A recombinant turkey herpesvirus, its preparation method and use in avian leukosis vaccine

CN121674351BActive Publication Date: 2026-09-11SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511833459.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-09-11
Estimated Expiration
2045-12-08

AI Technical Summary

Technical Problem

该发明的免疫方案目前仅适用于1周龄以上鸡只的免疫,尚无法为1日龄雏鸡提供有效保护

Benefits of technology

[0023] This invention uses turkey herpesvirus (HVT) as a vector and integrates six B-cell epitopes reported in the literature and six ALV-J specific T-cell epitopes (CN115991733A, CN114349829A and CN117143206A) that have been granted patents in our laboratory to construct a recombinant HVT multi-epitope vaccine rHVT-BNT.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674351B_ABST
    Figure CN121674351B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses a recombinant turkey herpes virus, wherein a tandem epitope expression cassette is inserted between UL45 and UL46 of the recombinant turkey herpes virus; the tandem epitope expression cassette is used for expressing multiple B cell epitopes and multiple T cell epitopes. The recombinant turkey herpes virus inserts the tandem epitope into a HVT (turkey herpes virus) carrier, and experiment verification shows that single immunization of the multi-epitope recombinant HVT vaccine can induce a good cellular immune response in 1-day-old chicks and 18-day-old chicken embryos, and compared with inactivated vaccines which need to be immunized twice, can provide earlier and better challenge protection effects. Meanwhile, it is verified that the recombinant turkey herpes virus can be vaccinated in ovo, and can produce obvious immune protection effects. Meanwhile, the application also provides a preparation method and purposes of the recombinant turkey herpes virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant turkey herpesvirus, its preparation method, and its application. Background Technology

[0002] Avian leukosis (AL) is a tumorigenic infectious disease of poultry caused by avian leukosis virus (ALV), which can be transmitted both horizontally and vertically. Among the various ALV subgroups, Avian leukosis virus subgroup J (ALV-J) is the most pathogenic, inducing myeloma-type avian leukosis, myeloblastic avian leukosis, and angiomatous avian leukosis. Clinically, AL causes decreased productivity, reduced egg production, and stunted growth in affected flocks. It can also lead to immunosuppression in infected chickens, increasing the risk of co-infection and vaccination failure, causing severe economic losses to the poultry industry. To date, there are no effective drugs or commercially available vaccines to prevent ALV-J infection.

[0003] Currently, there is limited development of ALV-J vaccines, with most research focusing on using viral env proteins as immunogens to construct subunit vaccines or recombinant viral vaccines. However, ALV-J env proteins are highly variable, making them unsuitable as immunogens against ALV-J variants. Furthermore, these studies primarily focus on inducing humoral immunity while neglecting cellular immunity.

[0004] Preliminary research in this project indicates that cellular immunity, especially CD8... + T cells play a crucial role in clearing ALV-J. Therefore, developing vaccines that can induce cellular immunity is a key focus in ALV-J vaccine development.

[0005] Based on this strategy, the applicant previously developed an ALV-J multi-epitope recombinant baculovirus (CN118460620A), which contains four CD8 sequences obtained by the research group in previous screening. +T-cell epitopes (CN115991733A and CN114349829A), three of which were found to be highly conserved among different ALV-J strains, and also conserved in ALV-A, ALV-B, and ALV-E. Two immunizations of chickens using this recombinant baculovirus achieved a 66.7% protection rate against ALV-J. This invention demonstrates the feasibility of constructing multi-epitope recombinant viruses for the control of ALV-J. Currently, the immunization regimen described in this invention is only applicable to chickens older than one week old and cannot provide effective protection for one-day-old chicks. However, research has found that one-day-old SPF chickens infected with ALV-J are more likely to develop immune tolerance, and infected chickens continue to carry and shed the virus without producing antibodies, indicating that controlling vertical transmission and initial post-hatching transmission is crucial for preventing and controlling the spread of ALV-J within chicken flocks.

