An acute high altitude disease genetic risk site detection reagent and a detection reagent kit, a microfluidic chip and an application thereof

Abstract

The application provides a genetic risk site detection reagent for acute high altitude disease and a detection kit, a micro-fluidic chip and an application thereof, and belongs to the technical field of gene detection. In the research of the genetic risk site of acute high altitude disease, 15 genetic risk sites are screened out, and RAA amplification primers, nucleic acid probes and reporter probes are designed. The application realizes the genotype judgment of the risk site by combining the detection reagent with the three-dimensional micro-fluidic chip, so as to realize the prediction of acute high altitude disease. The application provides a micro-fluidic chip and a reagent with high integration, good universality, excellent performance and simple operation, and has high technical feasibility and practicability.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a reagent for detecting genetic risk sites of acute mountain sickness, its detection kit, microfluidic chip, and its application. Background Technology

[0002] Acute altitude sickness (AAS) is a series of pathological reactions caused by the hypoxic environment when the human body rapidly ascends to an altitude of 3,000 meters or higher. It is divided into acute mountain sickness, high-altitude pulmonary edema, and high-altitude cerebral edema. Numerous studies have shown that there are differences in genetic susceptibility to AAS. Currently, multiple genes have been reported to be associated with AAS, and some reports also indicate that SNP molecular markers in certain susceptibility genes are associated with susceptibility to AAS.

[0003] Single nucleotide polymorphisms (SNPs), as third-generation genetic markers, have undergone a paradigm shift in detection technology, evolving from traditional PCR amplification to CRISPR-enabled systems. Traditional detection procedures follow a standard "amplification-genotyping" pathway: first, the target region is exponentially enriched using PCR or isothermal amplification techniques (such as RPA and LAMP), typically requiring 5-50 ng of genomic DNA template. Real-time monitoring with SYBR Green I is used to ensure amplification efficiency (Ct value versus template amount R). 2 ≥0.99); subsequently, SNP genotyping was achieved using techniques such as mass spectrometry (MALDI-TOF MS detection limit 5 amol / μL), fluorescent probes (TaqMan probe resolution 0.5℃), or chemiluminescence (luminol system signal-to-noise ratio 105:1). Although the accuracy of traditional methods under laboratory conditions is >99.5%, in field pathogen detection, rapid screening of drug-sensitive SNPs, and other point-of-care testing (POCT) scenarios, equipment dependence (qPCR instrument cost >500,000 RMB), operational complexity (requiring professional technicians), and time cost (4-6 hours) have become the main bottlenecks. To address these limitations, nucleic acid detection technology based on the CRISPR-Cas system has achieved a revolutionary breakthrough in detection paradigms through three major advantages: targeted specificity (crRNA / tracrRNA complex KD≈10-12 M), signal amplification (Cas protein paracleavage activity), and isothermal reaction (37-42℃). However, there is currently no universal detection reagent for genetic risk loci of acute mountain sickness. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a reagent for detecting genetic risk loci of acute mountain sickness (APS). The reagent achieves RAA amplification by using primers for genotyping detection of 15 APS genetic risk loci, and then activates the Cas12a trans-cleavage activity by utilizing the targeting effect of the probe. Combined with a fluorescence resonance energy transfer (FRET) probe, the genotype of APS genetic risk loci can be detected.

[0005] This invention provides a genetic risk locus detection reagent for acute mountain sickness, comprising a reporter probe, genotyping primers amplifying the following loci, and wild-type and mutant probes targeting the following loci: CHR5POS126959267, CHR6POS164080350, CHR9POS10271582, CHR9POS111496696, CHR11POS19722834, CHR11POS75257678, CHR12POS97137423, CHR13POS50592459, CHR16POS81648399, CHR18POS36828913, CHR18POS65311119, CHR19POS16411002, CHRXPOS32026957, CHRXPOS57492873, and CHRX POS92674859; The primers for genotyping detection of CHR5 POS126959267 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:2; the nucleoside sequence of the wild-type probe targeting CHR5 POS126959267 is shown in SEQ ID NO:3; and the nucleoside sequence of the mutant probe targeting CHR5 POS126959267 is shown in SEQ ID NO:4. Primers for genotyping detection of CHR6 POS164080350 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:5 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:6; the nucleoside sequence of the wild-type probe targeting CHR6 POS164080350 is shown in SEQ ID NO:7; and the nucleoside sequence of the mutant probe targeting CHR6 POS164080350 is shown in SEQ ID NO:8. Primers for genotyping detection of CHR9 POS10271582 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:9 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:10; the nucleoside sequence of the wild-type probe targeting CHR9 POS10271582 is shown in SEQ ID NO:11; the nucleoside sequence of the mutant probe targeting CHR9 POS10271582 is shown in SEQ ID NO:12. The primers for genotyping detection of CHR9 POS111496696 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:13 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:14; the nucleoside sequence of the wild-type probe targeting CHR9 POS111496696 is shown in SEQ ID NO:15; and the nucleoside sequence of the mutant probe targeting CHR9 POS111496696 is shown in SEQ ID NO:16. The primers for genotyping detection of CHR11 POS19722834 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:17 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:18; the nucleoside sequence of the wild-type probe targeting CHR11 POS19722834 is shown in SEQ ID NO:19; and the nucleoside sequence of the mutant probe targeting CHR11 POS19722834 is shown in SEQ ID NO:20. The primers for genotyping detection of CHR11 POS75257678 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:21 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:22; the nucleoside sequence of the wild-type probe targeting CHR11 POS75257678 is shown in SEQ ID NO:23; and the nucleoside sequence of the mutant probe targeting CHR11 POS75257678 is shown in SEQ ID NO:24. The primers for genotyping detection of CHR12 POS97137423 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:25 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:26; the nucleoside sequence of the wild-type probe targeting CHR12 POS97137423 is shown in SEQ ID NO:27; and the nucleoside sequence of the mutant probe targeting CHR12 POS97137423 is shown in SEQ ID NO:28. Primers for genotyping detection of CHR13 POS50592459 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:29 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:30; the nucleoside sequence of the wild-type probe targeting CHR13 POS50592459 is shown in SEQ ID NO:31; and the nucleoside sequence of the mutant probe targeting CHR13 POS50592459 is shown in SEQ ID NO:32. The primers for genotyping detection of CHR16 POS81648399 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:33 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:34; the nucleoside sequence of the wild-type probe targeting CHR16 POS81648399 is shown in SEQ ID NO:35; and the nucleoside sequence of the mutant probe targeting CHR16 POS81648399 is shown in SEQ ID NO:36. The primers for genotyping detection of CHR18 POS36828913 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:37 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:38; the nucleoside sequence of the wild-type probe targeting CHR18 POS36828913 is shown in SEQ ID NO:39; and the nucleoside sequence of the mutant probe targeting CHR18 POS36828913 is shown in SEQ ID NO:40. The primers for genotyping detection of CHR18 POS65311119 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:41 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:42; the nucleoside sequence of the wild-type probe targeting CHR18 POS65311119 is shown in SEQ ID NO:43; and the nucleoside sequence of the mutant probe targeting CHR18 POS65311119 is shown in SEQ ID NO:44. The primers for genotyping detection of CHR19 POS16411002 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:45 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:46; the nucleoside sequence of the wild-type probe targeting CHR19 POS16411002 is shown in SEQ ID NO:47; and the nucleoside sequence of the mutant probe targeting CHR19 POS16411002 is shown in SEQ ID NO:48. The primers for genotyping detection of CHRX POS32026957 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:49 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:50; the nucleoside sequence of the wild-type probe targeting CHRX POS32026957 is shown in SEQ ID NO:51; and the nucleoside sequence of the mutant probe targeting CHRX POS32026957 is shown in SEQ ID NO:52. The primers for genotyping detection of CHRX POS57492873 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:53 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:54; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:55; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:56. The primers for genotyping detection of CHRX POS92674859 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:57 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:58; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:59; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:60. The reporter probe is a TTATT sequence with a fluorescent group modified at one end and a quencher group modified at the other end.

