Reagent storage box for colon cancer detection

Abstract

The invention discloses a colon cancer detection reagent storage box, and belongs to the technical field of cell culture, the colon cancer detection reagent storage box comprises a storage box, the top of the storage box is connected with a sealing cover, the storage box is internally provided with a cold conduction plate, the outer wall of the cold conduction plate is connected with a cold conduction block, and the cold conduction block is wound with a conveying pipe; the conveying pipe is laid at the bottom of the cold guide plate and surrounds the side wall of the cold guide plate, the sealing mechanism comprises a mounting pipe communicating with the bottom of the storage box, the bottom end of the mounting pipe communicates with a connecting pipe, the inner wall of the connecting pipe is slidably connected with a movable plug, and a plurality of through holes are formed in the outer wall of the movable plug around the axis; according to the reagent storage box for colon cancer detection, the storage box is connected with the cold air pipe through the sealing mechanism, when the storage box is taken out of the refrigerator, the storage box is sealed, cold air dissipation is prevented, and the accuracy and reliability of the reagent storage box for colon cancer detection in practical application are verified through experiments.

Description

Technical Field

[0001] This invention belongs to the field of cell culture technology, and particularly relates to a reagent storage box for colon cancer detection. Background Technology

[0002] Colorectal cancer is a malignant tumor that occurs in the colon, belonging to the category of colorectal cancer. Based on anatomical location, it is divided into left-sided and right-sided colorectal cancer. Histologically, it is mainly adenocarcinoma. Early symptoms are often insidious, but as the disease progresses, changes in bowel habits, rectal bleeding or melena, persistent abdominal pain, and weight loss may occur. Left-sided colorectal cancer is prone to causing intestinal obstruction, while right-sided colorectal cancer is characterized by anemia and abdominal masses. After metastasis, jaundice, dyspnea, bone pain, and ascites may occur. It is not infectious. Early-stage patients are treated primarily with surgery, including endoscopic resection. Mid-to-late-stage patients require combined radiotherapy, chemotherapy, and targeted therapy. The incidence of colorectal cancer is closely related to the malignant transformation of adenomatous polyps, genetic factors, a high-fat, low-fiber diet, and chronic intestinal inflammation. High-risk groups include middle-aged and elderly people over 50 years of age, those with a family history of colorectal cancer, and patients with intestinal polyps or inflammatory bowel disease.

[0003] In the field of molecular diagnostics for colorectal cancer, early detection and accurate subtyping are crucial for treatment decisions and prognostic assessment. Mutation detection in colorectal cancer typically relies on the analysis of cell-free DNA (cfDNA) in peripheral blood, especially targeting specific mutation sites in genes such as Kras, BRAF, and Nras. However, traditional cfDNA extraction and PCR detection require multiple independent steps, including plasma separation, DNA purification, and reagent preparation. These procedures are complex, time-consuming, prone to human error, and have low standardization. Furthermore, inconsistencies in reagents, equipment, and procedures used by different laboratories lead to significant variability in test results, affecting comparability and reliability. Multi-target detection is inefficient, as detection of multiple mutation sites often requires multiple runs, increasing sample consumption, time, and cost. Sensitivity and specificity are also insufficient. In addition, conventional PCR methods may not effectively distinguish low-frequency mutations and are susceptible to non-specific amplification interference, leading to false positive or false negative results. Moreover, the lack of a built-in control system makes it difficult to monitor experimental validity in real time, affecting the accuracy of result interpretation. Summary of the Invention

[0004] The purpose of this invention is to provide a reagent storage box for colon cancer detection in order to solve the problem.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A reagent storage box for colon cancer detection includes a storage box with a sealing cap connected to the top. A cold-conducting plate is disposed inside the storage box, and a cold-conducting block is connected to the outer wall of the cold-conducting plate. A delivery tube is coiled around the outside of the cold-conducting block. The delivery tube is configured to be laid at the bottom of the cold-conducting plate and surround its sidewalls. Cold air flows within the delivery tube to maintain a low temperature inside the storage box. A sealing mechanism includes an installation tube connected to the bottom of the storage box, and a connecting tube connected to the bottom end of the installation tube. A movable plug is slidably connected to the inner wall of the connecting tube. Multiple through holes are formed around the outer wall of the movable plug along its axis. The movable plug is configured to slide relative to the connecting tube to control the opening or closing of the through holes.

[0006] As a further description of the above technical solution: The outer wall of the cooling block is provided with multiple cooling grooves, and one end of the conveying pipe is connected to a cooling collector. The side wall of the cooling collector is provided with multiple grooves along the axis.