[0006] Therefore, how to advance the age of immunization against ALV-J is the research focus of this invention. Summary of the Invention

[0007] One objective of this invention is to provide a recombinant turkey herpesvirus, which incorporates tandem epitopes into an HVT (turkey herpesvirus) vector to construct an ALV-J multi-epitope recombinant turkey herpesvirus. This invention advances the immunization age to 1-day-old chicks or 18-day-old embryos and systematically evaluates the immunogenicity and protective efficacy of the ALV-J multi-epitope recombinant turkey herpesvirus in chick immunization and intraembryonic immunization, providing a theoretical basis for developing an effective ALV-J vaccine applicable to 1-day-old chicks and intraembryonic immunization.

[0008] In addition, the present invention also provides a method for preparing the above-mentioned recombinant turkey herpesvirus and its uses.

[0009] To achieve the above objectives, the present invention provides a recombinant turkey herpesvirus, wherein a tandem epitope expression cassette is inserted between UL45 and UL46 of the recombinant turkey herpesvirus; the tandem epitope expression cassette is used to express multiple B cell epitopes and multiple T cell epitopes;

[0010] The amino acid sequences of the B-cell epitopes are shown in SEQ ID NO.1 to SEQ ID NO.6;

[0011] The amino acid sequences of the T cell epitopes are shown in SEQ ID NO.7 to SEQ ID NO.12.

[0012] In the above-mentioned recombinant turkey herpesvirus, the amino acid sequence of the tandem epitope expression cassette is shown in SEQ ID NO. 13.

[0013] Meanwhile, this invention also discloses a method for preparing the recombinant turkey herpesvirus as described above, comprising the following steps:

[0014] Step 1: Insert the tandem epitope expression cassette into the first vector to obtain the first plasmid;

[0015] Step 2: Using the genome of turkey herpesvirus as a template, amplify the homologous arm fragment that matches the insertion site of recombinant turkey herpesvirus; amplify the fragment of the tandem epitope expression cassette from the first plasmid;

[0016] Step 3: Clone the homologous arm fragment and the fragment of the tandem epitope expression cassette into the second plasmid to obtain the transfection donor plasmid;

[0017] Step 4: Transfect recipient cells with the donor plasmid, infect them with turkey herpesvirus, and after rescue and sorting purification, remove the GFP expression cassette using the Cre / loxP system to obtain the recombinant turkey herpesvirus.

[0018] In the above preparation method, the first vector is plasmid pcDNA3.1-ALV-J BNT; the second plasmid is plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46.

[0019] In the above preparation method, the base sequence of the homologous arm fragment is shown in SEQ ID NO.14 and SEQ ID NO.15.

[0020] In addition, the present invention also discloses the use of recombinant turkey herpesvirus as described above to prepare avian leukosis vaccine.

[0021] Finally, the present invention also discloses an avian leukosis vaccine comprising the recombinant turkey herpesvirus as described above.

[0022] Compared with the prior art, the present invention has at least the following advantages:

[0023] This invention uses turkey herpesvirus (HVT) as a vector and integrates six B-cell epitopes reported in the literature and six ALV-J specific T-cell epitopes (CN115991733A, CN114349829A and CN117143206A) that have been granted patents in our laboratory to construct a recombinant HVT multi-epitope vaccine rHVT-BNT.

[0024] In vitro experiments confirmed that its replication ability was consistent with that of the parent strain, and indirect immunofluorescence verified that the multi-epitope protein remained stably expressed after 20 passages. To evaluate the immunogenicity of the vaccine and the effectiveness of different immunization routes, this invention used two methods of rHVT-BNT vaccination: subcutaneous injection in 1-day-old SPF chickens and intraembryonic immunization in 18-day-old SPF chicken embryos. Simultaneously, a control was established by subcutaneous injection of whole-virus inactivated vaccine (InV) into 1-day-old SPF chickens followed by a booster immunization 14 days post-immunization. The humoral immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting ALV-J specific antibodies in serum, the proportion of B cells in PBMCs, and the levels of IgM, IgY, and IgA in serum on day 28 post-immunization. The cellular immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting the proportion of T cells in PBMCs, detecting the expression of immune-related factors by RT-qPCR, and detecting IFN-γ secretion by chicken spleen lymphocytes using ELISApot. Twenty-eight days after vaccination, the experimental animals were challenged with ALV-J via intraperitoneal injection at a viral dose of 1 mL of 10 4 TCID 50 Chicken viremia was assessed using 100 μL ALV-J (CHN06 strain) at days post-infection (DPI) of 7, 14, 21, and 28 to evaluate the protective effect against challenge after rHVT-BNT chick immunization and intraembryonic immunization. Attached Figure Description

