Application of plant pdeZHD protein and its coding gene in regulating poplar height

By studying the plant PdeZHD protein and its encoding gene, and using CRISPR/Cas9 technology for gene editing, significant regulation of poplar plant height and stem node number was achieved, solving the problem of poplar plant height regulation in existing technologies and providing an efficient poplar breeding strategy.

CN121653179BActive Publication Date: 2026-05-29CHENGDU ACAD OF AGRI & FORESTRY SCI
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHENGDU ACAD OF AGRI & FORESTRY SCI
Filing Date
2026-02-06
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Current technologies have not yet identified genes that affect poplar height or corresponding gene regulation methods, making it difficult to efficiently and reliably regulate poplar height and the number of stem nodes.

Method used

By studying the plant PdeZHD protein and its encoding gene, gene editing was performed using CRISPR/Cas9 technology to achieve overexpression or knockdown of the PdeZHD protein, thereby regulating poplar plant height and stem node number. This included designing specific primers for PCR amplification, constructing overexpression and knockdown vectors, and introducing them into poplar tissue culture seedlings for transformation.

Benefits of technology

This study significantly increases or decreases poplar tree height and stem node number, providing an efficient and reliable method for regulating poplar tree height. It also reveals the molecular mechanism regulating tree growth rate, representing a significant theoretical breakthrough and promising application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653179B_ABST
    Figure CN121653179B_ABST
Patent Text Reader

Abstract

The application discloses a plant PdeZHD protein and application of an encoding gene thereof in regulation and control of poplar plant height, and belongs to the technical field of biotechnology.The application constructs transgenic poplar of PdeZHD gene knockout and overexpression, and proves through experiments that the plant height and stem node quantity of the transgenic poplar with reduced PdeZHD gene expression quantity are significantly increased compared with wild type control plants, and the plant height and stem node quantity of the transgenic poplar with PdeZHD overexpression are significantly reduced.The application not only discloses a new function of the PdeZHD gene in woody plants for the first time, but also comprehensively uses two strategies of function acquisition and function loss, confirms that the PdeZHD gene can significantly affect the plant height and stem node quantity of the poplar, and further provides an efficient technical scheme for creating new germplasm of high-yield poplar by targeting growth inhibition circuit silencing.The application has important significance for revealing the regulation and control molecular mechanism of the growth speed of the poplar, improving wood quality, and directionally cultivating the poplar meeting actual production demands.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the plant PdeZHD protein and its encoding gene in regulating the height of poplar trees. Background Technology

[0002] Tree height is a core trait for competing for living space and acquiring sunlight. Greater tree height means an advantage in the competition for forest canopy space, enabling more efficient photosynthesis and thus accumulating more biomass. By enhancing photosynthetic carbon sequestration capacity and biomass carbon storage potential, high-growth-rate trees become efficient carbon sinks, a key natural solution for addressing climate change and promoting green development. Therefore, regulating and increasing tree height is a common need for forestry production and ecological construction.

[0003] Among numerous tree species, poplar (Populus spp.) is widely recognized as a model plant for forest biology research due to its significant advantages: a relatively small and high-quality genome, a mature genetic transformation system, and a short growth cycle and juvenile period. These characteristics make it an ideal material for gene function verification and molecular breeding operations. Key genes and regulatory mechanisms obtained using poplar as a research subject can not only be directly applied to the genetic improvement of poplar itself, but the conserved laws revealed also have important reference and guiding value for research on other woody plants.

[0004] Against this backdrop, in molecular breeding, accurately identifying and manipulating the intrinsic growth-influencing factors of trees is key to fundamentally achieving breakthroughs in growth traits. The invention patent with publication number CN120683165B, entitled "Application of PagLBD162 Gene in Regulating Poplar Tree Type Development," studied gene regulation methods for poplar tree type; however, existing technologies have not yet identified genes affecting poplar tree height or corresponding gene regulation methods.