[0006] Preferably, the fluorescent group includes FAM; the quenching group includes BHQ1.

[0007] This invention provides a kit for detecting genetic risk loci of acute mountain sickness, comprising the detection reagent, RAA reaction lyophilized powder, and CRISPR Cas12a enzyme digestion reaction lyophilized powder.

[0008] Preferably, the plasmids also include wild-type recombinant plasmids and mutant recombinant plasmids containing the following sites: CHR5POS126959267, CHR6 POS164080350, CHR9 POS10271582, CHR9 POS111496696, CHR11POS19722834, CHR11 POS75257678, CHR12 POS97137423, CHR13 POS50592459, CHR16POS81648399, CHR18 POS36828913, CHR18 POS65311119, CHR19 POS16411002, CHRXPOS32026957, CHRX POS57492873, and CHRX POS92674859; The exogenous gene fragments in the wild-type recombinant plasmid and the mutant recombinant plasmid are shown in SEQ ID NO:61~SEQ ID NO:90, respectively.

[0009] This invention provides a microfluidic chip for detecting genetic risk loci of acute mountain sickness. The microfluidic chip has several functional chambers arranged in an orderly manner along the centrifugation direction, and adjacent functional chambers are connected by a gas barrier valve. Each functional chamber includes a lysis region, a multiplex amplification region, a mixing region, a distribution region, and a detection region connected in sequence. The lysis region has a sample loading port for adding samples to the chip. The multiplex amplification region is pre-loaded with lyophilized RAA reaction lyophilized powder and primers. The detection area is provided with a number of reaction holes arranged circumferentially with openings facing the center of rotation along the centrifugal direction. The detection zone is pre-loaded with CRISPR Cas12a enzyme digestion reaction lyophilization reagent and probe; an exhaust port is provided at a location extending from the lysis zone close to the rotation center.

[0010] Preferably, the diameter of the microfluidic chip is 80~100mm; the thickness of the microfluidic chip is 3.0~4.0mm.

[0011] Preferably, the microfluidic chip uses microchannels to connect the various functional cavities; The equivalent diameter of the cross-section of the microchannel is 0.1~2mm.

[0012] Preferably, the microfluidic chip includes a lysis region, a multiplex amplification region, a mixing region, a distribution region, and 36 to 72 detection regions.

[0013] Preferably, the microfluidic chip is made of a transparent organic material; the primers are the detection primers in the detection reagent of claim 1; The probe is the reporter probe, wild-type probe, and mutant probe in the detection reagent of claim 1.

[0014] This invention provides the application of the detection reagent, the detection kit, or the microfluidic chip in constructing a model for predicting acute mountain sickness.

[0015] This invention provides a genetic risk locus detection reagent for acute mountain sickness, comprising a reporter probe, genotyping primers amplifying the following loci, and wild-type and mutant probes targeting the following loci: CHR5POS126959267, CHR6POS164080350, CHR9POS10271582, CHR9POS111496696, CHR11POS19722834, CHR11POS75257678, CHR12POS97137423, CHR13POS50592459, CHR16POS81648399, CHR18POS36828913, CHR18POS65311119, CHR19POS16411002, CHRXPOS32026957, CHRXPOS57492873, and CHRX POS92674859. This invention, through research on genetic risk loci for acute mountain sickness (APS), screened a group of genetic loci and designed and developed amplification primers and targeting probes with good detection effects based on these loci. The detection reagents are characterized by good versatility, excellent performance, and simple operation, and can rapidly and accurately detect the genotype of APS genetic risk loci.

[0016] The present invention also provides a microfluidic chip, wherein the chip has ordered arranged functional cavities arranged sequentially along the centrifugal direction, and adjacent functional cavities are connected by a gas-blocking valve; the gas-blocking valve is a channel connecting the upstream and downstream functional cavities, and after centrifugation is started, the liquid in the upstream functional cavity is transferred to the downstream functional cavity under the action of centrifugal force, and the gas in the downstream functional cavity moves to the upstream functional cavity in the opposite direction; the chip has a sample inlet and an exhaust outlet for adding samples to the chip; after the sample is added to the chip, the sample inlet and the exhaust outlet are sealed. The functional chamber mainly includes a lysis zone (1), a multiplex amplification zone (2), a mixing zone (3), a distribution zone (4), and a detection zone (5). The detection zone includes multiple reaction wells arranged sequentially along the centrifugation direction and circumferentially along the rotation center. The lysis zone is provided with a sample loading port for adding samples to the chip. The multiplex amplification zone is pre-loaded with a lyophilized RAA amplification system and primer combination, wherein the primer combination is the multiplex amplification primers described in claim 3 (the forward primer F1 and the reverse primer R1 for the 15 sites). The detection zone is pre-loaded with lyophilized reagents and detection probes required for the CRISPR Cas12a genotyping detection system. The chip also has a sample loading port in the lysis zone for adding samples, and an exhaust port extends from the lysis zone near the rotation center for venting gas. The chip cleverly integrates multi-step biochemical reactions onto a single reaction chip, and all biological reagents are pre-stored in the chip in a dry form. Users only need to perform one sample loading operation, and the system can automatically complete the detection according to the preset process, truly achieving seamless connection from sample input to result output. Its simple and straightforward structural design facilitates manufacturing and offers significant cost advantages. It also drastically reduces manual operations, effectively lowering the risk of cross-contamination. The chip achieves precise liquid control simply by adjusting the centrifugal speed, requiring minimal input from the prototype, which is simple in structure and inexpensive. Furthermore, it allows for simultaneous detection of multiple targets in a single experiment, offering flexibility and convenience. Simultaneously, the microfluidic chip can be injection molded in one piece, achieving low-cost manufacturing while ensuring high reliability and stability, making it more suitable for field testing. Attached Figure Description

