SgRNA combination and application thereof in preparation of prnp gene edited sheep

By designing sgRNA combinations PRNP-sgRNA1 and PRNP-sgRNA9, the PRNP gene in sheep was efficiently knocked out, solving the problem of the difficulty in accurately editing the PRNP gene in large animals. This resulted in the creation of a new sheep breed resistant to brucellosis, improving breeding efficiency and disease resistance.

CN121628909BActive Publication Date: 2026-07-14INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-02-05
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve precise bis-allelic knockout of PRNP genes in large animals, making it difficult to prevent and control prion diseases such as mad cow disease and scrapie in sheep. Furthermore, traditional breeding methods are inefficient and it is difficult to quickly obtain new resistant varieties.

Method used

We designed and used sgRNA combinations PRNP-sgRNA1 (CCACATAGGCAGTTGGATCC) and PRNP-sgRNA9 (CTGGCGGAGGATGGAACACT), combined with gene editing tools, to efficiently knock out the PRNP gene in sheep, creating PRNP gene-edited sheep and improving their resistance to Brucella.

Benefits of technology

The efficient and precise knockout of the PRNP gene was achieved, resulting in sheep with significant resistance to brucellosis. The PBMC cells achieved a 100% clearance rate of Brucella, providing efficient new breed materials for animal breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628909B_ABST
    Figure CN121628909B_ABST
Patent Text Reader

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a sgRNA combination and application thereof in preparation of PRNP gene edited sheep. The sgRNA combination comprises: PRNP-sgRNA1: CCACATAGGCAGTTGGATCC; and PRNP-sgRNA9: CTGGCGGAGGATGGAACACT. The application comprises: introducing the sgRNA combination and a gene editor into embryonic fibroblasts of sheep to obtain gene edited positive cells; using the gene edited positive cells as a nuclear donor to perform somatic cell nuclear transfer to obtain a reconstructed embryo; and transplanting the reconstructed embryo into a recipient ewe. The present application screens a group of sgRNA combinations which can efficiently and accurately knockout the PRNP gene of sheep, and the sgRNA combinations can be used for preparing an animal variety (2h brucella clearance rate of PBMC cells reaches 100%) against brucellosis, and have important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to an sgRNA combination and its application in the preparation of PRNP gene-edited sheep. Background Technology

[0002] Conventional breeding is time-consuming, labor-intensive, and inefficient, and is limited by the availability of breeding stock, making it difficult to achieve rapid breakthroughs in new varieties. Important economic traits in livestock and poultry are typically controlled by complex polygenic structures, and many mutation sites associated with these traits exhibit linkage. Large-fragment gene integration technology can precisely replace genes of any mutation type, facilitating the restoration or enhancement of target gene function at the translational level. This necessitates the development of modern bio-breeding technologies towards precision, efficiency, and large-fragment or multi-gene integration. Compared to traditional ZFN and TALEN technologies, gene editing technologies represented by CRISPR / Cas are more efficient and have a simpler construction process. For each target site, only appropriate sgRNAs need to be constructed for targeted editing; through the combined use of multiple sgRNAs, precise large-fragment editing can be achieved, suitable for targeted and precise modification of key target genes, thereby creating new animal germplasm with the target traits.

[0003] Prion diseases, also known as transmissible spongiform encephalopathy (TSE), are a group of fatal degenerative diseases of the central nervous system. The main characteristics of these diseases are neuronal death, vacuolation of the brain, and accompanying astrocyte proliferation, leading to motor impairment, dementia, and ultimately death in affected animals. Common prion diseases include bovine spongiform encephalopathy (BSE), scrapie in sheep and goats; in humans, it mainly manifests as Creutzfeldt-Jakob disease (CJD), with a variant directly related to BSE called vCJD.