[0005] Based on this, the present invention specifically studies the genes and proteins that affect poplar tree height and applies them to the transgenic engineering of poplar trees to obtain an efficient and reliable gene regulation method for poplar tree height. Summary of the Invention

[0006] The technical problem to be solved by this invention is to study the relevant genes and proteins that affect the height of poplar trees and to obtain an efficient and reliable gene regulation method for the height of poplar trees.

[0007] To solve the above-mentioned technical problems, the main contents of the present invention are as follows:

[0008] This invention provides the application of plant PdeZHD protein in regulating poplar plant height in any of the following A1)-A4):

[0009] A1) Regulate the height of poplar trees;

[0010] A2) Regulate the number of stem nodes in poplar trees;

[0011] A3) Cultivating transgenic poplar trees with altered plant height and / or number of stem nodes;

[0012] A4) Poplar breeding;

[0013] The regulation is to increase or decrease the height of poplar trees and to increase or decrease the number of poplar stem nodes.

[0014] The amino acid sequence of the PdeZHD protein is shown in SEQ ID NO.2.

[0015] In another preferred embodiment, the plant PdeZHD protein regulates poplar plant height in a negative manner. The application involves reducing the content and / or activity of the PdeZHD protein in poplar to obtain transgenic plants with increased plant height and / or increased number of stem nodes; or the application involves increasing the content and / or activity of the PdeZHD protein in poplar to obtain transgenic plants with decreased plant height and / or decreased number of stem nodes.

[0016] In another preferred embodiment, the substance that enhances the activity of PdeZHD protein may be a protein, polypeptide, or small molecule compound that enhances or promotes the function of PdeZHD protein; the substance that increases the content of PdeZHD protein may be a substance that promotes the synthesis of PdeZHD protein, inhibits the degradation of PdeZHD protein, or overexpresses PdeZHD protein; the substance that reduces the activity of PdeZHD protein may be a protein, polypeptide, or small molecule compound that inhibits the function of PdeZHD protein; the substance that reduces the content of PdeZHD protein may be a substance that inhibits the synthesis of PdeZHD protein, promotes the degradation of PdeZHD protein, or knocks down (reduces) or eliminates the gene encoding PdeZHD protein.

[0017] This invention also provides the application of the gene encoding the plant PdeZHD protein in regulating the height of poplar trees. The plant PdeZHD protein is the protein with the amino acid sequence shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the PdeZHD protein is shown in SEQ ID NO.1. The application is to overexpress the gene encoding the PdeZHD protein in poplar trees to obtain transgenic plants with reduced height and / or reduced number of stem nodes; or the application is to knock down or delete the gene encoding the PdeZHD protein to obtain transgenic plants with increased height and / or increased number of stem nodes.

[0018] In another preferred embodiment, the main steps of overexpressing the PdeZHD protein-encoding gene in poplar include:

[0019] (1) Design amplification primers, and use poplar genomic cDNA as a template for PCR amplification to obtainPdeZHD Gene coding region sequence;

[0020] (2) The above PdeZHD Genes are constructed into plant expression vectors to obtain overexpression vectors;

[0021] (3) Containing the above PdeZHD The gene overexpression vector was transferred into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic positive plants were obtained by identification.

[0022] In another preferred embodiment, knocking down or eliminating the PdeZHD protein-encoding gene involves introducing a substance that inhibits or interferes with the expression of the PdeZHD protein-encoding gene into poplar trees.

[0023] In another preferred embodiment, the substance that knocks down (reduces) the PdeZHD protein-encoding gene can be any substance that can inhibit or interfere with the expression of the PdeZHD protein-encoding gene, such as gRNA (e.g., sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0024] In another preferred embodiment, the substance that inhibits or interferes with the expression of the PdeZHD protein-encoding gene is a miRNA that inhibits or interferes with the expression of the PdeZHD protein-encoding gene.