[0007] As a further description of the above technical solution: Both inner walls at the top of the connecting tube have limiting plates, and springs are connected to the bottom of the limiting plates. One end of the spring is connected to the corresponding position on the outer wall of the top of the movable plug, and a contact block is connected to the top of the movable plug.

[0008] As a further description of the above technical solution: Peripheral blood was collected using EDTA anticoagulant tubes and plasma was separated. Human peripheral blood cell-free DNA (cfDNA) was extracted. Template DNA was added to pre-prepared reaction solutions containing 8 gene mutation sites, a negative control, and a positive control. The reaction tubes were placed in a real-time quantitative PCR instrument and amplified according to a preset program. After amplification, the amplification cycle number of the positive and negative controls was checked, and the sample test results were determined.

[0009] As a further description of the above technical solution: Peripheral blood was collected from healthy volunteers using EDTA anticoagulant tubes. The peripheral blood was transferred to centrifuge tubes using pipettes. The centrifuge tubes were centrifuged at 1600×g for 10 minutes to separate the plasma. After centrifugation, the upper plasma layer was transferred to a new centrifuge tube using a pipette. During the pipetting process, the leukocyte layer was avoided. The new centrifuge tubes were centrifuged at 1600×g for 10 minutes at 4°C. The supernatant was then frozen and stored at -20°C.

[0010] As a further description of the above technical solution: After adding an equal volume of ACB buffer to plasma and vortexing to mix, a cfDNA extraction kit was used to degrade proteins in the plasma using proteinase K. Under specific buffer conditions, cfDNA was selectively bound to the adsorption column. Impurities were removed by washing, and finally, high-purity cfDNA was eluted from the adsorption column using a low-ionic-strength elution buffer to obtain human peripheral blood cell-free DNA (cfDNA).

[0011] As a further description of the above technical solution: Remove the colorectal cancer test kit and template DNA from the refrigerator and place them on ice to thaw for 20 minutes. After all components have completely dissolved, place the premixed solution tube from the colorectal cancer test kit on a vortex mixer and vortex at a medium-low speed for 10 seconds to resuspend the precipitate.

[0012] As a further description of the above technical solution: The premixed solution tube in the colorectal cancer detection reagent storage box contains a specific PAP probe for detecting colorectal cancer-related gene mutation sites, PCR buffer, dNTPs, the fluorescent dye SYBR Green I, and KlenTaq-sDNA polymerase. The gene mutation sites are Kras G12D, Kras G12C, Kras G13D, BRAF V600E, Kras Q61H, Nras Q61K, Nras Q61R, and Nras G12D.

[0013] As a further description of the above technical solution: Plan the positions of 8 mutation site wells, 1 negative control well and 1 positive control well for each sample on the PCR plate. Add 1 μL of template DNA to the corresponding pre-reaction solution in each PCR reaction tube to obtain the reaction premix. The total volume of the reaction system is 25 μL.

[0014] As a further description of the above technical solution: PCR amplification was performed using a real-time quantitative PCR amplification instrument, with the program edited to pre-denaturate at 94℃ for 30 seconds. The PCR amplification was performed at 94℃ for 25 seconds, 60℃ for 30 seconds, and 64℃ for 30 seconds (fluorescence acquisition) for a total of 40 cycles. The final extension was performed at 68℃ for 30 seconds and 72℃ for 30 seconds. The total PCR amplification time was 2 hours. After the PCR amplification program was completed, the software automatically generated the amplification curve and Ct value. The validity of the experiment was verified by comparing it with the quality control standard.

[0015] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are: 1. In this invention, the colorectal cancer detection reagent storage kit is pre-loaded with pre-reaction solutions, negative controls, and positive controls targeting eight key mutation sites. This enables centralized management and standardized use of reagents, reducing the risk of reagent preparation errors and cross-contamination. The use of pre-mixed tubes and specific PAP probes simplifies template addition and reaction system preparation steps, significantly shortening detection time and improving detection efficiency. Furthermore, the colorectal cancer detection reagent storage kit employs PAP probe technology and KlenTaq-s polymerase, combined with SYBR Green I fluorescence detection, to accurately identify low-frequency mutations, effectively avoiding non-specific amplification and ensuring reliable detection results. It can simultaneously detect eight colorectal cancer-related mutation sites, improving detection throughput and efficiency, making it suitable for large-scale clinical screening. Moreover, the detection results of the colorectal cancer detection reagent storage kit are highly consistent with next-generation sequencing (NGS), showing a 100% concordance rate in clinical samples, demonstrating its accuracy and reliability in practical applications.