[0017] Figure 1 To illustrate the variations associated with the severity of acute mountain sickness in a Manhattan plot; Figure 2 To confuse the prediction model with statistical results; Figure 3 The functional cavity structure of the microfluidic chip includes: 1 is the lysis region, 2 is the multiplex amplification region, 3 is the mixing region, 4 is the distribution region, 5 is the detection region, 6 is the microchannel, 7 is the sample loading port, 8 is the venting port, 9 is the quantification region, and 10 is the waste liquid chamber. Figure 4 The test result was negative. Figures 5-34The results of sensitivity tests based on detection reagents were used to identify 15 variant sites associated with acute mountain sickness; A is a plasmid solution of 1 copy / μL, B is a plasmid solution of 10 copy / μL, C is a plasmid solution of 100 copy / μL, and D is a plasmid solution of 1000 copy / μL. Figure 35 This refers to the test results for sample 1 REF type; Figure 36 The results of the heterozygous test for sample 2, C11P2834; Figure 37 The results are for the heterozygous test of sample 3, C16P8399. Detailed Implementation

[0018] This invention provides a genetic risk locus detection reagent for acute mountain sickness, comprising a reporter probe, genotyping primers amplifying the following loci, and wild-type and mutant probes targeting the following loci: CHR5POS126959267, CHR6POS164080350, CHR9POS10271582, CHR9POS111496696, CHR11POS19722834, CHR11POS75257678, CHR12POS97137423, CHR13POS50592459, CHR16POS81648399, CHR18POS36828913, CHR18POS65311119, CHR19POS16411002, CHRXPOS32026957, CHRXPOS57492873, and CHRX POS92674859; The chromosome number, location, serial number, and gene mutation site information of the site are shown in Table 1.

[0019] Table 1. Genetic risk loci for acute mountain sickness

[0020] The primers for genotyping detection of CHR5 POS126959267 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:2; the nucleoside sequence of the wild-type probe targeting CHR5 POS126959267 is shown in SEQ ID NO:3; and the nucleoside sequence of the mutant probe targeting CHR5 POS126959267 is shown in SEQ ID NO:4. Primers for genotyping detection of CHR6 POS164080350 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:5 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:6; the nucleoside sequence of the wild-type probe targeting CHR6 POS164080350 is shown in SEQ ID NO:7; and the nucleoside sequence of the mutant probe targeting CHR6 POS164080350 is shown in SEQ ID NO:8. Primers for genotyping detection of CHR9 POS10271582 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:9 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:10; the nucleoside sequence of the wild-type probe targeting CHR9 POS10271582 is shown in SEQ ID NO:11; the nucleoside sequence of the mutant probe targeting CHR9 POS10271582 is shown in SEQ ID NO:12. The primers for genotyping detection of CHR9 POS111496696 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:13 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:14; the nucleoside sequence of the wild-type probe targeting CHR9 POS111496696 is shown in SEQ ID NO:15; and the nucleoside sequence of the mutant probe targeting CHR9 POS111496696 is shown in SEQ ID NO:16. The primers for genotyping detection of CHR11 POS19722834 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:17 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:18; the nucleoside sequence of the wild-type probe targeting CHR11 POS19722834 is shown in SEQ ID NO:19; and the nucleoside sequence of the mutant probe targeting CHR11 POS19722834 is shown in SEQ ID NO:20. The primers for genotyping detection of CHR11 POS75257678 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:21 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:22; the nucleoside sequence of the wild-type probe targeting CHR11 POS75257678 is shown in SEQ ID NO:23; and the nucleoside sequence of the mutant probe targeting CHR11 POS75257678 is shown in SEQ ID NO:24. The primers for genotyping detection of CHR12 POS97137423 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:25 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:26; the nucleoside sequence of the wild-type probe targeting CHR12 POS97137423 is shown in SEQ ID NO:27; and the nucleoside sequence of the mutant probe targeting CHR12 POS97137423 is shown in SEQ ID NO:28. Primers for genotyping detection of CHR13 POS50592459 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:29 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:30; the nucleoside sequence of the wild-type probe targeting CHR13 POS50592459 is shown in SEQ ID NO:31; and the nucleoside sequence of the mutant probe targeting CHR13 POS50592459 is shown in SEQ ID NO:32. The primers for genotyping detection of CHR16 POS81648399 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:33 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:34; the nucleoside sequence of the wild-type probe targeting CHR16 POS81648399 is shown in SEQ ID NO:35; and the nucleoside sequence of the mutant probe targeting CHR16 POS81648399 is shown in SEQ ID NO:36. The primers for genotyping detection of CHR18 POS36828913 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:37 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:38; the nucleoside sequence of the wild-type probe targeting CHR18 POS36828913 is shown in SEQ ID NO:39; and the nucleoside sequence of the mutant probe targeting CHR18 POS36828913 is shown in SEQ ID NO:40. The primers for genotyping detection of CHR18 POS65311119 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:41 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:42; the nucleoside sequence of the wild-type probe targeting CHR18 POS65311119 is shown in SEQ ID NO:43; and the nucleoside sequence of the mutant probe targeting CHR18 POS65311119 is shown in SEQ ID NO:44. The primers for genotyping detection of CHR19 POS16411002 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:45 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:46; the nucleoside sequence of the wild-type probe targeting CHR19 POS16411002 is shown in SEQ ID NO:47; and the nucleoside sequence of the mutant probe targeting CHR19 POS16411002 is shown in SEQ ID NO:48. The primers for genotyping detection of CHRX POS32026957 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:49 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:50; the nucleoside sequence of the wild-type probe targeting CHRX POS32026957 is shown in SEQ ID NO:51; and the nucleoside sequence of the mutant probe targeting CHRX POS32026957 is shown in SEQ ID NO:52. The primers for genotyping detection of CHRX POS57492873 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:53 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:54; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:55; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:56. The primers for genotyping detection of CHRX POS92674859 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:57 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:58; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:59; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:60.

[0021] In this invention, the reporter probe is a TTATT sequence with a fluorescent group modified at one end and a quencher group modified at the other end. The fluorescent group preferably includes FAM; the quencher group includes BHQ1.

[0022] This invention provides a kit for detecting genetic risk loci of acute mountain sickness, comprising the detection reagent, RAA reaction lyophilized powder, and CRISPR Cas12a enzyme digestion reaction lyophilized powder.

[0023] In this invention, the RAA reaction lyophilized powder was purchased from Zhejiang Lingyu Biotechnology Co., Ltd., catalog number S001LY. The CRISPR Cas12a enzyme digestion reaction lyophilized powder was purchased from Zhejiang Lingyu Biotechnology Co., Ltd., catalog number DB008LY.

[0024] In this invention, the detection kit preferably further includes wild-type recombinant plasmids and mutant recombinant plasmids containing the following sites: CHR5 POS126959267, CHR6 POS164080350, CHR9 POS10271582, CHR9POS111496696, CHR11 POS19722834, CHR11 POS75257678, CHR12 POS97137423, CHR13 POS50592459, CHR16 POS81648399, CHR18 POS36828913, CHR18 POS65311119, CHR19 POS16411002, CHRX POS32026957, CHRX POS57492873, and CHRX POS92674859; The exogenous gene fragments in the wild-type recombinant plasmid and the mutant recombinant plasmid are shown in SEQ ID NO:61~SEQ ID NO:90 respectively.

