and application prospects.

[0029] Furthermore, the experimental techniques used in this invention (such as HPLC-MS / MS, site-directed mutagenesis, cell function detection, etc.) are all mature and conventional techniques that are easy to operate, cost-controllable, and easy to promote and implement in the laboratory, possessing good operability and industrialization potential.

[0030] 4. Enhancing the accuracy and efficiency of IVDD basic research: Existing technologies for screening IVDD-related protein modification targets often employ generalized proteomics analysis, resulting in problems such as vague target selection, poor specificity, and low validation efficiency. This invention utilizes a progressive screening and validation strategy of "specific enrichment of lactylated peptides - mass spectrometry detection - precise bioinformatics analysis - multi-technical verification," which can quickly and accurately identify specific lactylation targets and sites related to IVDD. This significantly improves the accuracy and efficiency of target screening, reduces the blind spots in subsequent research, and provides technical support for the efficient conduct of IVDD basic research.

[0031] This invention has high specificity, high sensitivity and reproducibility. The screened SOD1-K123 lactylation sites can serve as potential biomarkers for the diagnosis of IVDD and potential targets for treatment, providing a new technical direction and experimental basis for the precision diagnosis and treatment of IVDD.

[0032] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description

[0033] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein: Figure 1 Bioinformatics analysis results of differentially modified lactate proteins and sites: A: Pie chart of subcellular localization distribution of differentially modified lactate proteins. The cytoplasm accounts for the highest proportion (54.4%), followed by the nucleus (19.1%), mitochondria (9.2%), and extracellular matrix (6.3%). B: Volcano plot of differentially modified lactate proteins. Different colors represent downregulated (blue), upregulated (orange), and no significant difference (gray) modified proteins, visually presenting the significant differences in protein modification levels. C: Bar chart of the number of differentially modified proteins and sites in the intervertebral disc degeneration group and the control group. D: Bubble chart of KEGG pathway enrichment of differentially modified proteins. E: GO enrichment heatmap of differentially modified proteins according to biological processes. F: GO enrichment bar chart of differentially modified proteins.

[0034] Figure 2 Secondary mass spectra of lactation modification sites: A. SOD1-K10 site; B. SOD1-K123 site; The horizontal axis represents the mass-to-charge ratio (m / z), and the vertical axis represents the ionic intensity; The figure shows the characteristic ion peaks of the lactylated peptides containing K10 and K123 sites in the SOD1 protein, which are reflected by a mass shift of 200.12 or 200.11 at the corresponding positions. This value is close to the value after adding the mass of the lactyl group (72.021) to the original mass of lysine K (128.09), and the ion peak signal intensity is high with little interference, confirming that the SOD1 protein has lactation modification at K10 and K123 sites.

[0035] Figure 3A diagram showing the species conservation of the SOD1 K123 site in humans, rats, and mice. The diagram shows partial amino acid sequences of the SOD1 protein in the three species (human, rat, and mouse) arranged horizontally, and the sequence alignment results are labeled vertically. The boxes indicate the amino acids corresponding to the K10 and K123 sites. It can be seen that this site is completely identical in the SOD1 protein sequences of the three different species, indicating that the K10 and K123 sites have a high degree of species evolution conservation.

[0036] Figure 4 A schematic diagram of the SOD1 K123R mutation; the figure shows the amino acid residue sequence corresponding to the mutation region at the K123 site in the SOD1 gene; the highlighted area is the mutation site, which corresponds to the base AAA (encoding lysine K) in the wild-type sequence and AGG (encoding arginine R) after mutation.