[0016] 2. In this invention, the reagent storage box for colon cancer detection needs to be stored in a -20°C refrigerator. By setting a sealing mechanism, the bottom end of the connecting tube is aligned with the cold air nozzle and connected. The cold air nozzle pushes the sealing plug upward to open the through hole. The spring is compressed, and the cold air passes through the limiting plate and is collected by the cold collector. It is then transported to the cold-conducting block by the delivery pipe. The cold-conducting block transfers the cold air to the cold-conducting plate to keep the reagent kit at a low temperature. The cold-conducting groove on the outer wall of the cold-conducting block greatly increases the contact area between the cold-conducting block and the cold air, improving the cold preservation efficiency. When the reagent storage box for colon cancer detection is taken out, the spring releases and pushes the moving plug back to its original position to seal the connecting tube, preventing the cold air from escaping and ensuring the cold preservation effect of the reagent storage box for colon cancer detection. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the main structure of a reagent storage box for colon cancer detection proposed in this invention; Figure 2 This is a schematic diagram showing the disassembled structure of a reagent storage box for colon cancer detection proposed in this invention; Figure 3 This is a partial half-section diagram of a reagent storage box for colon cancer detection proposed in this invention; Figure 4 This is a partial half-sectional schematic diagram of the sealing mechanism of a reagent storage box for colon cancer detection proposed in this invention. Figure 5 For the present invention Figure 4 A magnified structural diagram of part A in the middle; Figure 6 This is a schematic diagram illustrating the relative quantitative relationship between site mutation load and reaction in this invention; Figure 7 This is the gradient dilution amplification curve of the KRAS G12D site mutation standard of the present invention; Figure 8 This is the amplification curve of the wild-type standard of the KRAS G12D site in this invention.

[0018] Legend: 1. Storage box; 2. Sealing cover; 3. Cooling plate; 4. Cooling block; 5. Cooling channel; 6. Delivery pipe; 7. Cooling collector; 8. Sealing mechanism; 801. Mounting pipe; 802. Connecting pipe; 803. Limiting plate; 804. Spring; 805. Contact block; 806. Moving plug; 807. Through hole; 9. Reagent kit. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Example 1

[0020] Please see Figure 1 This invention provides a technical solution: a reagent storage box for colon cancer detection, comprising a storage box 1, a sealing cover 2 connected to the top of the storage box 1, a cooling plate 3 disposed inside the storage box 1, a cooling block 4 connected to the outer wall of the cooling plate 3, a delivery pipe 6 coiled around the outside of the cooling block 4, the delivery pipe 6 being configured to be laid at the bottom of the cooling plate 3 and also surrounding the side wall of the cooling plate 3, cold air flowing in the delivery pipe 6 to keep the interior of the storage box 1 at a low temperature, and a sealing mechanism 8, the sealing mechanism 8 including an installation pipe 801 connected to the bottom of the storage box 1, a connecting pipe 802 connected to the bottom end of the installation pipe 801, a movable plug 806 slidably connected to the inner wall of the connecting pipe 802, a plurality of through holes 807 opened around the outer wall of the movable plug 806 around the axis, the movable plug 806 being configured to slide relative to the connecting pipe 802 to control the opening or closing of the through holes 807.

[0021] Multiple cooling grooves 5 are provided on the outer wall of the cooling block 4, and a cooling collector 7 is connected to one end of the conveying pipe 6. Multiple grooves are provided on the side wall of the cooling collector 7 along the axis.

[0022] Both inner walls at the top of the connecting pipe 802 have limit plates 803. A spring 804 is connected to the bottom of the limit plate 803. One end of the spring 804 is connected to the corresponding position on the top outer wall of the movable plug 806. A contact block 805 is connected to the top of the movable plug 806.

[0023] Peripheral blood was collected using EDTA anticoagulant tubes and plasma was separated. Human peripheral blood cell-free DNA (cfDNA) was extracted. Template DNA was added to pre-prepared reaction solutions containing 8 gene mutation sites, a negative control, and a positive control. The reaction tubes were placed in a real-time quantitative PCR instrument and amplified according to a preset program. After amplification, the amplification cycle number of the positive and negative controls was checked, and the sample test results were determined.

[0024] Peripheral blood was collected from healthy volunteers using EDTA anticoagulant tubes. The peripheral blood was transferred to centrifuge tubes using pipettes. The centrifuge tubes were centrifuged at 1600×g for 10 minutes to separate the plasma. After centrifugation, the upper plasma layer was transferred to a new centrifuge tube using a pipette. During the pipetting process, the leukocyte layer was avoided. The new centrifuge tubes were centrifuged at 1600×g for 10 minutes at 4°C. The supernatant was then frozen and stored at -20°C.