[0025] This invention provides a microfluidic chip for detecting genetic risk sites of acute mountain sickness. The microfluidic chip has several functional chambers arranged in an orderly manner along the centrifugation direction; adjacent functional chambers are connected by air-resistance valves; an exhaust port is provided at a location extending from the lysis zone close to the center of rotation; each functional chamber includes a lysis zone, a multiplex amplification zone, a mixing zone, a dispensing zone, and a detection zone connected in sequence; the lysis zone has a sample loading port for adding samples to the chip; the multiplex amplification zone is pre-loaded with lyophilized RAA reaction lyophilized powder and primers; the detection zone has several reaction wells arranged circumferentially with openings facing the center of rotation along the centrifugation direction; the detection zone is pre-loaded with CRISPR Cas12a enzyme digestion reaction lyophilized reagent and probes.

[0026] In this invention, one end of the gas-resistance valve is connected to the distal end of the upstream functional chamber, and the other end is connected to the proximal end of the downstream functional chamber. Essentially, the gas-resistance valve is a channel connecting the upstream and downstream functional chambers. When the chip initiates centrifugal motion, the liquid in the upstream functional chamber migrates to the downstream functional chamber under the action of centrifugal force, while the gas in the downstream functional chamber flows in the opposite direction to the upstream functional chamber. During this process, the gas and liquid meet within the channel of the gas-resistance valve, forming a gas-resistance effect. In the design of the gas-resistance valve, the centrifugal radius of the inlet is smaller than that of the outlet to optimize fluid dynamics performance. The chip is provided with a sample inlet and an exhaust port for adding samples to the chip; after the sample is added to the chip, the sample inlet and exhaust port are sealed.

[0027] In this invention, the diameter of the microfluidic chip is preferably 80-100 mm; the thickness of the microfluidic chip is preferably 3.0-4.0 mm, and can be 3.5 mm. Microchannels connect the various functional cavities within the microfluidic chip; the equivalent diameter of the cross-section of the microchannel is preferably 0.1-2 mm, and can be 0.2-1 mm, or 0.5-0.8 mm. The microfluidic chip is made of transparent organic materials. The microfluidic chip is preferably manufactured using a single-piece molding process.

[0028] In this invention, the lysis region is preferably located near the rotation center and is preferably circular or square. The multiplex amplification region is preferably adjacent to the lysis region and farther from the rotation center than the lysis region. The end of the multiplex amplification region near the rotation center is connected to the end of the lysis region away from the rotation center via a microchannel. The multiplex amplification region can simultaneously pre-set primers for 15 sites, enabling simultaneous amplification of 15 primers in one reaction system. The mixing region is ring-shaped. One end of the mixing region is connected to the end of the multiplex amplification region away from the rotation center via the microchannel. The distribution region is elongated and ring-shaped to evenly distribute the upstream reaction solution to each detection region. The detection region is sequentially connected to the quantification region and the reaction chamber in the direction away from the center. The quantification region is used to control the total volume of the reaction system transferred into the reaction chamber. The volume of the quantification region is designed based on the total volume of the reaction system in the reaction chamber; excess reaction system will enter the waste liquid chamber during centrifugation (centrifugation speed of 4500 rpm). After quantification, the centrifugation speed is increased to 600 rpm and centrifuged again to break through the centrifugal force required for gas-liquid exchange, thus controlling the gas-liquid exchange position. The reaction chamber is preferably pre-loaded with lyophilized reagents and detection probes required for the CRISPR Cas12a genotyping detection system, with each reaction chamber corresponding to one detection probe.

[0029] The preferred detection method for the microfluidic chip is as follows: A biological sample is injected into the lysis chamber through the sample inlet, and then the inlet and outlet are sealed. The chip is fixed on a sample tray equipped with a heating membrane, which heats the sample in the lysis chamber at 39°C, causing the sample to release nucleic acids. Subsequently, the centrifuge speed is increased to a first breakthrough speed of 1000 rpm. At this point, the lysed sample enters the multiplex amplification zone under centrifugal force and is thoroughly mixed with pre-stored biochemical reaction reagents. The heating membrane then heats the reconstituted reaction system at 39°C (first-step RAA reaction). After the reaction is complete, the centrifuge speed is increased again to a breakthrough speed of 2000 rpm, and the liquid enters the mixing zone. Immediately afterwards, the centrifuge speed is increased to 4500 rpm, and the liquid is precisely transferred to the quantitative distribution chamber, achieving accurate weighing and distribution. Then, the centrifuge speed is increased to 6000 rpm, and the weighed liquid immediately enters the reaction chamber, simultaneously initiating the second-step amplification reaction (CRISPR reaction).

[0030] In this invention, the primers are the detection primers in the detection reagents described in the above technical solutions; the probes are the reporter probes, wild-type probes, and mutant probes in the detection reagents described in the above technical solutions.

[0031] This invention provides the application of the detection reagent, the detection kit, or the microfluidic chip in constructing a model for predicting acute mountain sickness.

[0032] Based on the microfluidic chip for detecting genetic risk loci for acute mountain sickness, performance is significantly improved through three breakthroughs: First, optimized reaction kinetics: the timing-matched design of the RAA isothermal amplification module (reaction at 37-42℃ for 15-20 minutes) and Cas12a trans-cleavage activity enables a single-target detection sensitivity of 10 copies / μL; second, spatial multiplexing of the microfluidic chip: 15 independent reaction chambers are integrated on the chip using a three-dimensional microfluidic structure, achieving precise isolation and parallel detection of each unit through centrifugal force; third, intelligent signal decoding: combining fluorescence resonance energy transfer (FRET) probes (FAM / BHQ1 labeled) with machine learning algorithms to construct a three-dimensional mapping relationship between target concentration, fluorescence intensity, and risk level. This provides a highly integrated, versatile, high-performance, simple-to-operate microfluidic chip and reagent with high technical feasibility and practicality.

[0033] The following detailed description, in conjunction with embodiments, illustrates a genetic risk locus detection reagent for acute mountain sickness, its detection kit, microfluidic chip, and its applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0034] Example 1 1. Acute Mountain Sickness Cohort The acute mountain sickness cohort consisted of 393 male volunteers aged 18 years and older who traveled to high-altitude areas in 2022. They had no history of migraines, headaches, or epilepsy, and no history of high-altitude travel in the past year. Volunteers traveled by car from Kashgar (1200 meters above sea level) to Ali (4500 meters above sea level). Upon arrival at the high altitude, they completed the Chinese Acute Mountain Sickness Assessment (CISA) on their first night. [The Third National Symposium on High Altitude Medicine of the Chinese Medical Association, Nomenclature, Classification and Diagnostic Criteria of High Altitude Sickness in my country, Journal of High Altitude Medicine 20 (2010) 9-11.] Of these, 249 were asymptomatic, 92 had mild acute mountain sickness, 9 had moderate acute mountain sickness, and 43 had severe acute mountain sickness.