[0037] Figure 5 Effects of Lactic Acid and KR Mutation on Oxidation-Related Indicators in Nucleus Pulp Cells. A. Results of SOD1 enzyme activity assay after lactate treatment in nucleus pulposus cells with SOD1 KR mutation. The results show that SOD1 enzyme activity was significantly reduced after lactate treatment, while K123R effectively inhibited the damage of lactate to SOD1 enzyme function, and K10R did not have the above effect, reflecting the inhibitory effect of K123 site lactation modification on SOD1 enzyme activity. B. Results of total antioxidant capacity assay after lactate treatment in nucleus pulposus cells with SOD1 KR mutation. The results show that the total antioxidant capacity after lactate treatment was significantly lower than that of the control group, and the total antioxidant capacity of the SOD1-K123R group was significantly higher than that of the lactate-only treatment group, indicating that K123 site lactation modification can reduce the overall antioxidant capacity of nucleus pulposus cells by inhibiting SOD1 activity. C, D: Results of superoxide anion content detection in SOD1 K123R mutant nucleus pulposus cells after lactate treatment (DHE probe method); the figures include cell imaging under a fluorescence microscope (C) and the corresponding quantitative analysis bar chart (D); the red fluorescence intensity in the imaging represents the superoxide anion content, and the vertical axis of the bar chart represents the probe fluorescence intensity. The results show that the red fluorescence intensity of nucleus pulposus cells was significantly enhanced after lactate treatment, indicating an increase in superoxide anion content, while the fluorescence intensity of the lactate-treated SOD1-K123R group was significantly weakened, confirming that lactation modification at the K123 site leads to the accumulation of superoxide anions in nucleus pulposus cells. Error bars represent the standard deviation of each experiment, * indicates P < 0.05, **** indicates P < 0.001, and ns indicates no statistical difference.

[0038] Figure 6This diagram illustrates the construction of SOD1-K123R point mutant rats. Figure A shows a schematic of the mutation sequence, representing the amino acid residue sequence corresponding to the Exon region at the K123 site of the SOD1 gene mutation. The red markers indicate the mutation site; in the wild-type sequence, this site corresponds to AAA (encoding lysine K), while the mutated site corresponds to AGG (encoding arginine R). Figure B shows the Sanger sequencing results of the SOD1-K123R point mutant rats. The sequencing chromatograms were compared with the wild-type rat Sod1 reference sequence (NM_017050.1). The wild-type sequence shows AAA (lysine K) at the corresponding position, while the mutant sequence shows AGG (arginine R) at the corresponding position. Figure 7 To verify the protective effect of the SOD1-K123R mutation against IVDD in vivo, male wild-type rats and male SOD1-K123R mutant rats underwent acupuncture treatment of the intervertebral discs at the 6th-7th caudal vertebral intervertebral space, while a control group underwent sham surgery. SO & FG staining images (A) and corresponding histological score bar charts (B) were generated for the four groups of animals. The vertical axis of the bar chart represents the histological score, and the error bars represent the standard deviation. *** indicates P < 0.01, **** indicates P < 0.001. The results showed that after acupuncture modeling, the nucleus pulposus tissue was significantly reduced, the intervertebral height was significantly decreased, the histological score was significantly increased, and intervertebral disc degeneration was significant. However, the degree of intervertebral disc degeneration was weakened in the SOD1-K123R mutant rat group, confirming that the K123R mutation can effectively inhibit intervertebral disc degeneration in the rat acupuncture degeneration model. Scale bar = 1000 μm. The results of SOD1 enzyme activity detection in the nucleus pulposus of the caudal intervertebral disc of group C4 animals are shown in the figure. The results show that the SOD1 enzyme activity in the nucleus pulposus was significantly reduced after acupuncture treatment, while the SOD1 enzyme activity in the nucleus pulposus of the SOD1-K123R mutant rat group was significantly increased, proving that K123R can effectively inhibit the damage to SOD1 enzyme function. Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments.

[0040] I. Preparation of Experimental Materials 1. Cells: Rat nucleus pulposus cells were extracted from the caudal intervertebral discs of SD rats using the method described in the applicant's reference "Isolation, Culture and Identification of Rat Caudal Intervertebral Disc Nucleus Pulsus Cells, 2016, 35, (1-6)". The cells were cultured in DMEM / F12 medium containing 10% fetal bovine serum (FBS, Gibco brand) and 1% penicillin-streptomycin mixture (solarbio brand) and were routinely cultured in a 37℃, 5% CO2 incubator. Cells in the logarithmic growth phase were selected for subsequent experiments.