[0025] In another preferred embodiment, the substance that inhibits or interferes with the expression of the PdeZHD protein-encoding gene is a recombinant vector containing the sequence shown in SEQ ID NO.3.

[0026] In any of the applications or methods described above, the transgenic plant not only includes overexpression PdeZHD Gene or knockdown / removal PdeZHD The first generation of transgenic plants, including their progeny, are obtained by transferring genetic material into poplar trees. For transgenic plants, the gene can be propagated within the species or transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus tissue, whole plants, and cells.

[0027] The beneficial effects of this invention are as follows:

[0028] This invention constructs an overexpression PdeZHD overexpression of transgenic poplar and PdeZHD Genetically modified poplar trees with gene knockdown (reduction). Experiments have shown that, compared to wild-type control plants, PdeZHD Transgenic poplars with gene knockdown (knockout) showed significantly increased plant height and number of stem nodes, while those with overexpression... PdeZHDThe transgenic poplar trees exhibited significantly reduced plant height and stem node number. This invention is of great significance for elucidating the molecular mechanisms regulating tree growth rate, improving timber quality, and for the targeted cultivation of trees that meet actual production needs.

[0029] This invention not only reveals for the first time in woody plants PdeZHD The novel gene function provides a highly efficient technical solution for creating high-yielding poplar germplasm by targeting and silencing growth inhibition circuits. This method avoids the cascading burden of desirable and undesirable traits in traditional breeding, offering a novel molecular breeding strategy and specific gene targets for targeted removal of growth limitations, significantly increasing tree growth rate, and enhancing carbon sequestration capacity. It has significant theoretical breakthrough value and broad application prospects. Attached Figure Description

[0030] Figure 1 The gene knockout transgenic poplar line in Example 4 PdeZHD Gene detection results; among them, WT is wild-type poplar, and ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137 are four different transgenic poplar lines with the gene knockout vector CRISPR / cas9 introduced.

[0031] Figure 2 Wild-type poplar seedlings (WT) grown for one month in Example 3 and PdeZHD Results of overexpression detection of transgenic poplar seedlings ZHD-OE-L21, ZHD-OE-L22 and ZHD-OE-L76.

[0032] Figure 3 The following are phenotypic observations and statistical diagrams of wild-type poplar seedlings and gene knockout transgenic poplar seedlings grown for two months in Example 4. In particular, Figure A shows the phenotypic diagrams of wild-type poplar seedlings (WT) and gene knockout transgenic poplar seedlings ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137.

[0033] Figure B shows the plant height statistics of wild-type poplar seedlings (WT) and gene knockout transgenic poplar seedlings ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137.

[0034] Figure C shows the number of stem nodes of wild-type poplar seedlings (WT) and gene knockout transgenic poplar seedlings ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137.

[0035] Five replicates were counted for each strain. *: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001, ns: no significant difference.

[0036] Figure 4 The figures show the phenotypic observations and statistical graphs of wild-type poplar seedlings and overexpression transgenic poplar seedlings grown for two months in Example 4, where:

[0037] Figure A shows the phenotypic diagrams of wild-type (WT) poplar seedlings and overexpression transgenic poplar seedlings ZHD-OE-L21, ZHD-OE-L22, and ZHD-OE-L76;

[0038] Figure B is a statistical chart of plant heights of wild-type (WT) poplar seedlings and overexpressing transgenic poplar seedlings ZHD-OE-L21, ZHD-OE-L22 and ZHD-OE-L76.

[0039] Figure C shows the number of stem nodes in wild-type (WT) poplar seedlings and overexpressing transgenic poplar seedlings ZHD-OE-L21, ZHD-OE-L22 and ZHD-OE-L76.

[0040] Five replicates were counted for each strain. *: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001, ns: no significant difference. Detailed Implementation

[0041] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0043] The CRISPR / Cas9 vectors in the following examples are described in the literature “Ma X, et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.” Mol Plant 8(8):1274-84.”