[0004] The core mechanism of this type of disease is a conformational change in the normal prion protein (PrPC), which transforms into the pathogenic isoform prion protein (PrP). Sc PrP Sc Like a "seed," it can induce surrounding normal PrPC to misfold and aggregate, a chain reaction that ultimately leads to the death of brain nerve cells, the formation of sponge-like vacuoles in tissues, and loss of function. Extensive evidence suggests that prion diseases are caused solely by PrPC. ScThe composition of this isoform is rich in β-sheets and resistant to protease digestion, while the normal prion protein PrPC is rich in α-helices. PrPC is a glycoprotein whose exact function is not fully understood, and it is anchored to the cell membrane via GPI. Based on the researchers' proposed theory that TSE pathogens are "protein-only," PrPC, as a pathogen... Sc Once inside the body, it induces PrPC to transform into PrP. Sc This allows for proliferation; the theory also predicts that if PrPC is not expressed in the animal, PrP... Sc The prion gene will be unable to replicate in the body, thus equipping the animal with resistance to TSE pathogen infection. This hypothesis has been validated by two independent prion gene knockouts (Prnp...). - / - The mouse strains fully confirmed that both strains of mice are not only resistant to TSE pathogen infection, but also can develop and reproduce normally.

[0005] However, due to the limitations of current technology, it is difficult to precisely knock out a biallelic gene in large animals, and there are currently no PRNP gene-edited sheep with excellent correlation traits. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides an sgRNA combination and its application in the preparation of PRNP gene-edited sheep.

[0007] In a first aspect, the present invention provides an sgRNA combination comprising:

[0008] PRNP-sgRNA1 (SEQ ID NO.1):CCACATAGGCAGTTGGATCC;

[0009] PRNP-sgRNA9 (SEQ ID NO. 9): CTGGCGGAGGATGGAACACT.

[0010] In a second aspect, the present invention provides an expression cassette or vector comprising the aforementioned sgRNA combination.

[0011] Thirdly, the present invention provides a cell comprising the aforementioned sgRNA combination, or the aforementioned expression cassette or vector.

[0012] Fourthly, the present invention provides a kit comprising the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cells.

[0013] Fifthly, the present invention provides the application of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cell, or the aforementioned kit in reducing the expression level of the PRNP gene in animals.

[0014] In a sixth aspect, the present invention provides the application of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cell, or the aforementioned kit in animal breeding, or in the preparation of PRNP gene-edited animals.

[0015] In a seventh aspect, the present invention provides the use of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cells in improving animal resistance to Brucella, or in the preparation of drugs or kits for improving animal resistance to Brucella.

[0016] Furthermore, the animal in question is a mammal;

[0017] Preferably, the animal includes one or more of sheep, goats, pigs, cattle, or horses;

[0018] More preferably, the animal is a sheep.

[0019] Eighthly, the present invention provides a method for preparing PRNP gene-edited sheep, comprising: knocking out the PRNP gene in sheep using the aforementioned sgRNA combination.

[0020] The knockout method described in this invention protects all prior art knockout methods, such as pronuclear injection or somatic cell nuclear transfer. Those skilled in the art know how to use these knockout methods to knock out the PRNP gene in sheep based on the above sgRNA combination.

[0021] Furthermore, the knockout includes: introducing the sgRNA combination and gene editor into sheep embryonic fibroblasts to obtain gene-edited positive cells;

[0022] Reconstructed embryos were obtained by somatic cell nuclear transfer using the gene-edited positive cells as nuclear donors;

[0023] The reconstructed embryo was transplanted into the recipient ewe.

[0024] The present invention has the following beneficial effects:

[0025] This invention yielded a set of sgRNAs. Gene editing tools constructed based on these sgRNAs can efficiently and accurately edit the PRNP gene in animals, inhibiting its function. Sheep with PRNP gene-edited sgRNAs prepared according to this invention exhibit significantly high resistance to brucellosis; isolated PBMC cells showed a 100% clearance rate of Brucella bacteria 2 hours after challenge, demonstrating significant application value in animal breeding. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0027] Figure 1 This is the PRNP gene sequence provided in Example 1 of the present invention and the location map of the specific target designed in the present invention.