[0041] 2. Twenty healthy SPF-grade male SD rats (8 weeks old, weighing 200-220g) were purchased from Chengdu Dashuo Experimental Animal Technology Co., Ltd. The rats were randomly divided into two groups: a normal control group (n=10) and a rat caudal intervertebral disc degeneration model group (n=10). After effective anesthesia, the rats in the model group were fixed in a prone position. The intervertebral disc at the 6th-7th segment of the caudal vertebrae was located, and a sterile 21G needle was used to vertically puncture the center of the intervertebral disc to a depth of 5mm. After 30 seconds, the needle was slowly withdrawn to establish the rat caudal intervertebral disc degeneration model. No intervertebral disc puncture was performed in the control group. All rats were routinely fed for 4 weeks post-surgery at an ambient temperature of 22-25℃ and humidity of 50%-60%, with free access to food and water. After 4 weeks, the rats were anesthetized again, and the nucleus pulposus tissue at the 6th-7th segment of the caudal vertebrae from both the normal control group and the model group was dissected and immediately frozen at -80℃ for later use. This experimental protocol was approved by the Laboratory Animal Ethics Committee of our institution (Ethics Approval No.: AMUWEC20235167), and the experimental process strictly followed the animal welfare and ethical guidelines.

[0042] 3. Main reagents and instruments: RIPA lysis buffer, protease inhibitors, deacetylase inhibitors, lactylase inhibitors (all purchased from Solarbio); lactylation-specific antibody (anti-lactyllysine antibody, Jingjie Biotechnology); trypsin (Promega brand); high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS / MS, Thermo Fisher, model Q ExactiveHF-X); site-directed mutagenesis kit (Stratagene); liposome transfection reagent Lipofectamine 3000 (Invitrogen); SOD enzyme activity assay kit, total antioxidant capacity (T-AOC) assay kit, superoxide anion assay kit (DHE probe method, all purchased from Beyotime); PCR instrument (Bio-Rad).

[0043] II. Specific Implementation Steps Total protein extraction and enrichment of lactylated peptides from nucleus pulposus tissue 1. Take 100 mg of nucleus pulposus tissue samples from frozen normal SD rats and IVDD-induced SD rats, place them in a pre-cooled mortar, add liquid nitrogen and grind them thoroughly into powder, then transfer them to centrifuge tubes.

[0044] 2. Add 1 mL of pre-chilled RIPA lysis buffer (containing 1% protease inhibitor cocktail, 1 mM deacetylase inhibitor, and 1 mM lactylase inhibitor) to a centrifuge tube and lyse on ice for 30 min, vortexing once every 5 min to ensure complete lysis.

[0045] 3. Centrifuge at 12000 rpm for 30 min at 4℃, and collect the supernatant, which is the total protein extract. Determine the protein concentration using the BCA method, standardize the protein concentration of each group of samples to 2 μg / μL, and freeze at -80℃ for later use.

[0046] 4. Take 200 μg of standardized total protein, add trypsin (enzyme:protein ratio 1:50), and enzymatically hydrolyze at 37°C for 12 h to obtain a peptide mixture; add lactylation-specific antibody to the peptide mixture and incubate at 4°C overnight for immunoprecipitation reaction.

[0047] 5. Add Protein A / G agarose beads and incubate at 4°C for 2 hours to allow the antibody-antigen complex to fully bind to the agarose beads. Wash three times each with low-concentration washing buffer (50 mM Tris-HCl, pH 7.4, containing 100 mM NaCl) and high-concentration washing buffer (50 mM Tris-HCl, pH 7.4, containing 500 mM NaCl). After each wash, centrifuge at 4°C and 3000 rpm for 5 minutes and discard the supernatant. Finally, elute the bound lactylated peptides with elution buffer, collect the eluent, and freeze-dry for later use.

[0048] Identification of SOD1-K10 and SOD1-K123 site lactylation modification ( Figure 1 and Figure 2 ) 1. The lyophilized lactylated peptide fragments were reconstituted with 0.1% formic acid solution and detected by HPLC-MS / MS: the chromatographic column was a C18 reversed-phase column (150μm×100mm, 1.9μm), mobile phase A was 0.1% formic acid aqueous solution, and mobile phase B was 0.1% formic acid acetonitrile solution. The gradient elution program was: 0-5 min, 5% B; 5-40 min, 5%-35% B; 40-45 min, 35%-95% B; 45-50 min, 95% B; flow rate 300 nL / min.