[0025] After adding an equal volume of ACB buffer to plasma and vortexing to mix, a cfDNA extraction kit was used to degrade proteins in the plasma using proteinase K. Under specific buffer conditions, cfDNA was selectively bound to the adsorption column. Impurities were removed by washing, and finally, high-purity cfDNA was eluted from the adsorption column using a low-ionic-strength elution buffer to obtain human peripheral blood cell-free DNA (cfDNA).

[0026] Remove the colorectal cancer test kit and template DNA from the refrigerator and place them on ice to thaw for 20 minutes. After all components have completely dissolved, place the premixed solution tube from the colorectal cancer test kit on a vortex mixer and vortex at a medium-low speed for 10 seconds to resuspend the precipitate.

[0027] Reagents: Human peripheral blood donated by healthy volunteers; EDTA anticoagulant tubes (purple cap tubes); PBS buffer (Ca²⁺ / Mg²⁺-free); 70% ethanol; anhydrous ethanol; cfDNA extraction kit (Qiagen): containing proteinase K, ACB buffer, ACL buffer, AWI and AW2 buffer, and AE buffer.

[0028] Consumables and equipment: Clean bench; benchtop high-speed centrifuge; mini centrifuge; vortex mixer; constant temperature water bath; micropipette; 2mL nuclease-free centrifuge tubes; Qubit fluorometer.

[0029] Experimental steps: Before using the clean bench, wipe the surface with 75% alcohol and irradiate it with ultraviolet light for 30 minutes.

[0030] Preparation of PBS buffer (Ca²⁺ / Mg²⁺-free): Weigh 8.0g NaCl, 0.2g KCl, 1.44g Na₂HPO₄, and 0.24g KH₂PO₄ and dissolve them in 800mL distilled water. Adjust the solution to 7.4 with HCl, and finally add distilled water to make up to 1L to obtain 0.01M PBS buffer. After autoclaving, store at room temperature.

[0031] Preparation of 70% ethanol: Measure 700 mL of anhydrous ethanol using a graduated cylinder, add 300 mL of nuclease-free water, mix well, and store at room temperature.

[0032] Plasma separation: 30 ml of peripheral blood was collected from healthy volunteers using EDTA anticoagulant tubes (purple cap tubes), and plasma separation was performed within 6 hours after blood collection; Take a 50ml centrifuge tube, pipette 20ml of peripheral blood, place it in a benchtop high-speed centrifuge at room temperature, set the centrifugal force to 1600×g, set the acceleration and deceleration to the lowest setting, and centrifuge for 10 minutes. After centrifugation, carefully pipette the upper plasma layer into a new sterile centrifuge tube, avoiding touching the white leukocyte layer in the middle during the pipetting process. Centrifuge the collected serum again at 16000×g at 4℃ for 10 minutes to completely remove residual cells. Carefully pipette the supernatant into a new centrifuge tube and freeze at -20℃.

[0033] cfDNA extraction: Take 5 mL of plasma, add an equal volume of ACB buffer, vortex for 15 seconds, add 50 μL of proteinase K according to the kit instructions, vortex, add ACL buffer, vortex for 15 seconds, and incubate the mixture in a 60°C water bath for 30 minutes, vortexing occasionally during the incubation period.

[0034] DNA binding: After incubation, briefly centrifuge (3000 rpm, 10 seconds) to collect droplets from the tube wall, add anhydrous ethanol to the collection tube, vortex immediately for 15 seconds, briefly centrifuge (3000 rpm, 10 seconds), transfer the entire mixture to the adsorption column, cap the tube, set the centrifuge force to 6000×g, set the acceleration and deceleration speeds to the lowest setting, centrifuge for 1 minute, discard the filtrate after centrifugation, and return the adsorption column to the collection tube.

[0035] Washing: Add 500 μL of LAWI buffer to the adsorption column, set the centrifugation force to 6000×g, set the speed of acceleration and deceleration to the lowest setting, centrifuge for 1 minute, and discard the filtrate after centrifugation. Add 700 μL LAW2 buffer to the adsorption column, set the centrifugation force to 6000 × g, set the acceleration and deceleration rates to the lowest setting, centrifuge for 1 minute, and discard the filtrate after centrifugation. Return the empty adsorption column to the collection tube, set the centrifuge to a centrifugal force of 20000×g, set the speed increase and decrease to the lowest setting, and centrifuge for 3 minutes to thoroughly dry the membrane.