[0044] The PGWB2-5×MYC carrier in the following embodiments is a carrier obtained by linking a 5×MYC tag into a PGWB2 carrier.

[0045] The Agrobacterium tumefaciens strain GV3101 in the following examples is described in the literature “Zheng, S., et al. (2020). "Two MADS-box genes regulate vascular cambium activity and secondary growth via modulating auxin homeostasis in Populus." Plant Communications.”

[0046] The wild-type poplar “nanlin895” in the following examples is described in the literature “Zhu, Y., et al. (2018). A HD-ZIP III gene, PtrHB4, is required for interfascicular cambium development in Populus.” Plant Biotechnol J 16(3): 808-817.”

[0047] Example 1: Obtaining the PdeZHD protein and its encoding gene

[0048] 1. Take the whole "nanlin 895" poplar plant that has been growing in a tissue culture bottle for one month, freeze it in liquid nitrogen, grind it and extract total RNA, and reverse transcribe the total RNA to obtain poplar cDNA.

[0049] 2. Primers were designed based on the ZF-HD gene family transcription factor (gene number Potri.002G102900) of Populus tomentosa published on the Phytozome website. Using the obtained Populus cDNA as a template, PCR amplification was performed with 5'-ATGGAGTTTGACGAGCACGA-3' as the forward primer and 5'-GGGTTTCTTACCAAGGGTGT-3' as the reverse primer to obtain the amplified product.

[0050] 3. The amplified product was separated and purified by agarose gel electrophoresis to obtain a DNA fragment of about 800 bp. This PCR product was then ligated into the cloning vector peasy-Blunt simple, and the ligated vector was sequenced.

[0051] Sequencing results showed that in poplar tree “nanlin 895” PdeZHDThe gene coding region sequence is shown in SEQ ID NO.1. The gene shown in SEQ ID NO.1 is named... PdeZHD The amino acid sequence of the PdeZHD protein it encodes is shown in SEQ ID NO.2 in the sequence listing.

[0052] Example 2: Construction of recombinant vector and recombinant Agrobacterium

[0053] I. Construction of Recombinant Gene Knockout Vector and Recombinant Gene Knockout Agrobacterium

[0054] 1. Construction of the recombinant gene knockout vector PGWB2-R

[0055] (1) As shown in SEQ ID NO.1 PdeZHD The gene coding region sequence was used as the target sequence. Primers were designed based on the literature “Ma X, et al. (2015). 'A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8(8):1274-84.'”. The primer sequences are as follows:

[0056] ZHD-T1-F gtcACTAATTGAGTCATAACCCGG

[0057] ZHD-T1-RAAACCCGGGTTATGACTCAATTAG

[0058] ZHD-T2-F gtcACCTTTCCTCCACCACCTGC

[0059] ZHD-T2-RAAACGCAGGTGGTGGAGGAGAAGG

[0060] ZHD-T3-F attGATCGGTGGACACGCACTTGA

[0061] ZHD-T3-R AAACTCAAGTGCGTGTCCACCGAT

[0062] ZHD-T4-F attGTGTGGCGAATTCATGGCCGC

[0063] ZHD-T4-RAAACGCGGCCATGAATTCGCCACA

[0064] Target linker preparation: The synthesized forward and reverse linker primers were dissolved in TE buffer to prepare a 100 μM stock solution. 1 μL of each stock solution was added to 98 μL of 0.5×TE and mixed thoroughly (final concentration 1 μM). The mixture was heated at 90°C for 30 seconds and then allowed to cool naturally to room temperature to form a double-linked head.

[0065] The sgRNA vector was digested with BsaI (intermediate vector), then ligated with an annealing adapter, followed by PCR amplification of the sgRNA expression cassette. Finally, it was assembled into the pYLCRISPR / Cas9 binary vector using a Golden Gate or Gibson Assembly. See the sequencing results of the target site and its vicinity shown in SEQ ID NO.3 in the sequence listing; all four target sequences were successfully ligated into the CRISPR / Cas9 recombinant vector.