[0028] Figure 2 This is a graph showing the experimental results of the target sgRNA efficiency screening-T7E1 provided in Example 1 of this invention.

[0029] Figure 3 This is a comparison diagram of the high-efficiency sgRNA sequencing results provided in Example 1 of the present invention; wherein, A: representative mutant of PRNP-sgRNA1, B: representative mutant of PRNP-sgRNA2, C: representative mutant of PRNP-sgRNA5, D: representative mutant of PRNP-sgRNA9, and E: representative mutant of PRNP-sgRNA9.

[0030] Figure 4 The Suffolk sheep is a PRNP gene knockout positive clone provided in Example 3 of this invention.

[0031] Figure 5 This is a sequencing comparison diagram of the large fragment knockout of the PRNP gene in the cloned Suffolk sheep provided in Example 3 of the present invention.

[0032] Figure 6 This is the cell growth status after Brucella challenge provided in Example 4 of the present invention, PRNP. - / - Experimental group: PRNP gene knockout cloned sheep PBMC cell challenge group; Control group: negative sheep PBMC cell challenge group.

[0033] Figure 7 This is a diagram showing the results of Brucella plate culture in cells after Brucella challenge, as provided in Example 4 of this invention. (PRNP) - / - Experimental group: PRNP gene knockout cloned sheep PBMC cell challenge group; Control group: negative sheep PBMC cell challenge group.

[0034] Figure 8 This is a graph showing the statistical results of Brucella bacterial load after challenge provided in Example 4 of the present invention, PRNP. - / - Experimental group: PRNP gene knockout cloned sheep PBMC cell challenge group; Control group: negative sheep PBMC cell challenge group; among which, This means p < 0.05. This means p < 0.01. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0036] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0037] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. DMEM culture medium, trypsin, PBS buffer, and FBS are all commercially available, for example, from Gibco or Life Technologies. Electrolysis buffer and electrolysis cuvettes are also commercially available, for example, from LONZA. Gene editors are commercially available, for example, from Nanjing GenScript Biotech Co., Ltd.

[0038] Example 1

[0039] 1. Based on the sheep genome sequence in NCBI, the third exon of the PRNP gene in the sheep genome was selected as the target site for sgRNA design. The target site sequence is as follows: Figure 1 As shown in Table 1, a total of 24 sgRNAs were designed, of which 14 were located near the ATG start coding sequence and 10 were located near the TGA stop coding sequence.

[0040] Table 1. Sequences and target sites of sgRNAs (SEQ ID NO.1-24)

[0041]

[0042] 2. Amplification primers were designed for the target sites. The primer sequences are shown in Table 2. S-PRN-F1 / R1 is the identification primer for PRNP-sgRNA1-12 / 22 / 23 / 24, with a Tm value of 52 degrees, amplifying the target fragment length of 711 bp; S-PRN-F2 / R2 is the identification primer for PRNP-sgRNA13-21, with a Tm value of 58 degrees, amplifying the target fragment length of 679 bp. After PCR amplification, a T7E1 restriction enzyme digestion experiment was performed (results are shown in Table 2). Figure 2 ) and high-throughput sequencing efficiency statistical screening efficiency of sgRNA.

[0043] Table 2 Primer sequences (SEQ ID NO.25-28)

[0044]

[0045] T7E1 restriction enzyme digestion and sequencing results showed that the 11 sgRNAs (PRNP-sgRNA1-11) near the ATG region all had high cleavage efficiency, while the sgRNAs near the TGA region showed no significant cleavage activity. The gene editing efficiency verified by sequencing is shown in Table 3.