[0036] Elution: Place the adsorption column on a clean 1.5 mL nuclease-free centrifuge tube, carefully add 20-60 μL of LAE buffer to the center of the adsorption column membrane, and let it stand at room temperature for 3-5 minutes to allow the elution buffer to fully wet the membrane. Set the centrifuge to 20000×g and the acceleration / deceleration speed to the lowest setting, centrifuge for 1 minute. The liquid at the bottom of the centrifuge tube is the elution buffer containing cfDNA. To improve the yield, add the elution buffer back to the adsorption column and centrifuge again. Store the extracted cfDNA at -20°C.

[0037] Concentration and purity determination: Quantification was performed using a Qubit fluorometer, and fragment distribution of cfDNA was assessed using an Agilent 2100 Bioanalyzer.

[0038] (4) Experimental results: The main peak of the cfDNA fragment distribution was 170bp. Example 2

[0039] A reagent storage kit for colorectal cancer detection includes the following steps: the premixed solution tube in the reagent storage kit contains a specific PAP probe for detecting colorectal cancer-related gene mutation sites, PCR buffer, dNTPs, fluorescent dye SYBR Green I, and KlenTaq-sDNA polymerase, wherein the gene mutation sites are Kras G12D, Kras G12C, Kras G13D, BRAF V600E, Kras Q61H, Nras Q61K, Nras Q61R, and Nras G12D.

[0040] Plan the positions of 8 mutation site wells, 1 negative control well and 1 positive control well for each sample on the PCR plate. Add 1 μL of template DNA to the corresponding pre-reaction solution in each PCR reaction tube to obtain the reaction premix. The total volume of the reaction system is 25 μL.

[0041] Reagents: Template DNA (peripheral blood cfDNA: concentration 10 ng / μL), volume 10 μL; nuclease-free water; colon cancer detection reagent storage box: containing PCR tubes pre-filled with reaction premix.

[0042] Equipment: Micropipette; nuclease-free pipette tips; vortex mixer; mini centrifuge; ice box; PCR tube rack.

[0043] Experimental steps: Wipe the clean bench or work surface, pipette surface, and ice pack with 75% ethanol. Thawing and mixing of reagents: Remove the colon cancer test reagent storage box and template DNA from the -20℃ freezer. Place the PCR premixed solution tube and template DNA in the colon cancer test reagent storage box on ice to thaw for 20 minutes. After all components are completely dissolved, place the premixed solution tube on a vortex mixer and vortex at medium-low speed for 10 seconds to ensure that the precipitate is completely resuspended and mixed evenly. Briefly centrifuge all tubes (3000 rpm, 10 seconds) to collect all the liquid on the tube wall and cap to the bottom of the tube. Template DNA addition: Plan the positions of 8 mutation site wells, 1 negative control well, and 1 positive control well for each sample on the PCR plate, and make clear markings; Adjust the micropipette to 1.0 μL. Take a new 10 μL nuclease-free tip, securely attach it to the pipette, and vertically insert it about 2-3 mm below the template DNA surface. Slowly and steadily press the stopper to the first position, aspirate 1.0 μL of template DNA, check the tip tip to confirm the liquid column is uniform and free of air bubbles, carefully insert the tip tip into the corresponding premixed PCR tube, attaching it to the inside of the tube wall above the liquid surface, and slowly press the stopper to the first position to expel the template DNA liquid. Continue pressing to the second position to completely blow out any remaining liquid in the tip. Hold it on the outer wall of the tube for one second to ensure the liquid is completely removed from the tip tip, then vertically remove the pipette. Discard the currently used tip, replace it with a new tip, and repeat the above operation to add 1.0 μL of the template DNA to the reaction tubes for the remaining 7 mutation sites. Set up a control: Take a reaction tube and label it "positive control"; Take one reaction tube and label it "negative control"; Replace the pipette tip, pipette 1.0 μL of the positive control and add it to the reaction tube labeled as the positive control. Replace the pipette tip again, pipette 1.0 μL of the negative control and add it to the reaction tube labeled as the negative control.

[0044] Mixing and centrifugation: Tightly cap all PCR tubes to prevent evaporation and leakage during subsequent centrifugation and PCR heating. Place all reaction tubes into a mini centrifuge and balance them. Centrifuge at 3000 rpm for 1 minute to thoroughly mix all components and collect them to the bottom of the tube, while removing any air bubbles that may be present in the tube.

[0045] Place it on ice briefly, but not for more than 30 minutes.