[0049] 2. Mass spectrometry detection parameters: The ion source is an electrospray ionization (ESI) source, positive ion mode, scan range m / z 300-1800, first-stage mass spectrometry resolution 70000, second-stage mass spectrometry resolution 17500, collision energy 30 eV, dynamic exclusion time 15 s.

[0050] 3. Mass spectrometry data were analyzed using MaxQuant software. The UniProt rat protein database was searched, and lactylation (K-lactyl) was set as a variable modification. Lactylated peptides with confidence ≥95% and their corresponding modification sites were screened. The lactylated peptide sequences of SOD1 protein were obtained, and their secondary mass spectra are shown below. Figure 1 As shown, Figure 1The characteristic ion peaks are clearly identifiable, and the mass shifts at the corresponding positions of K10 and K123 are 200.12 or 200.11. These values ​​are close to those obtained by adding a lactyl group (72.021) to the original mass of lysine K (128.09), confirming that the SOD1 protein has lactylation modification at the K10 and K123 sites.

[0051] Species conservation analysis of SOD1 K123 loci ( Figure 3 ) 1. Download the amino acid sequences of SOD1 protein from human (Homo sapiens, accession number NP_000445.1), rat (Rattusnorvegicus, accession number NP_036608.1), and mouse (Mus musculus, accession number NP_035432.1) from the NCBI database.

[0052] 2. Multiple alignment analysis of the SOD1 protein amino acid sequences of the three species was performed using ClustalX 2.0 software, and sequence conservation diagrams were plotted using MEGA 11 software. Figure 3 ). Figure 3 The results showed that the K10 and K123 sites of the SOD1 protein were highly conserved in humans, rats, and mice, suggesting they may have important evolutionarily conserved functions, providing species-level evidence for their role as key regulatory sites for IVDD. It should be noted that modern bioinformatics databases (such as UniProt) often provide full-length sequence numbers, with the first amino acid typically being methionine (Met, M). However, previous classical biochemical literature tended to use the numbering of mature proteins (where the first M is removed), which led to the K10 and K123 sites of the SOD1 protein described in this patent being reported as K9 and K122 in some literature.

[0053] Construction and sequence verification of SOD1-KR mutants Figure 4 ) 1. Using rat SOD1 gene cDNA as a template, site-directed mutagenesis primers targeting the K10 site (upstream primer: 5'-GCG GCG GCC TGG CGG CCG TGG GCG AAG-3', downstream primer: 5'-CTT CGC CCA CGG CCGCCA GGC CGC CG-3') and site-directed mutagenesis primers targeting the K123 site (upstream primer: 5'-GCTGAAGCTGCGCGACCGG-3', downstream primer: 5'-CCGGT CGCGCAGCTTCAGC-3') were designed. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0054] 2. The site-directed mutagenesis kit was used for the mutagenesis reaction. The reaction system was as follows: 10×PCR Buffer 5μL, dNTPMix 1μL, upstream primer (10μM) 1μL, downstream primer (10μM) 1μL, template cDNA 2μL, Pfu DNA polymerase 0.5μL, and sterile deionized water to a final volume of 50μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 8 min, for a total of 30 cycles; and 72℃ final extension for 10 min.

[0055] 3. The PCR product was digested with DpnI enzyme (incubated at 37°C for 1 h) to remove the template DNA. The digested product was then transformed into DH5α competent cells, plated on LB solid medium containing ampicillin, and incubated overnight at 37°C.

[0056] 4. Select single colonies for amplification culture, extract recombinant plasmids, and construct wild-type SOD1 (SOD1-WT) recombinant plasmid as a control.

[0057] Cell transfection and lactate treatment 1. Logarithmic growth phase rat nucleus pulposus cells were seeded into 6-well plates, with 5 × 10⁶ cells seeded per well. 5 Each cell was cultured for 24 hours until the cell confluence reached 60%-70%.