[0046] Table 3. Statistics on gene editing efficiency of candidate sgRNAs through high-throughput sequencing

[0047]

[0048] As shown in Table 3, among the 11 sgRNAs, the gene editing efficiency of 6 sgRNAs—PRNP-sgRNA1, PRNP-sgRNA2, PRNP-sgRNA5, PRNP-sgRNA9, PRNP-sgRNA10, and PRNP-sgRNA11—all exceeded 50%. Sequencing analysis and comparison of the amplified products were performed, and their mutant types were analyzed in detail. Figure 3 In this embodiment, the optimal combination of sgRNA1 and sgRNA9 was used for subsequent experiments, and S-PRN-F1R1 was confirmed as the optimal combination of PCR primers.

[0049] Example 2: Obtaining gene-edited positive cell clones

[0050] In this embodiment, the method for preparing gene-positive cell clones includes:

[0051] 1. Establishment of sheep fetal fibroblasts

[0052] Fetuses of pregnant blackhead Suffolk sheep at 45 days of age were collected, and fetal fibroblasts were established using standard methods. Once the cells reached 80% confluence, they were passaged or cryopreserved.

[0053] 2. Electroporation of sheep fetal fibroblasts and screening of cell clone sites

[0054] (1) Two days before electroporation, 2×10 5 The sheep fibroblast cell line obtained in step 1 above was revived in a 6-well plate and 4 mL of DMEM medium containing 10% (v / v) fetal bovine serum (FBS) was added. The plates were then incubated at 37°C in a 5% CO2 incubator.

[0055] (2) After the cells in the 6-well plate have grown to a confluence, approximately 1×10 6Digest cells with 1 mL of 0.25% trypsin solution. Centrifuge at 1000g for 5 min to pellet the cells. Wash the cell pellet once with PBS buffer. Resuspend the cells in 100 μL of electroporation buffer to obtain a cell suspension.

[0056] (3) Add the gene editor and 15 μg of PRNP-sgRNA1 and sgRNA9 selected in Example 1 to 100 μL of the cell suspension obtained in (2) above, mix and transfer to an electroporation cup.

[0057] (4) Electrolyze the cells with an electric field strength of 1.2KV / cm and a pulse time of 1ms.

[0058] (5) Transfer the electrolyzed cells into a 60 mm cell culture dish; add 4 mL of DMEM culture medium containing 10% (volume percentage) fetal bovine serum, and culture in a CO2 incubator until the cells recover their growth status and are screened.

[0059] (6) When the cell clones in the culture dish grow to a diameter of more than 2 mm, remove the culture medium, rinse with DPBS, cover the clone cluster with a cloning loop, add about 100 μL of 0.1% trypsin at 37°C, digest for about 3 min, add DMEM medium containing 20% ​​(v / v) FBS to stop digestion, gently pipette and transfer to a 48-well plate for expansion culture.

[0060] (7) When the cell fusion rate in the 48-well plate reaches 90%, half of the cells are digested and used for cell clone genotype identification, while the remaining half are cultured in the well plate.

[0061] (8) After centrifuging the cells used for genotyping at 1000g for 5min, discard the supernatant and add 10-20μL of cell lysis buffer (50mm KCl, 2.5mm MgCl2, 10mm Tris-HCl, 0.45% NP40, 0.45% Tween 20 and 0.2mg / mL proteinase K) according to the amount of cell precipitate.

[0062] 3. Identification of positive cell clonal sites

[0063] (1) Take 3 μL of cell lysate as a template for PCR identification and use primer pair S-PRN-F1 / R1 for PCR amplification.

[0064] S-PRN-F1: 5'-GCTGGCATTCTGTATTTATC-3';

[0065] S-PRN-R1: 5'-CATAGTCATTGCCAAAATGT-3'.

[0066] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0067] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0068] After purifying and sequencing the amplification products obtained from the above PCR amplification, cloned sheep were prepared.

[0069] Example 3: Preparation and Identification of Nuclear Transfer Embryos and Cloned Sheep

[0070] 1. In vitro maturation of sheep oocytes.