[0046] Experimental results: A complete 25 μL reaction system has been prepared, and its final composition and volume are shown below: 10×Buffer 2.5ul Na4PPi 1ul DMSO 2ul dNTP 1ul SYBRGreenⅠ 1ul PAP Primer F 1ul PAP Primer R 1ul KlenTaq-s 0.3ul Template DNA 1ul ddH2O 13.2ul. Example 3

[0047] A reagent storage kit for colorectal cancer detection includes the following steps: PCR amplification is performed using a real-time quantitative PCR amplification instrument. The program is edited as follows: 94℃ for 30 seconds pre-denaturation, 94℃ for 25 seconds, 60℃ for 30 seconds, 64℃ for 30 seconds (fluorescence acquisition), for a total of 40 cycles, followed by 68℃ for 30 seconds and 72℃ for 30 seconds final extension. The total PCR amplification time is 2 hours. After the PCR amplification program is completed, the software will automatically generate an amplification curve and Ct value, and the validity of the experiment will be verified against the quality control standard.

[0048] Reagents: PCR reaction solution with template added (25 μL, containing reaction buffer, dNTPs, SYBR GreenI, KlenTaq-s enzyme and specific PAP probe).

[0049] Equipment: Biorad series real-time quantitative PCR amplification instrument or ABI series real-time quantitative PCR amplification instrument.

[0050] Experimental steps: All specific PAP probes have dideoxy modification at the 3' end. The specific sequences of the specific PAP probes are shown below: Kras G12D-F TGACTGAATATAAACTTGTGGTAGTTGGAGCTG 3-DDA Kras G12D-R AAGGCACTCTTGCCTACGCCA 3-DDT Kras G12C-F ATGACTGAATATAAACTTGTGGTAGTTGGAGCT 3-DDT Kras G12C-R AGGCACTCTTGCCTACGCCAC 3-DDA Kras G13D-F CTGAATATAAACTTGTGGTAGTTGGAGCTGGTG 3-DDA Kras G13D-R GTCAAGGCACTCTTGCCTACG 3-DDT BRAF V600E-F AGTAAAAATAGGTGATTTTGGTCTAGCTACAG 3-DDA BRAF V600E-R GGACCCACTCCATCGAGATTTC 3-DDT Kras Q61H-F TTGGATATTCTCGACACAGCAGGTCA 3-DDC Kras Q61H-R CCTCATTGCACTGTACTCCTC 3-DDG Nras Q61K-F TTGGACATACTGGATACAGCTGGA 3-DDA Nras Q61K-R GTCTCTCATGGCACTGTACTCTTCTT 3-DDT Nras Q61R-F TTGGACATACTGGATACAGCTGGAC 3-DDG Nras Q61R-R GTCTCTCATGGCACTGTACTCTTCT 3-DDC Nras G12D-F TGGTGGTGGTTGGAGCAG 3-DDA Nras G12D-R TGCGCTTTTCCCAACACCA 3-DDT Check the reaction tubes: Confirm that all reaction tubes are tightly capped, the tube walls are clean, the liquid at the bottom of the tubes is concentrated and there are no large air bubbles, and check the arrangement of the reaction tubes on the tube rack to ensure that it is consistent with the experimental design; Start the instrument: Turn on the power of the real-time fluorescence quantitative PCR instrument and the computer, and start the instrument control software (Biorad's CFX Maestro or ABI's QuantStudio Design & Analysis). Create an amplification program: Create a new quantitative PCR (qPCR) experiment in the software, set the reaction volume to 25 μL and select the FAM / SYBR channel as the detection channel; Edit the temperature cycle program: Locate the "Stage" or "Step" editing function in the software interface, and enter the following parameters in sequence; stage Cycle number temperature time Fluorescence Acquisition Pre-variation 1 94℃ 30 seconds Do not collect Amplification Cycle 40 94℃ 25 seconds Do not collect 60℃ 30 seconds Do not collect 64℃ 30 seconds Collect at the end of each step Final extension 1 68℃ 30 seconds Do not collect 72℃ 30 seconds Do not collect Running the amplification program: Open the hot cap of the PCR instrument, place the prepared reaction tubes symmetrically and securely into the sample chambers, confirm the sample layout in the software interface and name the run, then click the "Start Run" or "Run" button. The instrument will automatically lower the hot cap and start the program. The total running time is 2 hours. The instrument operation status and specific PAP probe status are shown below: stage Cycle number temperature time Instrument operating status and specific PAP probe status Pre-variation 1 94℃ 30 seconds Instrument operating status: Performing initial high-temperature denaturation to unwind all double-stranded DNA templates; PAP primers: in standby mode. Deformation 40 94℃ 30 seconds Instrument operation status: Denatures double-stranded DNA product into single strands at the beginning of each cycle; PAP primers: Prepare for the next round of annealing. annealing 40 60℃ 30 seconds Instrument operating status: Temperature reduced to 60℃; PAP primer function: At this temperature, specific PAP primers precisely recognize and preferentially bind to perfectly complementary mutant DNA templates via their 3' ends. Extension / Collection 40 64℃ 30 seconds Instrument operation status: The temperature is raised to 64℃ to start polymerase activity, and the fluorescence signal of SYBRGreen I is collected at the end of this step; PAP primer function: Under the action of KlenTaq-s enzyme, the successfully bound PAP primer starts to extend and synthesize a new DNA strand from other unmodified blocking sites. SYBRGreen I is embedded in the newly synthesized double-stranded DNA and produces fluorescence. After each cycle, the copy number of mutant DNA template approximately doubles, and the fluorescence signal is enhanced accordingly. extend 1 68℃ 30 seconds Instrument operating status: Performing intermediate extensions to ensure the complete synthesis of longer products. Final extension 1 72℃ 30 seconds Instrument operating status: Performing final extension to ensure all PCR products are intact double-stranded. Reaction quality control and data analysis: After the program ends, the software will automatically generate the amplification curve and Ct value; Positive control: A typical S-type amplification curve was observed, and its Ct value was <20, indicating that the reaction system was sensitive, the enzyme activity was normal, and the positive template was successfully amplified; Negative control: A flat line with a Ct value > 38 indicates that the reaction system is uncontaminated and that non-specific amplification such as primer dimers is within acceptable limits.