[0035] 2. Whole genome sequencing and variant detection Whole genome sequencing was performed on 393 individuals using the BGI DNBSEQ-T7 sequencing platform. The sequencing data was quality controlled and filtered using the FASTP software. The sequencing data was aligned to the human hg19 reference genome (hs37d5 version) using the Sentieon software BWA-MEM algorithm. SNPs and indel variants were obtained using the GATK software.

[0036] 3. Correlation Analysis Association analysis was performed using PLINK2 software. First, variants with multiple alleles, deletion rates greater than 10%, and variants that did not conform to Haven-Wen equilibrium were filtered out. P <1×10 -6 ) and variants with a secondary allele frequency of less than 0.01, ultimately yielding 9,118,444 variants for association analysis.

[0037] To correct the population structure, principal component analysis was performed based on these variations using PLINK2, and the significance of each principal component was tested using the twstats method. The top 7 significant principal components were selected to correct the population structure.

[0038] Using a linear regression model, with age and the first five principal components as covariates, association analysis was performed between these variables and the severity of acute mountain sickness, resulting in 27 potentially associated variables. P <5×10 -7 )(See Figure 1 ).

[0039] 4. Model Building Based on chain disequilibrium (r 2 >0.5), the above 27 potential associated variants were pruned to obtain 18 independent variants. In addition, the regions containing three variants were discarded because the presence of continuous A made it difficult to design detection primers. Finally, 15 variants were used to establish a predictive model for severe acute mountain sickness (see Table 1).

[0040] Table 1. 15 variant sites associated with severe acute mountain sickness (hs37d5 version)

[0041] Note: 126959267 on chromosome 5 is the physical location of the G base in GA on the reference chromosome, and 57492873 on chromosome X is the physical location of the G base in GTA on the reference chromosome.

[0042] From the 393 samples, 80% was used as the training set, consisting of 200 asymptomatic cases, 73 mild cases, 5 moderate cases, and 37 severe cases, totaling 315 samples. The remaining 20% ​​was used as the test set, consisting of 49 asymptomatic cases, 19 mild cases, 4 moderate cases, and 6 severe cases, totaling 78 samples.

[0043] The training set was used to train a prediction model using the radial basis function kernel support vector machine (svmRadial) algorithm to predict mild and severe cases of acute mountain sickness. Five-fold cross-validation resampling was used for parameter tuning. The accuracy of the prediction model was evaluated using ROC curves.

[0044] The training set results are shown in Table 2 and Figure 2 A.

[0045] Table 2 Prediction results of the training prediction model

[0046] A prediction model was built using a test set, and the accuracy of the prediction model was evaluated by plotting the ROC curve. The test set results are shown in Table 3 and... Figure 2 The results show that acute mountain sickness can be accurately predicted based on 15 loci.

[0047] Table 3. Prediction results of the prediction model constructed for the test set.

[0048] The prediction model was further validated using a separate sample of 25 volunteers who traveled to high-altitude areas. The results showed that the prediction model has good prediction accuracy.