[0071] Ovaries were retrieved from the slaughterhouse and transported back to the laboratory. Follicles measuring 3-6 mm on the surface of the ovary were aspirated using a 20 mL syringe equipped with an 18-gauge needle. Under a stereomicroscope, cumulus-oocyte complexes (COCs) with ≥2 layers of cumulus cells, dense structure, and homogeneous cytoplasm were selected and cultured in an in vitro maturation medium for 22 hours.

[0072] 2. Somatic cell preparation.

[0073] Using the serum starvation method, when the cells (the gene-edited positive cell clones constructed in Example 2) grew to 80% confluence, they were subjected to serum starvation treatment, that is, the FBS concentration in the culture medium was reduced from 20% to 0.5% and cultured for 2-5 days. The cells were digested, centrifuged and washed, and finally the cell pellet was resuspended in 1 mL of micromanipulation solution for use as donor cells.

[0074] 3. Enucleation of recipient oocytes and nuclear transfer of donor cells.

[0075] Enucleation of mature oocytes was performed using a blind aspiration method. After cumulus exfoliation of mature oocytes (22 h old), oocytes with homogeneous cytoplasm, a clear perivitelline space, and intact cell membranes were selected and placed in a micromanipulation droplet. Under micromanipulation, the first polar body and a small amount of cytoplasm near it were aspirated. A single, round, smooth somatic cell (15-20 μM in diameter) with strong refractive properties was selected and injected subzonal pellucida of the enucleated oocyte through the enucleation needle insertion point, ensuring close contact between the donor cell and the oocyte membrane. 25-30 oocytes were processed per batch. After all procedures were completed, the donor cell-oocyte cytoplasm pair was transferred to culture medium and incubated for 1-2 hours in a 5% CO2, 100% humidity incubator.

[0076] 4. Integration and activation.

[0077] The reconstructed oocytes were transferred in batches to the fusion medium and equilibrated for 3 minutes. After washing three times with the fusion / activation solution, five oocytes per batch were placed in a fusion tank filled with fusion medium. The reconstructed oocytes were moved with a drawn, fine-tipped solid glass needle to make the donor cell-recipient oocyte membrane contact surface parallel to the electrode. A 30 μs, 2.0 kV / cm DC pulse was applied using an ECM2001 fusion instrument to induce fusion and activate the cells. The cells were washed five times with culture medium and immediately transferred to a mineral oil-covered embryo culture medium. After incubation at 5% CO2 and 100% humidity for 0.5 to 1 hour, the cells were removed and the fusion was assessed under a stereomicroscope.

[0078] 5. Embryo culture.

[0079] The successfully fused reconstructed embryos were washed five times with embryo culture medium and then transferred to embryo culture medium. Eight to ten reconstructed embryos were cultured in 30 μL droplets each, and the cleavage rate was recorded after 48 h of culture.

[0080] 6. Embryo transfer.

[0081] Select recipient ewes in estrus at the same time. Anesthetize them with nifedipine acetaminophen (N2). After disinfecting the abdomen, make an 8-10cm incision along the midline of the abdomen, and pull out the ovary and fimbriae of the oviduct. Insert a transfer tube containing selected embryos at least 5cm into the oviduct (to the ampulla-isthmus junction) through the fimbriae, and inject the qualified embryos. The transferred embryos include two types: one is embryos developed to the 2 / 4 / 8 cell stage, with equal division of blastomeres and no cytoplasmic debris; the other is embryos at the 1 / 2 cell stage, where 2-cell embryos divide equally and single-cell embryos are compact. The suture is closed post-operatively. After embryo transfer, administer the nifedipine hydrochloride (0.15mL) intramuscularly to the lateral hind leg of each ewe to relieve the anesthesia. Then, administer oxytetracycline (5mL) intramuscularly to each ewe to prevent subsequent inflammation and infection.

[0082] 7. Identification of F0 generation positive gene-edited cloned sheep.

[0083] After five months of gestation, gene-edited cloned lambs are born (e.g. Figure 4 ).