[0058] 2. The cells were divided into 5 groups: blank control group (no plasmid transfection), blank control group (no plasmid transfection), SOD1-WT group (transfected with SOD1-WT recombinant plasmid, the amino acid sequence of SOD1-WT is shown in SEQ ID NO.1), SOD1-K10R group (transfected with SOD1-K10R recombinant plasmid, the amino acid sequence of SOD1-K10R is shown in SEQ ID NO.3), and SOD1-K123R group (transfected with SOD1-K123R recombinant plasmid, the amino acid sequence of SOD1-K123R is shown in SEQ ID NO.2). Each group was configured with 3 replicates.

[0059] 3. Lipofectamine 3000 reagent was used for transfection according to the instructions. After transfection, the culture medium was replaced with fresh medium after 6 hours, and the cells were cultured for another 48 hours. Western blotting was used to verify the expression efficiency of SOD1 protein in each group of cells to ensure successful transfection.

[0060] 4. 48 h after transfection, lactate (final concentration of 10 mM) was added to the cells in the other three groups except for the first blank control group. An equal amount of culture medium was added to the blank control group. The cells were cultured for another 24 h for subsequent functional testing.

[0061] SOD1 enzyme activity assay Figure 5 (A) 1. Collect cells from each group after the above treatment, wash twice with pre-cooled 0.01M PBS buffer (pH=7.4), add cell lysis buffer and lyse on ice for 20 min, centrifuge at 4℃ and 12000rpm for 15 min, and collect the supernatant as the total cell protein extract.

[0062] 2. Follow the instructions of the SOD enzyme activity assay kit, add the reaction solution and sample supernatant in sequence, incubate at 37℃ for 30 min, and measure the absorbance (OD value) of each well at a wavelength of 450 nm.

[0063] 3. The SOD1 enzyme activity in each group of cells was calculated based on the standard curve, and the results were expressed as "U / g protein" and a statistical graph was plotted. The results showed that, compared with the lactate-treated group alone, the SOD1-K123R group (K123 site delactylation mutation) showed a significant increase in SOD1 enzyme activity after lactate treatment (P<0.001), confirming that SOD1-K123 site lactylation modification can inhibit its enzyme activity.

[0064] Total antioxidant capacity test ( Figure 5 (B) 1. The total cell protein extract was prepared using the same method as before. Following the instructions of the Total Antioxidant Capacity (T-AOC) assay kit, sample supernatant, reaction substrate, and chromogenic reagent were added, and the mixture was incubated at 37°C for 60 min. The OD value of each well was measured at 520 nm.

[0065] 2. The total antioxidant capacity of each group of cells was calculated based on the standard curve. The results showed that, compared with the lactate-treated group, the total antioxidant capacity of the SOD1-K123R group (K123 site delactylation mutation) was significantly increased after lactate treatment (P<0.001), indicating that SOD1-K123 site lactylation modification can reduce the total antioxidant capacity of nucleus pulposus cells by inhibiting SOD1 enzyme activity.

[0066] Detection of superoxide anion content ( Figure 5 (C, D) 1. Seed each group of cells in confocal culture dishes and cultured until the confluence reached 70%. Then, perform transfection and lactate treatment as described above.

[0067] 2. After processing, add DHE probe (final concentration 5 μM) to the culture dish, incubate at 37°C and 5% CO2 for 30 min, and wash three times with pre-cooled PBS buffer to remove unbound probe.

[0068] 3. The fluorescence intensity of intracellular superoxide anions was observed using fluorescence microscopy (excitation wavelength 543 nm, emission wavelength 610 nm), and the fluorescence intensity values ​​were quantitatively analyzed using ImageJ software. The results showed that, compared with the lactate treatment group alone, the fluorescence intensity of intracellular superoxide anions in the SOD1-K123R group (K123 site delactylation mutation) was significantly reduced after lactate treatment (P<0.001), indicating that SOD1-K123 site lactylation modification can lead to the accumulation of superoxide anions in nucleus pulposus cells and aggravate oxidative stress damage.

[0069] Construction of SOD1-K123R point mutant rats ( Figure 6 (A, B) 1. In this embodiment, the Sod1 gene from rats (Rattus norvegicus) was selected as the target gene. GenBank accession number: NM_017050.1. Ensembl ID: ENSRNOG00000002115. Chromosomal location: chromosome 11. The nucleotide sequence of the Sod1 gene is shown in SEQ ID NO.4. This gene contains 5 exons, with the start codon ATG located in exon 1 and the stop codon TAA located in exon 5. K123 was selected as the mutation site. The target mutation site p.K123 is located in exon 5 of the Sod1 gene. The wild-type sequence encodes lysine (Lys, K) with the codon AAA. The mutation goal is to mutate this site to arginine (Arg, R), that is, to mutate the codon from AAA to AGG.