[0066] 2. Construction of recombinant Agrobacterium interfering PGWB2-R / GV3101

[0067] The recombinant interference vector PGWB2-R was transformed into Agrobacterium tumefaciens GV3101 using the Agrobacterium-mediated transformation method. After PCR detection, the recombinant interfering Agrobacterium PGWB2-R / GV3101 was obtained.

[0068] II. Construction of Recombinant Overexpression Vector and Recombinant Overexpression Agrobacterium

[0069] 1. Construction of the recombinant overexpression vector p35S::PdeZHD-5×MYC

[0070] The DNA fragment shown in SEQ ID NO.1 of the sequence listing— PdeZHD The CDS sequence (Coding DNA Sequence) was ligated into the pENTR / D-TOPO® vector via homologous recombination to obtain the pENTR / D-TOPO®-ZHD vector; then, the CDS sequence of the pENTR / D-TOPO®-ZHD vector was transferred via LR homologous recombination. PdeZHD The CDS sequence was ligated into the vector PGWB2-5×MYC to obtain the recombinant overexpression vector p35S::PdeZHD-5×MYC.

[0071] 2. Construction of recombinant Agrobacterium p35S::PdeZHD-5×MYC / GV3103 overexpression

[0072] The recombinant overexpression vector p35S::PdeZHD-5×MYC was transformed into Agrobacterium tumefaciens GV3103 using the Agrobacterium transformation method. After PCR detection, recombinant overexpressing Agrobacterium p35S::PdeZHD-5×MYC / GV3103 containing the recombinant overexpression vector p35S::PdeZHD-5×MYC was obtained.

[0073] Example 3: Obtaining and Identifying Transgenic Poplar Trees

[0074] I. Obtaining Genetically Modified Poplar Trees

[0075] The recombinant Agrobacterium obtained in Example 2 was introduced into "nanlin 895" tissue culture poplar seedlings using the leaf disc method, as follows:

[0076] 1. Activation of bacterial culture: Single clone → 5 mL YEB (1 g yeast extract, 5 g tryptone, 5 g beef extract, 5 g sucrose, 1.954 g MgSO4·7H2O, pH 7.0) shake gently for 12 h → transfer 1 mL to a 100 mL bottle and shake at 28 ℃ until OD is reached. 600 ≈0.8, add 100 μmol / L acetylsuccine.

[0077] 2. Prepare leaf trays: Take tender leaves from 1-month-old sterile seedlings, cut off the edges leaving a 1 cm² main vein area, make 3-4 light cuts on the surface, immerse in the above bacterial solution and shake slowly for 30 minutes.

[0078] 3. Co-culture: Transfer the leaves with the underside facing down to the co-culture medium (basal medium + 0.5 mg / L kinetin + 0.75 mg / L 2,4-D + 100 μmol / L acetylsylgenone) and incubate in the dark at 28 ℃ for 2 days.

[0079] 4. Callus induction and screening: Transfer to callus induction medium (basal medium + 0.5 mg / L kinetin + 0.75 mg / L 2,4-D + 50 mg / L Kan + 250 mg / L Carb + 300 mg / L Timentin), and subculture every 14 days under dark conditions until dense spherical callus appears.

[0080] 5. Bud differentiation: Cut callus and transfer it to differentiation medium (basal medium + 0.2 mg / L TDZ + 50 mg / L Kan + 250 mg / L Carb + 300 mg / L Timentin), culture under light, and subculture once every 15 days until bud clusters emerge.

[0081] 6. Rooting and propagation: Isolate healthy shoots and inoculate them into rooting medium (basal medium + 50 mg / L Kan + 250 mg / L Carb + 300 mg / L Timentin). Culture under light until the roots are more than 2 cm long to obtain transgenic plants, which can be further propagated by cutting.