[0049] Example 2 Acute mountain sickness genetic risk locus detection reagent By studying genetic risk loci for acute mountain sickness, a set of relevant loci were screened, and a reaction system with good detection performance was designed and developed, including the following sequences: Group 1, CHR5 POS126959267 genotyping primer set: Forward primer F1: AGATACTGCATCCCTGAACTGAGAACAAGA (SEQ ID NO:1); Reverse primer R1: TTTTCTGTCTTTTTCTTCTATTTTCTTCTT (SEQ ID NO:2); REF probe: aauuucuacuaaguguagauUGAAUGCCUUUUUUUCUUAG (SEQ ID NO:3); ALT probe: aauuucuacuaaguguagauUGAAUGCCUUUUUUCUUAGC (SEQ ID NO:4); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 2, CHR6 POS164080350 genotyping primer set: Forward primer F1: TTCCCAGACCCTAGTTTATGTCTTCCCTCT (SEQ ID NO:5); Reverse primer R1: ATCTTTTCATAAAGTTATAGGAGGATGTGT (SEQ ID NO:6); REF probe: aauuucuacuaaguguagauGUACUUUAAUCCUUAUUUUA (SEQ ID NO:7); ALT probe: aauuucuacuaaguguagauUUACUUUAAUCCUUAUUUUA (SEQ ID NO: 8); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 3, CHR9 POS10271582 genotyping primer set: Forward primer F1: TTTGAGACGGAATCTTGCTTTGTC (SEQ ID NO:9); Reverse primer R1: GAGGTTGCAGTGAGCCGAGATTATT (SEQ ID NO:10); REF probe: aauuucuacuaaguguagauUCGCCCAGACCAGAGUGCGG (SEQ ID NO: 11); ALT probe: aauuucuacuaaguguagauUCACCCAGACCAGAGUGCGG (SEQ ID NO:12); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 4, CHR9 POS111496696 genotyping primer set: Forward primer F1: ATGCTGCTATAAAGACACATGCACACGTAT (SEQ ID NO:13); Reverse primer R1: TTGGACATCTGGGTTGGTTCCAAGTCTTTG (SEQ ID NO:14); REF probe: aauuucuacuaaguguagauUUGUGGCACUAUUCAUAAUA (SEQ ID NO:15); ALT probe: aauuucuacuaaguguagauUUGUGACACUAUUCAUAAUA (SEQ ID NO:16); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 5, CHR11 POS19722834 genotyping primer set: Forward primer F1: TTCTCCTGTAGGGAAACCAGAAGAAAATGG (SEQ ID NO:17); Reverse primer R1: CTAGAATCCCCTCCCATGACCGTGGCCATT (SEQ ID NO:18); REF probe: aauuucuacuaaguguagauAGCACUUUCCUUGCCUUUGA (SEQ ID NO:19); ALT probe: aauuucuacuaaguguagauAGCGCUUUCCUUGCCUUUGA (SEQ ID NO:20); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 6, CHR11 POS75257678 genotyping primer set: Forward primer F1: CTGTCTCTATTAAAAATACAAAAATTAGCC (SEQ ID NO:21); Reverse primer R1: CTGCCTTAGCCTCCCAAGTAGCTGGGATTA (SEQ ID NO:22); REF probe: aauuucuacuaaguguagauCAGGUGUGUUCCACAACACC (SEQ ID NO: 23); ALT probe: aauuucuacuaaguguagauCAGGCGUGUUCCACAACACC (SEQ ID NO:24); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 7, CHR12 POS97137423 genotyping primer set: Forward primer F1: GAGGGATTCCAGTTAGAACAAAAGGAGAGA (SEQ ID NO:25); Reverse primer R1: ACAAGAGCTGGACATGTTAATTGTTATGCA (SEQ ID NO:26); REF probe: aauuucuacuaaguguagauAGUACCUAAGUGGAAUUUGAA (SEQ ID NO: 27); ALT probe: aauuucuacuaaguguagauAAGUACCUAGUGGAAUUUGA (SEQ ID NO:28); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 8, CHR13 POS50592459 genotyping primer set: Forward primer F1: CTACTATCTGTATATACTATTTGTATCTTA (SEQ ID NO:29); Reverse primer R1: TCTAAAAACATTTGTCAAAGTGAGAAAAAT (SEQ ID NO:30); REF probe: aauuucuacuaaguguagauUUUUAUGAGAUGUUCUGUAA (SEQ ID NO:31); ALT probe: aauuucuacuaaguguagauUUUCAUGAGAUGUUCUGUAA (SEQ ID NO:32); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 9, CHR16 POS81648399 genotyping primer set: Forward primer F1: TGGTGTGTGTGGTATGTGTGCATTTGTGTG (SEQ ID NO:33); Reverse primer R1: CACACCGTATACACATATACATACCACATA (SEQ ID NO:34); REF probe: aauuucuacuaaguguagauUGUGCCUGAUAUGUGUGUUU (SEQ ID NO:35); ALT probe: aauuucuacuaaguguagauUGUGUCUGAUAUGUGUGUUU (SEQ ID NO:36); Report probe: 5'FAM-TTATT-BHQ1-3' Group 10, CHR18 POS36828913 genotyping primer set: Forward primer F1: GCAAAAATTCCTTGAAAGACACAAAGTATA (SEQ ID NO:37); Reverse primer R1: AGGTTTAATTTTTATTAGAAATGGGACTAT (SEQ ID NO:38); REF probe: aauuucuacuaaguguagauACGAUAAAAGAGAAAAAGUA (SEQ ID NO:39); ALT probe: aauuucuacuaaguguagauACAAUAAAAGAGAAAAAGUA (SEQ ID NO:40); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 11, CHR18 POS65311119 genotyping primer set: Forward primer F1: GGTAAAGCACTCAATAGAGGTTCATCACTA (SEQ ID NO:41); Reverse primer R1: ATAGTAACATAAATTGAGTGCTTATACAAT (SEQ ID NO:42); REF probe: aauuucuacuaaguguagauUUGCUAUUGUUACUUUUGGC (SEQ ID NO:43); ALT probe: aauuucuacuaaguguagauCUGCUAUUGUUACUUUUGGC (SEQ ID NO:44); Report probe: 5'FAM-TTATT-BHQ1-3'; Group 12, CHR19 POS16411002 genotyping primer set: Forward primer F1: TACTATCATCCTGTCCCCCCCTGTATATTA (SEQ ID NO:45); Reverse primer R1: TAGTACCCCCAATATCGCAGGGGGCGTGTA (SEQ ID NO:46); REF probe: aauuucuacuaaguguagauUGACUGGUAUUAUGGGGGGU (SEQ ID NO:47); ALT probe: aauuucuacuaaguguagauUGACUAGUAUUAUGGGGGGU (SEQ ID NO:48); Report probe: 5'FAM-TTATT-BHQ1-3' Group 13, CHRX POS32026957 genotyping primer set: Forward primer F1: CATAGAGGAAGAGGCAGGAGAACTTCTGGC (SEQ ID NO:49); Reverse primer R1: CCCTCTTATACCTACTTAGGAGGACCCTCA (SEQ ID NO:50); REF probe: aauuucuacuaaguguagauAAACAUGAGCAUGAUGGAAC (SEQ ID NO:51); ALT probe: aauuucuacuaaguguagauAAACGUGAGCAUGAUGGAAC (SEQ ID NO:52); Report probe: 5'FAM-TTATT-BHQ1-3' Group 14, CHRX POS57492873 genotyping primer set: Forward primer F1: GGAAAAGTATATATATGTGTATATATATCT (SEQ ID NO:53); Reverse primer R1: TCTTTTACATACTTTTGTTATATATATTTA (SEQ ID NO:54); REF probe: aauuucuacuaaguguagauUAUACUUUUCCAGUAUAUUA (SEQ ID NO:55); ALT probe: aauuucuacuaaguguagauUACUUUUCCAGUAUAUUAUU (SEQ ID NO:56); Report probe: 5'FAM-TTATT-BHQ1-3' Group 15, CHRX POS92674859 genotyping primer set: Forward primer F1: TTATCCCTGTTCCCATGGTAATCTGCTAGC (SEQ ID NO:57); Reverse primer R1: AGGCTTGCCCAAGCTCACATATGCAAGAGA (SEQ ID NO:58); REF probe: aauuucuacuaaguguagauUUGCAUAUGCAAGUGUUGUC (SEQ ID NO:59); ALT probe: aauuucuacuaaguguagauCUGCAUAUGCAAGUGUUGUC (SEQ ID NO:60).

[0050] Report probe: 5'FAM-TTATT-BHQ1-3'.

[0051] Note: In the sequences of the REF and ALT probes above, U can be replaced with T.

[0052] Example 2 A microfluidic chip for detecting genetic risk loci for acute mountain sickness Microfluidic chip structure ( Figure 3 The functions are as follows: The chip has functional cavities arranged sequentially along the centrifugation direction, and adjacent functional cavities are connected by a gas resistance valve; the upstream and downstream functional cavities are connected by a gas resistance valve. After centrifugation is started, the liquid in the upstream functional cavity is transferred to the downstream functional cavity under the action of centrifugal force, and the gas in the downstream functional cavity moves to the upstream functional cavity in the opposite direction; after the sample is added to the chip, the sample inlet and the exhaust port are sealed.

[0053] The functional chambers are arranged sequentially along the centrifugation direction, including a lysis zone (1), a multiplex amplification zone (2), a mixing zone (3), a distribution zone (4), and a detection zone (5). The detection zone includes multiple detection chambers, arranged sequentially along the centrifugation direction and circumferentially around the rotation center. The lysis zone has a sample loading port for adding samples to the chip. The multiplex amplification zone is pre-loaded with a lyophilized RAA amplification system and primer combinations. The primer combinations are multiplex amplification primers (forward primer F1 and reverse primer R1 for the 15 detection sites described in Example 1). The RAA amplification system is a commercially available reagent, and the lyophilized enzyme MIX and system buffer are purchased from Zhejiang Lingyu Biotechnology Co., Ltd., catalog number: S001LY. The detection zone is pre-loaded with lyophilized reagents and detection probes required for the CRISPR Cas12a genotyping detection system. The lyophilized reagents are commercially available reagents, and the lyophilized LbCas12a and system buffer are purchased from Zhejiang Lingyu Biotechnology Co., Ltd., Cas catalog number: DB008LY. Each reaction chamber in the microfluidic chip corresponds to one type of probe.