[0070] 2. Design and Synthesis of sgRNAs. Specific sgRNAs (single guide RNAs) targeting the 5th exon region of the Sod1 gene were designed to guide Cas9 nuclease cleavage at the target site. Two sgRNA sequences were designed, both recognizing the target region: gRNA-A1 target sequence: 5'-CCAAGTCATCTTGTTTCTCG-3' (PAM: TGG); gRNA-B1 target sequence: 5'-CCACGAGAAACAAGATGACT-3' (PAM: TGG). The sgRNAs were prepared by in vitro transcription for subsequent microinjection.

[0071] 3. Donor Oligonucleotide Design: To introduce point mutations via homologous recombination (HDR), a single-stranded oligonucleotide donor (ssODN) containing the mutation site and flanking homologous arms was designed. The design strategy involved including approximately 120 bp homologous sequences at both ends of the donor sequence. The sequence was characterized by the presence of the p.K123R mutation (AAA > AGG). Specific sequence: WT: GTGCTAATTACTTGATCACCGAAACCTAAATGTTCTTAATTCTTTTCAAAGGTCC ACGA / / G(AAA)CAAGATG / / ACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACTGGAAATGCTGGAAGC ( / / represents the gRNA splicing site); Mutant: GTGCTAATTACTTGATCACCG AAACCTAAATGTTCTTAATTCTTTTCAAAGGTCCACGAG(AGG)CAAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACTGGAAATGCTGGAAGC.

[0072] 4. Microinjection: Fertilized eggs from SD rats were collected. Cas9 mRNA, sgRNA, and ssODN were mixed at a mass concentration ratio of 50:20:100 (ng / µL). The mixture was microinjected into the fertilized eggs, with a total injection volume of approximately 2 pL per embryo, ensuring sufficient Donor template to enter the cells to support homologous recombination repair. The injected fertilized eggs were then transferred to the oviducts of pseudopregnant rats, awaiting the birth of the pups.

[0073] 5. Sanger sequencing identification of SOD1-K123R rats. Tail tissue (approximately 2 mm) was harvested from newborn F0 generation rats. Digestion method: The tail tissue was placed in a centrifuge tube containing digestion buffer (50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, and 0.4 mg / mL Proteinase K) and digested in a 55°C water bath. After digestion, the tissue was incubated at 98°C for 13 minutes to inactivate Proteinase K. The tissue was centrifuged at 12,000 rpm for 15 minutes, and the supernatant was used as a template for PCR. Based on the rat Sod1 gene sequence, specific primers were designed to identify the K123R mutation: forward primer (F1): 5'-TTC TTG GCT TAG CCA GTC GTT-3'; reverse primer (R1): 5'-TAT TTT CAA AAC CAA TCC ACC CT-3'. Amplification product length: 452 bp for both wild-type and mutant. The reaction system (25 μL) consisted of: Green Taq Mix (2x): 12.5 μL; forward primer (10 μM): 1.0 μL; reverse primer (10 μM): 1.0 μL; genomic DNA template: 1.5 μL; ddH2O: 9.0 μL. The cycling conditions were: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 15 s; annealing: 60°C, 15 s; extension: 72°C, 30 s; number of cycles: 35; final extension: 72°C, 5 min.

[0074] The chromatograms obtained from sequencing were compared with the rat Sod1 wild-type reference sequence (NM_017050.1). Wild-type: The sequence is shown as AAA (lysine K) at the corresponding position. Mutant / KI: The sequence is shown as AGG (arginine R) at the corresponding position.