[0025] The present invention will be further described below with reference to the accompanying drawings and embodiments;

[0026] Figure 1A This is a schematic diagram illustrating the construction of a series tabletop;

[0027] Figure 1B This is a patch image of the recombinant virus rHVT-GFP-BNT;

[0028] Figure 1C Electrophoresis image of the purified recombinant virus rHVT-GFP-BNT;

[0029] Figure 1D The GFP expression diagrams of purified recombinant viruses rHVT-BNT, rHVT-GFP-BNT, and WT-HVT wild-type viruses without GFP expression cassettes are shown.

[0030] Figure 1E IFA identification results for WT-HVT wild-type virus and recombinant virus rHVT-BNT;

[0031] Figure 1F Western blotting results for identification of WT-HVT wild-type virus and recombinant virus rHVT-BNT;

[0032] Figure 1G Map of donor plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46;

[0033] Figure 2A Figure showing the results of genetic stability identification of recombinant virus rHVT-BNT;

[0034] Figure 2B The results of the in vitro replication kinetics of the recombinant virus rHVT-BNT are shown in the figure.

[0035] Figure 3A Diagram of T cell gating strategy;

[0036] Figure 3B Diagram of B cell gating strategies;

[0037] Figure 4A The results are from the detection of ALV-J specific antibodies in serum;

[0038] Figure 4B A graph showing the proportion of B cells in PBMCs;

[0039] Figure 4C The image shows the results of the detection of IgM antibody content in chicken serum.

[0040] Figure 4D The image shows the results of the detection of IgY antibody content in chicken serum.

[0041] Figure 4E The image shows the results of the detection of IgA antibody content in chicken serum.

[0042] Figure 5A CD4 + T cell percentage chart;

[0043] Figure 5B CD8α + T cell percentage chart;

[0044] Figure 5C CD4 + CD8α + T cell percentage chart;

[0045] Figure 5D This is a graph showing the expression levels of genes related to inflammation and chemokines.

[0046] Figure 5E A graph showing the expression levels of genes related to CTLs;

[0047] Figure 5F This is a graph showing the expression levels of genes related to innate immunity.

[0048] Figure 5GThis is a graph showing the expression levels of Th2-related genes.

[0049] Figure 6A A graph showing the secretion levels of different epitopes in the rHVT-BNT group;

[0050] Figure 6B A graph showing the secretion levels of different epitopes in the rHVT-BNT-in ovo group;

[0051] Figure 6C A graph showing the secretion levels of different epitopes in the InV group;

[0052] Figure 6D This is a graph showing the secretion levels of different epitopes in the WT-HVT group. Detailed Implementation

[0053] The present invention will be further described below with reference to embodiments, but this does not constitute any limitation on the present invention. Any limited modifications made within the scope of the claims of the present invention are still within the scope of the claims of the present invention.

[0054] Terminology Explanation:

[0055] ALV-J: Avian leukosis virus subgroup J; CEF: Chicken embryo fibroblasts; DPI: Days post-challenge; DPV: Days post-immunization; FBS: Fetal bovine serum; HVT: Turkey herpesvirus; IgA: Immunoglobulin A; IgY: Immunoglobulin Y; IgM: Immunoglobulin M; PBMC: Peripheral blood mononuclear cells; PFU: Plaque-forming units; SPF: Specific pathogen-free; TCID 50 : Half of the infection rate in the organization.

[0056] Solution Summary

[0057] This invention uses turkey herpesvirus (HVT) as a vector and integrates six B-cell epitopes reported in the literature and six ALV-J specific T-cell epitopes (CN115991733A, CN114349829A and CN117143206A) that have been granted patents in our laboratory to construct a recombinant HVT multi-epitope vaccine rHVT-BNT.