[0082] II. Identification of Genetically Modified Poplar

[0083] 1. Initial screening of positive strains

[0084] DNA was extracted from all seedlings to be tested using the SLS method. Specific primers were designed at both ends of the T-DNA for PCR. DNA from wild-type plants was used as a negative control.

[0085] pGWB2-R vector primers:

[0086] F 5′-GGGGACTCTAGAGTTATCAAC-3′

[0087] R 5′-CTAAGCGCTGTTATCAACCAC-3′

[0088] Agarose gel electrophoresis can be used to confirm the bands and preliminarily identify positive transgenic plants. Positive plants show an 822 bp band.

[0089] 2. Expression level identification and material classification

[0090] PCR-positive plants that had grown for one month were sampled simultaneously with wild-type control plants of the same age. Total RNA was extracted from leaves using the Megan plant RNA miniprep kit, and cDNA was synthesized using the Invitrogen reverse transcription kit (Oligo dT primers). Actin was used as an internal control. PdeZHD Gene-specific primers were used for qRT-PCR to screen transgenic poplar lines exhibiting interference (significantly downregulated expression) and overexpression (significantly upregulated expression) based on changes in expression levels. The primers are as follows:

[0091] PdeZHD-qPCR-F GAGTAGTTCAAAGAAGAGGCATAGG

[0092] PdeZHD-qPCR-RTTAGGGTTTCTTACCAAGGTG

[0093] QpdeActinF:5'-AAACTGTAATGGTCCTCCCTCCG-3'

[0094] QpdeActinR: 5'-GCATCATCACAATCACTCTCCGA-3'.

[0095] Different overexpression transgenic poplar PdeZHD Gene expression level detection results as follows Figure 2 As shown. Compared with wild-type poplar, PdeZHD The most significant upregulation of gene expression levels PdeZHD The transgenic poplar lines PdeZHD-OE-L21, PdeZHD-OE-L22, and PdeZHD-OE-L74, which overexpressed the gene, were used for subsequent research experiments.

[0096] Example 4 PdeZHD Genes significantly influence poplar tree height and stem node number.

[0097] Test material: Wild-type poplar “nanlin895” (WT) PdeZHD Gene knockout transgenic poplar lines ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131, and ZHD-cas9-L137 [[ID= Five plants from each of the three overexpressing transgenic poplar lines ZHD-OE-L21, ZHD-OE-L22, and ZHD-OE-L74 were analyzed. Sequencing results for each line are available in [link to sequencing data]. ​ As shown.

[0098] Experimental method: Terminal buds of four gene knockout transgenic poplar trees and four... ​ The terminal buds of transgenic poplar trees were overexpressed and cultured for one month before being transplanted into nutrient soil for 60 days, with wild-type plants of the same age as controls.

[0099] Statistical phenotypic findings: See ​ As shown, compared with wild-type poplar WT, the height of gene knockout transgenic seedlings was significantly increased. The average height of WT, ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137 lines were 42.70 cm, 53.03 cm, 54.28 cm, 56.40 cm and 55.58 cm, respectively. Compared with WT, the number of stem nodes of gene knockout transgenic seedlings was significantly increased. The average number of stem nodes of WT, ZHD-cas9-L16, ZHD-cas9-L118, ZHD-cas9-L131 and ZHD-cas9-L137 lines were 32, 35, 38, 39 and 39, respectively.

[0100] The experimental results of overexpressing transgenic poplar seedlings are as follows: ​As shown in the figure. Compared with the wild-type plant WT, the overexpression transgenic poplar seedlings had significantly lower plant heights, with the average plant heights of WT, ZHD-OE-L21, ZHD-OE-L22, and ZHD-OE-L74 lines being 45.17 cm, 34 cm, 34.6 cm, and 26.33 cm, respectively. Compared with the wild-type plant WT, the overexpression transgenic poplar seedlings also had significantly fewer stem nodes, with the average number of stem nodes of WT, ZHD-OE-L21, ZHD-OE-L22, and ZHD-OE-L74 lines being 32, 30, 26, and 24, respectively.