[0054] Example 3 1. Materials and Methods 1.1 Plasmid Plasmids: A total of 30 plasmids (BioGen Biotech), sequences are shown in Table 4.

[0055] Table 4. Sequences of 30 plasmids

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] 1.2 Detection Method Add 300 μL of template (plasmid solution, extracted nucleic acid, or oral swab collection fluid with nucleic acid release function) to the chip sample loading port, then seal the loading port and place the chip inside the instrument. This embodiment uses a nucleic acid release agent (catalog number: THR-SF-3-48) purchased from Beijing Taihao Biotechnology Co., Ltd. to lyse cells.

[0066] The reaction process is controlled by a microfluidic chip. First, nucleic acid is released in the lysis region, a process that takes 5 minutes at room temperature. Then, a portion of the nucleic acid solution is rotated into the multiplex amplification region, which is pre-coated with RAA lyophilized reagent. Once the lyophilized reagent is completely reconstituted, the RAA multiplex amplification reaction begins. This reaction consists of four steps: First, the recombinant protease, with the assistance of the cofactor uvsY, forms an enzyme-primer complex with the upstream and downstream primers; second, after the complex is localized on the template, it directly initiates the strand exchange reaction, forming a D-shaped loop; third, after the recombinant enzyme uvsX dissociates, the 3′ end of the primer is exposed, and it is recognized by the strand displacement DNA polymerase for strand extension, forming a new complementary strand; fourth, with the synergistic effect of the strand displacement DNA polymerase system, the amplification of the specific fragment begins. The target sequence can be amplified to a detectable level within 10-30 minutes. The optimal temperature for this reaction is 37-42℃, making it low-cost, time-efficient, and enabling rapid nucleic acid detection. In this invention, RAA multiplex amplification (1x Buffer, 0.1 μM RAA primers (15 primers in total), 50 μL reaction) was performed entirely in a microfluidic chip at a temperature of 39°C for 20 minutes.

[0067] After multiplex amplification, the RAA reagent and unreacted nucleic acid solution are transferred to the mixing zone via microfluidic chip rotation. This process allows for dilution of the RAA reaction system within the chip, facilitating the subsequent CRISPR Cas12a reaction. This embodiment designs a crRNA probe that specifically identifies risk sites. Based on base pairing principles, it specifically recognizes SNP sites. Upon successful recognition, the Cas12a protein is activated, cleaving the single-stranded DNA reporter probe in the reaction system, thereby generating a quantitative fluorescence signal. Analysis of the fluorescence signal determines the genotype of the risk site.

[0068] All of the above reaction processes are carried out in the microfluidic chip. In actual operation, the instrument system performs them fully automatically without human intervention.

[0069] 1.3 Negative test Add 300 μL of DEPC aqueous solution to the chip sample port, then seal the sample port, place the chip inside the instrument, and start the detection. Figure 3 The test result was negative.

[0070] 1.4 Sensitivity Test The risk sites involved in this invention are synthesized by Sangon Biotech using wild-type and mutant plasmids, followed by the preparation of plasmid aqueous solutions of different concentrations for sensitivity testing. In this embodiment, the reference genomic locus C5P9267-REF (referring to the 5th chromosome locus 126959267, with the backbone vector being PUB57), C5P9267-ALT, C6P0350-REF, C6P0350-ALT, C9P5820-REF, C9P5820-ALT, C9P6696-REF, C9P6696-ALT, C11P2834-REF, C112834-ALT, C117678-REF, C11P7678-ALT, C12P7423-REF, C12P7423-ALT, C13P2459-REF, C13P2459-ALT, are used. The plasmids C16P8399-REF, C168399-ALT, C18P8913-REF, C18P8913-ALT, C18P1119-REF, C18P1119-ALT, C19P1002-REF, C19P1002-ALT, CXP6957-REF, CXP6957-ALT, CXP2873-REF, CXP2873-ALT, CXP4859-REF, and CXP4859-ALT were used for sensitivity detection. Gradient concentration solutions of 1 copy / μL, 10 copies / μL, and 100 copies / μL were prepared, and 300 μL of each solution was added to the chip sample port. After sealing, the chip was used for detection.

[0071] See results Figures 5-34 Sensitivity experiments showed that the detection method established in this invention detected 15 variant sites, with a limit of detection of 10 copies / μL of target nucleic acid within 45 minutes.

[0072] 1.5 Specificity Detection Specificity and actual sample testing Three samples with clearly defined genotypes (normal REF type, C11P2834 heterozygous type, and C16P8399 heterozygous type) were tested. 300 μL of the extracted genomic solution was added to the chip's sample loading port, sealed, and then analyzed. Sample 1 represents the normal genotype, with all 15 loci being REF type, denoted as REF type. Sample 2 is C11P2834 heterozygous, specifically representing locus 19722834 on chromosome 11 as REF and ALT heterozygous, with the remaining 14 loci being REF type. Sample 3 represents C16P8399 heterozygous, specifically representing locus 81648399 on chromosome 16 as REF and ALT heterozygous, with the remaining 14 loci being REF type.

[0073] Result interpretation method: Based on the amplification status of the two probes at each site in the fluorescence data, when only one curve of the wild-type or mutant detection probe of the corresponding color appears, it indicates that the corresponding site is homozygous wild-type or mutant. If curves of both wild-type and mutant detection probes appear at the same time, it indicates that the corresponding site is heterozygous.

[0074] See results Figures 35-37 The results of sample testing experiments show that the detection method established in this invention can effectively identify risk gene loci and has practical application value.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A microfluidic chip for detecting genetic risk loci in acute mountain sickness, characterized in that, The microfluidic chip has several functional cavities arranged in an orderly manner along the centrifugal direction, and adjacent functional cavities are connected by air resistance valves. The functional cavity includes a lysis region, a multiplex amplification region, a mixing region, a distribution region, and a detection region connected in sequence; the lysis region is provided with a sample loading port for adding samples to the chip; the multiplex amplification region is pre-loaded with lyophilized RAA reaction lyophilized powder and primers; the primers are genotyping primers from the acute mountain sickness genetic risk site detection reagent. The detection area is provided with several reaction chambers with openings facing the center of rotation and arranged circumferentially along the centrifugal direction; The reaction chamber is pre-loaded with CRISPR Cas12a enzyme digestion reaction lyophilized reagents and probes; The probes are reporter probes, wild-type probes, and mutant probes from the acute mountain sickness genetic risk site detection reagent; An exhaust port is provided at a location extending from the pyrolysis zone close to the center of rotation. The acute mountain sickness genetic risk locus detection reagent includes a reporter probe, genotyping primers amplifying the following loci, and wild-type and mutant probes targeting the following loci: CHR5 POS126959267, CHR6 POS164080350, CHR9 POS10271582, CHR9 POS111496696, CHR11 POS19722834, CHR11 POS75257678, CHR12 POS97137423, CHR13 POS50592459, CHR16 POS81648399, CHR18 POS36828913, CHR18 POS65311119, CHR19 POS16411002, CHRX POS32026957, CHRX POS57492873, and CHRX POS92674859; Primers for genotyping detection of CHR5 POS126959267 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:2; the nucleoside sequence of the wild-type probe targeting CHR5 POS126959267 is shown in SEQ ID NO:3; and the nucleoside sequence of the mutant probe targeting CHR5 POS126959267 is shown in SEQ ID NO:

4. Primers for genotyping detection of CHR6 POS164080350 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:5 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:6; the nucleoside sequence of the wild-type probe targeting CHR6 POS164080350 is shown in SEQ ID NO:7; and the nucleoside sequence of the mutant probe targeting CHR6 POS164080350 is shown in SEQ ID NO:

8. Primers for genotyping detection of CHR9 POS10271582 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:9 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:10; the nucleoside sequence of the wild-type probe targeting CHR9 POS10271582 is shown in SEQ ID NO:11; the nucleoside sequence of the mutant probe targeting CHR9 POS10271582 is shown in SEQ ID NO:

12. The primers for genotyping detection of CHR9 POS111496696 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:13 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:14; the nucleoside sequence of the wild-type probe targeting CHR9 POS111496696 is shown in SEQ ID NO:15; and the nucleoside sequence of the mutant probe targeting CHR9 POS111496696 is shown in SEQ ID NO:

16. The primers for genotyping detection of CHR11 POS19722834 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:17 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:18; the nucleoside sequence of the wild-type probe targeting CHR11 POS19722834 is shown in SEQ ID NO:19; and the nucleoside sequence of the mutant probe targeting CHR11 POS19722834 is shown in SEQ ID NO:

20. The primers for genotyping detection of CHR11 POS75257678 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:21 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:22; the nucleoside sequence of the wild-type probe targeting CHR11 POS75257678 is shown in SEQ ID NO:23; and the nucleoside sequence of the mutant probe targeting CHR11 POS75257678 is shown in SEQ ID NO:

24. The primers for genotyping detection of CHR12 POS97137423 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:25 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:26; the nucleoside sequence of the wild-type probe targeting CHR12 POS97137423 is shown in SEQ ID NO:27; and the nucleoside sequence of the mutant probe targeting CHR12 POS97137423 is shown in SEQ ID NO:

28. Primers for genotyping detection of CHR13 POS50592459 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:29 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:30; the nucleoside sequence of the wild-type probe targeting CHR13 POS50592459 is shown in SEQ ID NO:31; and the nucleoside sequence of the mutant probe targeting CHR13 POS50592459 is shown in SEQ ID NO:

32. The primers for genotyping detection of CHR16 POS81648399 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:33 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:34; the nucleoside sequence of the wild-type probe targeting CHR16 POS81648399 is shown in SEQ ID NO:35; and the nucleoside sequence of the mutant probe targeting CHR16 POS81648399 is shown in SEQ ID NO:

36. The primers for genotyping detection of CHR18 POS36828913 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:37 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:38; the nucleoside sequence of the wild-type probe targeting CHR18 POS36828913 is shown in SEQ ID NO:39; and the nucleoside sequence of the mutant probe targeting CHR18 POS36828913 is shown in SEQ ID NO:

40. The primers for genotyping detection of CHR18 POS65311119 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:41 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:42; the nucleoside sequence of the wild-type probe targeting CHR18 POS65311119 is shown in SEQ ID NO:43; and the nucleoside sequence of the mutant probe targeting CHR18 POS65311119 is shown in SEQ ID NO:

44. The primers for genotyping detection of CHR19 POS16411002 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:45 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:46; the nucleoside sequence of the wild-type probe targeting CHR19 POS16411002 is shown in SEQ ID NO:47; and the nucleoside sequence of the mutant probe targeting CHR19 POS16411002 is shown in SEQ ID NO:

48. The primers for genotyping detection of CHRX POS32026957 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:49 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:50; the nucleoside sequence of the wild-type probe targeting CHRX POS32026957 is shown in SEQ ID NO:51; and the nucleoside sequence of the mutant probe targeting CHRX POS32026957 is shown in SEQ ID NO:

52. The primers for genotyping detection of CHRX POS57492873 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:53 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:54; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:55; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:

56. The primers for genotyping detection of CHRX POS92674859 include a forward primer with a nucleoside sequence as shown in SEQ ID NO:57 and a reverse primer with a nucleoside sequence as shown in SEQ ID NO:58; the nucleoside sequence of the wild-type probe targeting CHRX POS57492873 is shown in SEQ ID NO:59; and the nucleoside sequence of the mutant probe targeting CHRX POS57492873 is shown in SEQ ID NO:

60. The reporter probe is a TTATT sequence with a fluorescent group modified at one end and a quencher group modified at the other end.

2. The microfluidic chip for detecting genetic risk loci of acute mountain sickness according to claim 1, characterized in that, The fluorescent group includes FAM; the quenching group includes BHQ1.

3. The microfluidic chip for detecting genetic risk loci of acute mountain sickness according to claim 1, characterized in that, The diameter of the microfluidic chip is 80~100mm; the thickness of the microfluidic chip is 3.0~4.0mm.

4. The microfluidic chip for detecting genetic risk loci of acute mountain sickness according to claim 1, characterized in that, The microfluidic chip uses microchannels to connect the various functional cavities; The equivalent diameter of the cross-section of the microchannel is 0.1~2mm.

5. The microfluidic chip for detecting genetic risk loci of acute mountain sickness according to claim 1, characterized in that, The microfluidic chip includes a lysis region, a multiplex amplification region, a mixing region, a distribution region, and 36-72 detection regions.

6. The microfluidic chip according to any one of claims 1 to 5, characterized in that, The microfluidic chip is made of transparent organic materials.

7. A kit for detecting genetic risk loci for acute mountain sickness, characterized in that, The microfluidic chip for detecting genetic risk sites of acute mountain sickness as described in claim 1 or 2 includes the detection reagent, RAA reaction lyophilized powder, and CRISPR Cas12a enzyme digestion reaction lyophilized powder.

8. The detection kit according to claim 7, characterized in that, It also includes wild-type recombinant plasmids and mutant recombinant plasmids containing the following sites: CHR5 POS126959267, CHR6 POS164080350, CHR9 POS10271582, CHR9POS111496696, CHR11 POS19722834, CHR11 POS75257678, CHR12 POS97137423, CHR13 POS50592459, CHR16 POS81648399, CHR18 POS36828913, CHR18 POS65311119, CHR19 POS16411002, CHRX POS32026957, CHRX POS57492873, and CHRX POS92674859; The exogenous gene fragments in the wild-type recombinant plasmid and the mutant recombinant plasmid are shown in SEQ ID NO:61~SEQ ID NO:90, respectively.

9. The application of the microfluidic chip for detecting genetic risk sites of acute mountain sickness according to any one of claims 1 to 6 or the detection kit according to claim 7 or 8 in constructing a model for predicting acute mountain sickness.

Images