[0058] In vitro experiments confirmed that its replication ability was consistent with that of the parent strain, and indirect immunofluorescence verified that the multi-epitope protein remained stably expressed after 20 passages. To evaluate the immunogenicity of the vaccine and the effectiveness of different immunization routes, this invention used two methods of rHVT-BNT vaccination: subcutaneous injection in 1-day-old SPF chickens and intraembryonic immunization in 18-day-old SPF chicken embryos. Simultaneously, a control was established by subcutaneous injection of whole-virus inactivated vaccine (InV) into 1-day-old SPF chickens followed by a booster immunization 14 days post-immunization. The humoral immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting ALV-J specific antibodies in serum, the proportion of B cells in PBMCs, and the levels of IgM, IgY, and IgA in serum on day 28 post-immunization. The cellular immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting the proportion of T cells in PBMCs, detecting the expression of immune-related factors by RT-qPCR, and detecting IFN-γ secretion by chicken spleen lymphocytes using ELISApot. Twenty-eight days after vaccination, the experimental animals were challenged with ALV-J via intraperitoneal injection at a viral dose of 1 mL of 10 4 TCID 50 / 100 μL ALV-J (CHN06 strain), at days post-infection (DPI) of 7, 14, 21 and 28, avian viremia, cloacal viral shedding, and the ratio of T and B cells in PBMCs were measured to evaluate the protective effect of rHVT-BNT chicks after immunization and intraembryonic immunization.

[0059] Example 1: Preparation and Identification of Recombinant Turkey Herpesvirus

[0060] 1. Experimental Materials

[0061] 1.1 Viruses, plasmids, cells, vaccines, and laboratory animals

[0062] ALV-J CHN06 strain (Genbank: HQ900844), HVT Fc126 strain (Genbank: AF291866), pcDNA-LoxN-GFP plasmid, and Cre recombinase expression plasmid were preserved by the National-Local Joint Engineering Laboratory for Zoonotic Disease Prevention and Control Preparations of South China Agricultural University. DH5α competent cells were purchased from Nanjing Novizan Technology Co., Ltd. 1-day-old specific pathogen-free (SPF) chickens and 9-10 gestational age SPF chicken embryos were purchased from Guangdong Xinxing Dahua Agricultural Poultry and Egg Co., Ltd.

[0063] 1.2 Main Reagents

[0064] DNA and RNA extraction kits were purchased from Nanjing Novizan Biotechnology Co., Ltd.; NheI, PspXI, and SfiI restriction endonucleases were purchased from New England Biolabs, USA; Plasmid Mini Kit II and Endo-free Plasmid Mini Kit II were purchased from Omega Bio-Tek, USA; RPMI-1640 medium and fetal bovine serum were purchased from Thermo Fisher Scientific; Mouse Anti-Chicken CD3-APC, CD4-FITC, and BU1-FITC flow cytometry antibodies were purchased from Southern Biotech; Chicken IFN-γ ELISA kits were purchased from Southern Biotech. BASIC Kit was purchased from Mabtech; PMA+Ionomycin was purchased from Dakowei Biotechnology Co., Ltd.; SYRBR Green Premix Pro Taq HSqPCR Kit (ROX Plus) and M-MLV RT Master Mix were purchased from Hunan Aikerui Biotechnology Co., Ltd.; Chicken peripheral blood lymphocyte isolation kit, chicken spleen lymphocyte isolation kit, and erythrocyte lysis buffer were purchased from Tianjin Haoyang Biological Products Technology Co., Ltd.; Chicken immunoglobulin M (IgM) detection kit, chicken immunoglobulin Y (IgY) detection kit, and chicken immunoglobulin A (IgA) detection kit were purchased from Quanzhou Ruixin Biotechnology Co., Ltd.

[0065] 1.3 Preparation of main reagents

[0066] LB solid culture medium: Dissolve LB solid culture medium powder in deionized water, autoclave, and store at room temperature.

[0067] LB liquid medium: Dissolve LB liquid medium powder in deionized water, autoclave, and store at room temperature.

[0068] Ampicillin (Amp): Prepare a solution of 100 mg / mL with sterile deionized water, filter through a 0.22 µm filter membrane, dispense, and store at -20°C.

[0069] M199 cell culture medium: Dissolve M199 culture medium powder in a measured amount of sterile deionized water, stir gently until completely dissolved, filter sterilize through a 0.22 µm filter membrane, dispense, and store at 4℃.