[0051] Experimental results: Result Interpretation: Positive Interpretation Criteria: If the Ct value of a sample at a certain site is more than 2 smaller than the Ct value of the negative control (i.e., ΔCt>2), then the sample is judged to be positive for mutation at that site (+). Negative determination criteria: If the Ct value of a sample at a certain site does not meet the above conditions (i.e., no amplification, or ΔCt≤2), it is determined to be negative (-). The relative quantitative relationship between the mutation load at this site and the response is as follows: Figure 6 As shown below; Patient ID PAP kit detects cycle number PAP reagent kit test results Next-generation sequencing (NGS) test results C003 27.13 + + C004 32.22 - - C017 26.66 + + C021 34.13 - - C025 23.42 + + C027 27.52 + + C034 25.52 + + C036 24.58 + + Positive control 18.51 + + negative control 34.18 - - Blank control 40.11 - - The test results of this colorectal cancer detection kit are highly consistent with the clinical gold standard next-generation sequencing (NGS). As shown in the table above, the positive and negative results of the PAP method in clinical sample testing are completely consistent with the NGS results, demonstrating the accuracy and reliability of this kit in real-world applications.

[0052] Application examples: KRAS G12D site mutation standard gradient dilution amplification curves are shown below. Figure 7 As shown; To verify the amplification efficiency and detection dynamic range of this kit, a 10-fold serial dilution test was performed using the KRAS G12D mutant standard. Figure 7 As shown, each concentration gradient exhibits a typical S-shaped amplification curve, and the Ct value shows a good linear relationship with the template concentration, demonstrating the stability and reliability of the detection method.

[0053] The amplification curve of the wild-type standard for the KRAS G12D locus is as follows: Figure 8 As shown; The specificity of the reagent kit is crucial. Figure 8 The amplification results using a high concentration of wild-type standard as a template are shown. It can be seen that even at high concentrations, the amplification curve of the wild-type template is no different from that of the negative control (Ct value > 38). This indicates that the PAP primers used in this kit can effectively distinguish between mutant and wild-type sequences, have extremely high specificity, and can effectively avoid false positive results.

[0054] In this invention, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance; the term "multiple" refers to two or more unless otherwise explicitly defined. The terms "installation," "connection," "linking," and "fixing," etc., should be interpreted broadly. For example, "connection" can be a fixed connection, a detachable connection, or an integral connection; "linking" can be a direct connection or an indirect connection through an intermediate medium. Those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0055] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A reagent storage box for colon cancer detection, characterized in that, include: Storage box (1), the top of the storage box (1) is connected to a sealing cover (2), the storage box (1) is provided with a cooling plate (3), the outer wall of the cooling plate (3) is connected to a cooling block (4), the cooling block (4) is surrounded by a conveying pipe (6), the conveying pipe (6) is configured to be laid at the bottom of the cooling plate (3) and surround the side wall of the cooling plate (3), and the cold air flows in the conveying pipe (6) to keep the storage box (1) at a low temperature; The closing mechanism (8) includes an installation tube (801) connected to the bottom of the storage box (1), a connecting tube (802) connected to the bottom end of the installation tube (801), a movable plug (806) slidably connected to the inner wall of the connecting tube (802), and a plurality of through holes (807) opened around the outer wall of the movable plug (806) around the axis. The movable plug (806) is configured to slide relative to the connecting tube (802) to control the opening or closing of the through holes (807).