[0075] In vivo experiments to verify the protective effect of SOD1-K123R mutation against IVDD ( Figure 7 ) 1. Acupuncture-induced IVDD model: Male wild-type rats (2 months old, 200-220g) and male SOD1-K123R mutant rats (2 months old, 200-220g) were subjected to acupuncture treatment, while the control group (Sham treatment) was used. Acupuncture was performed under isoflurane inhalation anesthesia. The location was determined at the 5-6 intervertebral space of the coccyx (palpation or X-ray). A 21G needle (with a depth limiter) was vertically inserted to a depth of 5mm, rotated 360°, and held for 30 seconds. Postoperative disinfection and analgesia with antibiotics were administered for 3 days. The Sham group underwent the same procedure but without acupuncture.

[0076] 2. Assessment of the degree of intervertebral disc degeneration: Histological assessment: Animals were sacrificed, and intervertebral disc tissue was collected, fixed in 4% paraformaldehyde for 48 hours, decalcified with EDTA for 2 weeks, embedded in paraffin, sectioned at 5 μm, and stained with modified SO & FG. Histological scoring was performed using a blinded method by three researchers. Results showed that after acupuncture, the histological score of SOD1-K123R mutant rats was improved by 30-50% compared to wild-type rats (P<0.001), demonstrating that inhibiting SOD1-K123R lactation has a protective effect against IVDD.

[0077] 3. SOD1 Enzyme Activity Assay. Nucleus pulposus tissues from each group after the above treatment were collected, washed twice with pre-chilled 0.01M PBS buffer (pH=7.4), and lysed on ice for 20 min with cell lysis buffer. The tissues were then centrifuged at 12000 rpm for 15 min at 4℃, and the supernatant was collected as the total cell protein extract. Following the instructions of the SOD enzyme activity assay kit, reaction solution and sample supernatant were added sequentially, and the mixture was incubated at 37℃ for 30 min. The absorbance (OD value) of each well was measured at 450 nm. The SOD1 enzyme activity in the nucleus pulposus tissues of each group was calculated based on the standard curve. The results are expressed as "U / g protein" and a statistical graph was plotted. The results showed that SOD1-K123R mutant rats showed a 30-50% improvement in SOD1 activity after acupuncture compared to wild-type rats (P<0.001). This confirms that inhibiting SOD1-K123R lactation can protect the enzyme activity of SOD1.

[0078] in conclusion Through the series of experiments described above, the K10 and K123 lactylation modification sites of SOD1 protein were successfully identified, confirming that these two sites are highly conserved in humans, rats, and mice. By constructing and functionally validating K10R and K123R delactylated mutants, it was clarified that SOD1-K123 lactylation modification can inhibit SOD1 enzyme activity, reduce the total antioxidant capacity of nucleus pulposus cells, promote superoxide anion accumulation, and thus exacerbate oxidative stress damage in nucleus pulposus cells, participating in the pathological process of IVDD. The experimental procedures of this invention are clear and highly reproducible, and the results directly verify the core conclusions of this invention, providing a reliable experimental basis for the subsequent development of diagnostic and therapeutic targets for IVDD.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The application of reagents that promote the expression of SOD1 protein mutants in the preparation of IVDD drugs for the prevention or treatment of discogenic low back pain and intervertebral disc degeneration, characterized in that, The amino acid sequence of the SOD1 protein mutant is shown in SEQ ID NO.2; The reagent is a recombinant expression plasmid, which is obtained by the following method: Based on the known sequence of the SOD1 gene, specific primers were designed, and the full-length SOD1 gene was amplified from cDNA in normal nucleus pulposus tissue by PCR. Using site-directed mutagenesis, lysine was mutated to arginine to construct the SOD1 delactylated mutant K123R at the K123 site. The mutant was cloned into a eukaryotic expression vector to construct a recombinant expression plasmid.

2. An IVDD drug for the prevention or treatment of discogenic low back pain and intervertebral disc degeneration, characterized in that, The invention contains a reagent that promotes the expression of a mutant SOD1 protein, the amino acid sequence of which is shown in SEQ ID NO.2; The reagent is a recombinant expression plasmid, which is obtained by the following method: Based on the known sequence of the SOD1 gene, specific primers were designed, and the full-length SOD1 gene was amplified from cDNA in normal nucleus pulposus tissue by PCR. Using site-directed mutagenesis, lysine was mutated to arginine to construct the SOD1 delactylated mutant K123R at the K123 site. The mutant was cloned into a eukaryotic expression vector to construct a recombinant expression plasmid.

Images