[0084] Take cloned sheep ear tissue or blood samples, add DNA extraction buffer and proteinase K to the samples, digest completely in a 56℃ water bath, then extract sequentially with Tris-saturated phenol (twice), phenolform (1:1), and chloroform, centrifuge and collect the supernatant, add anhydrous ethanol to precipitate DNA, wash with 70% ethanol and air dry, then dissolve in TE buffer, detect the concentration and purity of genomic DNA, store at -20℃, and then perform PCR amplification and sequencing.

[0085] The PCR primer sequences are:

[0086] S-PRN-F1: 5'-GCTGGCATTCTGTATTTATC-3';

[0087] S-PRN-R1: 5'-CATAGTCATTGCCAAAATGT-3'.

[0088] The reaction mixture consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTPs, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O. The reaction program was: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min, then stored at 4℃.

[0089] Positive identification sequencing of newborn lambs confirmed that the target region of the third exon of the PRNP gene in lambs was precisely knocked out by 77 bp, with no non-specific mutations. Figure 5 They successfully obtained a PRNP gene-knockout cloned sheep.

[0090] Example 4: Isolation and Anti-brucellosis Validation of PRNP Gene-Edited Sheep PBMCs Provided by the Present Invention

[0091] 1. Isolation and culture of sheep PBMCs

[0092] (1) Centrifuge the sheep blood sample at 3000 rpm for 5 min at room temperature to remove the supernatant serum;

[0093] (2) Dilute the remaining blood sample with an equal volume of tissue diluent;

[0094] (3) Add an appropriate amount of separation solution to the centrifuge tube. Spread the diluted blood evenly on the surface of the separation solution, making sure to keep the interface between the two liquid surfaces clear.

[0095] (4) Centrifuge horizontally at 2200 rpm for 20-30 min at room temperature.

[0096] (5) After centrifugation, obvious stratification will appear (keep it still): the top layer is the diluted plasma layer, the middle layer is the transparent separation liquid layer, the white membrane layer between the plasma and the separation liquid is the mononuclear cell layer, and the bottom of the centrifuge tube contains red blood cells and granulocytes.

[0097] (6) Carefully aspirate the white membrane cells into a 15mL sterile centrifuge tube, then add 8mL of red blood cell lysis buffer to resuspend them, let stand at room temperature for 10min, and then centrifuge at 1100rpm for 10min.

[0098] (7) Discard the supernatant, add 5 mL of PBS or cell washing solution to resuspend the cells, centrifuge at 250 g for 10 min;

[0099] (8) Resuspend the cells in medium containing 10% FBS, count the cells using a cell counting chamber, and calculate the survival rate. Both the experimental and control groups of sheep PBMCs showed round, suspended growth after isolation, and a trypan blue staining survival rate of ≥90%. This indicates successful cell isolation and culture with no significant differences between groups, making them suitable for subsequent challenge experiments.

[0100] (9) Adjust the PBMC concentration of sheep in the gene-editing experimental group and the control group to 3×10⁻⁶ cells respectively. 5 Cells were inoculated at a density of 1 / mL into 24-well culture plates and pre-cultured at 37°C in a 5% CO2 incubator for 2 hours. After the cells adhered and stabilized, they were then infected.

[0101] 2. Brucella infection treatment

[0102] Add the appropriate volume of Brucella bacterial suspension to the PBMC wells to achieve a multiplicity of infection (MO1) of 100. Gently shake the cell plate to ensure even contact of Brucella with the cells. Centrifuge at 400g for 10 min at room temperature, then incubate for 1 h in a constant temperature incubator. Subsequently, add gentamicin to achieve an antibiotic concentration of 50 mg / mL in the wells, followed by maintenance medium, and incubate in a constant temperature incubator.

[0103] 3. Collect cells for colony culture.