2. The reagent storage box for colon cancer detection according to claim 1, characterized in that, The outer wall of the cooling block (4) is provided with multiple cooling grooves (5), and one end of the conveying pipe (6) is connected to a cold collector (7). The side wall of the cold collector (7) is provided with multiple grooves along the axis.

3. The reagent storage box for colon cancer detection according to claim 1, characterized in that, The inner wall of the top end of the connecting tube (802) has two limit plates (803). The bottom of the limit plate (803) is connected to a spring (804). One end of the spring (804) is connected to the corresponding position of the top outer wall of the movable plug (806). The top of the movable plug (806) is connected to a contact block (805).

4. A reagent storage box for colon cancer detection according to claim 1, characterized in that, Peripheral blood was collected and plasma was separated using EDTA anticoagulant tubes; Extraction of cell-free DNA (cfDNA) from human peripheral blood; Template DNA was added to pre-prepared pre-reaction solutions containing 8 gene mutation sites, a negative control pre-reaction solution, and a positive control pre-reaction solution to prepare reaction solutions. Place the reaction tube in a real-time quantitative PCR instrument and amplify according to the preset program; After amplification is completed, the amplification cycle number of the positive and negative controls is checked to determine the sample test results.

5. A reagent storage box for colon cancer detection according to claim 4, characterized in that, Peripheral blood was collected from healthy volunteers using EDTA anticoagulant tubes. The peripheral blood was transferred to centrifuge tubes using pipettes. The centrifuge tubes were centrifuged at 1600×g for 10 minutes to separate the plasma. After centrifugation, the upper plasma layer was transferred to a new centrifuge tube using a pipette. During the pipetting process, the leukocyte layer was avoided. The new centrifuge tubes were centrifuged at 1600×g for 10 minutes at 4°C. The supernatant was then frozen and stored at -20°C.

6. A reagent storage box for colon cancer detection according to claim 5, characterized in that, After adding an equal volume of ACB buffer to plasma and vortexing to mix, a cfDNA extraction kit was used to degrade proteins in the plasma using proteinase K. Under specific buffer conditions, cfDNA was selectively bound to the adsorption column. Impurities were removed by washing, and finally, high-purity cfDNA was eluted from the adsorption column using a low-ionic-strength elution buffer to obtain human peripheral blood cell-free DNA (cfDNA).

7. A reagent storage box for colon cancer detection according to claim 6, characterized in that, Remove the colorectal cancer test kit and template DNA from the refrigerator and place them on ice to thaw for 20 minutes. After all components have completely dissolved, place the premixed solution tube from the colorectal cancer test kit on a vortex mixer and vortex at a medium-low speed for 10 seconds to resuspend the precipitate.

8. A reagent storage box for colon cancer detection according to claim 4, characterized in that, The premixed solution tube in the colorectal cancer detection reagent storage kit contains a specific PAP probe for detecting colorectal cancer-related gene mutation sites, PCR buffer, dNTPs, the fluorescent dye SYBR Green I, and KlenTaq-sDNA polymerase. The gene mutation sites are KrasG12D, KrasG12C, KrasG13D, BRAF V600E, KrasQ61H, NrasQ61K, NrasQ61R, and NrasG12D.

9. A reagent storage box for colon cancer detection according to claim 8, characterized in that, Plan the positions of 8 mutation site wells, 1 negative control well and 1 positive control well for each sample on the PCR plate. Add 1 μL of template DNA to the corresponding pre-reaction solution in each PCR reaction tube to obtain the reaction premix. The total volume of the reaction system is 25 μL.

10. A reagent storage box for colon cancer detection according to claim 4, characterized in that, PCR amplification was performed using a real-time quantitative PCR instrument. The program was edited as follows: Pre-denaturation at 94℃ for 30 seconds; 94℃ for 25 seconds, 60℃ for 30 seconds, 64℃ for 30 seconds (fluorescence acquisition), for a total of 40 cycles; The final extension was achieved at 68℃ for 30 seconds and 72℃ for 30 seconds. The total PCR amplification time is 2 hours. After the PCR amplification program is completed, the software will automatically generate the amplification curve and Ct value, and verify the validity of the experiment by comparing it with the quality control standard.

Images