[0101] In summary, this invention comprehensively utilizes both gain-of-function and loss-of-function strategies to systematically study the transcription factors of the ZF-HD gene family (Zinc-finger homeodomain, whose core function is to regulate growth, development, and stress response). ​ The function of the gene in the regulation of poplar tree height has been confirmed. ​ Genes can significantly affect the height and number of nodes in poplar trees. First, precise knockout of this gene using CRISPR / Cas9 gene editing technology yielded poplar mutants with significantly increased height and node number. More importantly, overexpression of the gene using an overexpression vector further confirmed that this gene significantly inhibits poplar height growth and reduces node number. Both sides of the genetic evidence consistently and sufficiently demonstrate that this gene is a key endogenous repressor regulating poplar height; regulating or knocking out this gene can effectively control poplar height.

[0102] This invention, through the ​ Gene overexpression regulation significantly suppressed / reduced the height of transgenic poplar trees; by knocking down / knockout... ​ The gene significantly increased the height of transgenic poplar trees. Therefore, this invention confirms that the PdeZHD protein and its encoding gene can be effectively applied to the regulation of poplar tree height.

[0103] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of plant PdeZHD protein in regulating poplar in any of the following (A1)-A4): A1) Regulate the height of poplar trees; A2) Regulate the number of stem nodes in poplar trees; A3) Cultivating transgenic poplar trees with altered plant height and / or number of stem nodes; The amino acid sequence of the PdeZHD protein is shown in SEQ ID NO.

2.

2. The application of the plant PdeZHD protein according to claim 1 in regulating poplar trees, characterized in that, The regulation method is negative regulation, and the application is to reduce the content and / or activity of the PdeZHD protein in poplar to obtain transgenic plants with increased plant height and / or increased number of stem nodes; or the application is to increase the content and / or activity of the PdeZHD protein in poplar to obtain transgenic plants with decreased plant height and / or decreased number of stem nodes.

3. The application of the gene encoding the plant PdeZHD protein in regulating poplar, characterized by, The plant PdeZHD protein is the protein with the amino acid sequence shown in SEQ ID NO.2 as described in claim 1, and the nucleotide sequence of the PdeZHD protein encoding gene is shown in SEQ ID NO.

1. The application is to overexpress the PdeZHD protein encoding gene in poplar to obtain transgenic plants with reduced plant height and / or reduced number of stem nodes; or the application is to knock down or delete the PdeZHD protein encoding gene to obtain transgenic plants with increased plant height and / or increased number of stem nodes.

4. The application of the gene encoding the plant PdeZHD protein according to claim 3 in regulating poplar, characterized in that, The main steps for overexpressing the PdeZHD protein-encoding gene in poplar include: (1) Design amplification primers, and use poplar genomic cDNA as a template for PCR amplification to obtain PdeZHD Gene coding region sequence; (2) The above PdeZHD Genes are constructed into plant expression vectors to obtain overexpression vectors; (3) Containing the above PdeZHD The gene overexpression vector was transferred into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic positive plants were obtained by identification.

5. The application of the gene encoding the plant PdeZHD protein according to claim 3 in the regulation of poplar trees, characterized in that, The knockdown or knockout of the PdeZHD protein-encoding gene involves introducing a substance that inhibits or interferes with the expression of the PdeZHD protein-encoding gene into poplar trees.

6. The application of the gene encoding the plant PdeZHD protein according to claim 5 in the regulation of poplar trees, characterized in that, The substance that inhibits or interferes with the expression of the PdeZHD protein-encoding gene is a recombinant vector containing the sequence shown in SEQ ID NO.3.