[0070] M199 complete culture medium: Add 45 mL of cell culture medium, 5 mL of inactivated FBS and 500 μL of penicillin-streptomycin (100x) to a 50 mL centrifuge tube, mix well and set aside at 4°C.

[0071] Flow cytometry buffer: Take 49 mL of sterile PBS and place it in a 50 mL centrifuge tube. Add 1 mL of inactivated fetal bovine serum, mix thoroughly, and store at 4°C.

[0072] Cell cryopreservation solution: Add 35 mL of complete culture medium, 10 mL of inactivated FBS, and 5 mL of DMSO to a 50 mL centrifuge tube, mix well, and store at 4℃.

[0073] 2. Experimental Methods

[0074] 2.1 Primer Design and Synthesis

[0075] Based on the sequences of HVT FC-126 strain (GenBank sequence number AF282130), pcDNA3.1-LoxN-GFP plasmid, and pcDNA3.1-ALV-J BNT plasmid, eight PCR amplification primers as shown in Table 1 were designed. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0076] Table 1 Primer Information

[0077] UL45-F GGGAGACCCAAGCTGGCTAGCCTGGACTAGTCCTACACCCGTG UL45-R GCTGGATGTTTAAACGCTAGCTAGAGGTGCGTTTTTATTTACTCATCG UL-46-F AATTTAAATGTGGCGGCCGCACGGTTACTGTGTTTTATTTATC UL46-R TTTAAACGGGCCCTCTAGACATACTCAGAATTGGACACTTTAG BNT-F ACCTTATACGAAGTTATGGCCATAATGGCCGACATTGATTATTGACTAGTTATTAATAGT BNT-R TTAAATTATAGGAGACGGGCCGCCTAGGCCGATCCAGACATGATAAGATACATTGATGAG rHVT-F TACCGTTATATGTCAGCGACCCA rHVT-R CTCCGACAACCAAATACTTTCATGA

[0078] 2.2 Design and Synthesis of Multiepitope Expression Cascades

[0079] In this embodiment, six T-cell epitopes (CN115991733A, CN114349829A and CN117143206A) previously screened by the applicant were tandemly linked with six published B-cell epitopes via flexible adapters (GGGGS) and repeated multiple times to construct the multi-epitope expression cassette ALV-J BNT.

[0080] To facilitate subsequent expression validation, a His tag was introduced into the expression cassette. Furthermore, a CMV promoter was introduced upstream, and a bGH poly(A) signal was added downstream to ensure mRNA stability. The gene sequence of the expression cassette was synthesized by Universal Biotech (Anhui) Co., Ltd., and the synthesized sequence was inserted into the pcDNA3.1 plasmid, resulting in the plasmid pcDNA3.1-ALV-J BNT.

[0081] Schematic diagram after construction (reference) Figure 1A ;exist Figure 1A Table 2 shows the epitope information of B cells and T cells in the middle.

[0082] Table 2 Epitope Sequences

[0083] <![CDATA[Gp85 81-92 ]]> LPWDPQELDILG Gp85 B (81-92) SEQ ID NO.1 <![CDATA[Gp85 137-158 ]]> LRDFIAKWKSDDLLIRPYVNQS Gp85 B (137-158) SEQ ID NO.2 <![CDATA[Gp85 137-158 ]]> LRDFITKWKGDDHLIRPYVNQS Gp85 B (137-158) SEQ ID NO.3 <![CDATA[Gp85 137-158 ]]> LRDFIEKWKGDDHLIRPYVNQS Gp85 B (137-158) SEQ ID NO.4 <![CDATA[Gp85 137-158 ]]> LRDFIEKWKSDDHLIRPYVNQS Gp85 B (137-158) SEQ ID NO.5 <![CDATA[Gp85 134-142 ]]> AEAELRDFI Gp85 B (134-142) SEQ ID NO.6 <![CDATA[Pol 652-660 ]]> TVDTASSAI Pol T (652-660) SEQ ID NO.7 <![CDATA[Gag 374-382 ]]> FVDFANRLI Gag T (374-382) SEQ ID NO.8 <![CDATA[Gag 403-411 ]]> SALQAFREV Gag T (403-411) SEQ ID NO.9 <![CDATA[Pol 270-280 ]]> PRLMGPFYEQL Pol T (270-280) SEQ ID NO.10 <![CDATA[Gag 343-352 ]]> DRLKGLADGM Gag T (343-352) SEQ ID NO.11 <![CDATA[Gag 531-541 ]]> SRERCQLCDGM Gag T (531-541) SEQ ID NO.12