[0104] Cell samples were collected into 1.5 mL centrifuge tubes at 2 h and 48 h after challenge, centrifuged at 3000 rpm for 5 min at room temperature, discarded, and 500 μL of 0.1% Triton X-100 was added. The mixture was incubated at 37 °C for 10 min, and the samples were collected afterward. The samples at each time point were then rinsed with sterile PBS according to a 1:1 ratio. -1 10 -2 10 -3 10 -4Serial dilutions were performed, and 100 μL of the diluted sample was spotted onto TSA solid medium. After 3 days, the colony count was observed and calculated.

[0105] 4. Observation of cell morphology after virus challenge

[0106] Cell morphology was observed using an inverted microscope, and the presence of cell floating, rupture, or other damage was recorded. Results showed that both groups of cells had normal morphology at the initial stage of infection, but some cells began to suspend and die at 24 hours, and the cell count in both groups decreased. At 48 hours, PRNP... - / - The experimental group showed an increase in cell number while maintaining good morphology, while the control group showed no significant increase in cell number. Figure 6 This indicates that the gene-edited PBMCs are more resistant to Brucella infection.

[0107] 5. Intracellular bacterial load count after challenge

[0108] (1) Take out the cell suspension from the culture well, centrifuge at 1000 rpm for 5 min, discard the supernatant, and wash twice with PBS (to remove extracellular bacteria).

[0109] (2) Add 500 μL of cell lysis buffer and incubate at room temperature for 10 min to fully lyse the cells and release intracellular bacteria.

[0110] (3) Gradually dilute the lysis buffer (10) -1 ~10 -4 Incubate at 37°C for 3 days, count the number of colonies (CFU), and calculate the total number of intracellular bacteria per well.

[0111] The results of the bacterial culture plate showed that PRNP 2 hours after challenge. - / - The experimental group had zero colony counts, while the control group showed a large number of Brucella bacteria. Figure 7 After colony counting, CFU calculation, and significance difference analysis, the results showed that the bacterial load in the experimental groups differed significantly at 2 hours. Figure 8 The PRNP knockout showed a 100% clearance rate of Brucella, indicating that it could resist Brucella invasion for 2 hours after challenge. This also shows that PRNP knockout can significantly inhibit the early colonization or survival of Brucella in PBMC monocytes and enhance early anti-infection ability.

[0112] 48 hours after the challenge, at PRNP - / - The experimental group showed a restorative increase in cell number (indicating that the cells in the experimental group were less infected, their viability was restored, and cell proliferation occurred). Figure 6 The bacterial load still showed significant differences, PRNP - / - The bacterial colony count in the experimental group was significantly lower than that in the control group. Figure 8 ), and compared to the control group, PRNP - / -The clearance rate of Brucella in the experimental group was 54%, indicating that PRNP knockout may confer host resistance to Brucella infection by affecting bacterial invasion or phagocytosis-related pathways, especially showing excellent performance in blocking Brucella invasion in the early stage.

[0113] In summary, the PRNP gene knockout cloned sheep provided by this invention exhibited excellent resistance to Brucella infection in in vitro experiments, demonstrating enhanced disease resistance. This study provides a very good foundation and new breeding material for the subsequent breeding of new brucellosis-resistant sheep breeds.

[0114] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of sgRNA conjugates, expression cassettes, vectors, or cells in the preparation of drugs or kits for enhancing Brucella resistance in animals; wherein the animal is a sheep; The sgRNA combination includes: PRNP-sgRNA1:CCACATAGGCAGTTGGATCC; PRNP-sgRNA9:CTGGCGGAGGATGGAACACT; The expression cassette or vector includes the sgRNA combination; The cells comprise the sgRNA combination, or the expression cassette or vector.

2. A method for breeding sheep resistant to brucellosis, characterized in that, include: The PRNP gene in sheep was knocked out using a combination of sgRNAs. The sgRNA combination includes: PRNP-sgRNA1:CCACATAGGCAGTTGGATCC; PRNP-sgRNA9:CTGGCGGAGGATGGAACACT.