[0084] 2.3 Construction of recombinant plasmid pcDNA3.1-LoxN-GFP-LARA-AIV BNT

[0085] Using the HVT genome as a template, the left and right homologous arms of HVT were obtained using primers UL45-F / R or UL46-F / R, respectively. Using pcDNA3.1-ALV-J BNT as a template, the ALV-J BNT fragment was obtained using primer BNT-F / R. The three fragments were then cloned into the pcDNA3.1-LoxN-GFP plasmid to obtain the donor plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46.

[0086] The amino acid sequence of the ALV-J BNT expression cassette is shown in SEQ ID NO.13;

[0087] The sequence of the left homologous arm is shown in SEQ ID NO.14;

[0088] The sequence of the right homologous arm is shown in SEQ ID NO.15;

[0089] Reference image of donor plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46 Figure 1G .

[0090] 2.4 Obtaining and purifying multi-epitope recombinant turkey herpesvirus rHVT-BNT

[0091] Transfect donor plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46 into CEF cells.

[0092] Twelve h after transfection, HVT virus was inoculated into transfection wells at a multiplicity of infection (MOI) of 0.02. The wells were then incubated at 37°C in a 5% CO2 incubator. After 48 h of virus culture, single viral plaques exhibiting green fluorescence were selected and inoculated into 24-well cell culture plates pre-coated with a CEF cell monolayer. The recombinant virus rHVT-GFP-BNT was then purified by flow cytometry sorting. rHVT-GFP-BNT was identified by PCR using specific primers rHVT-F / R.

[0093] Plaques of recombinant virus rHVT-GFP-BNT such as Figure 1B As shown;

[0094] rHVT-GFP-BNT was purified using flow cytometry sorting, and the results are as follows: Figure 1CAs shown, compared with WT-HVT wild-type virus (361 bp), the recombinant viral DNA in lanes 1, 4, 6, and 14 contained a single specific target band at 5327 bp (consistent with the recombinant plasmid band in lane 16 as a positive control), which was verified by sequencing to be the ALV-J BNT multi-epitope expression cassette sequence.

[0095] The Cre plasmid was transfected, and 24 h after transfection, the purified rHVT-GFP-BNT virus was inoculated into transfection wells at an MOI of 0.02. Single viral plaques that did not express green fluorescence were selected and transferred to 24-well cell culture plates coated with a CEF cell monolayer for amplification. Through successive rounds of plaque purification and screening, until all viral plaques did not show green fluorescence, the fully purified recombinant virus rHVT-BNT was finally obtained. rHVT-BNT was identified by PCR using specific primers rHVT-F / R.

[0096] After removing the GFP expression cassette from rHVT-GFP-BNT using the Cre / Loxp system, the results are as follows: Figure 1D As shown, compared with rHVT-GFP-BNT (5327 bp) and WT-HVT wild virus (361 bp), rHVT-BNT only showed the target band at around 2895 bp, indicating that the multi-epitope protein was inserted correctly and the GFP gene expression cassette was successfully knocked out, resulting in the purification of the recombinant virus rHVT-BNT without the GFP expression cassette.

[0097] 2.5 Identification of rHVT-BNT

[0098] To detect the expression of multiple epitope proteins (BNT proteins) in recombinant virus rHVT-BNT, indirect immunofluorescence and Western blotting were performed.

[0099] 2.5.1 Indirect immunofluorescence identification

[0100] The testing method was as follows: Cells were fixed with 500 μL of 4% paraformaldehyde at room temperature for 30 min; after fixation, they were washed three times with PBS and permeabilized with 500 μL of 0.25% Triton X-100 at room temperature for 30 min; then washed three times with PBS and blocked with 500 μL of 5% BSA-PBST at room temperature for 1 h. After blocking, cells were washed three times with PBST and incubated with 500 μL of 1:500 diluted mouse 6×His monoclonal antibody at room temperature for 1 h; the primary antibody was discarded, cells were washed three times with PBST, and then incubated with 1:500 diluted goat anti-mouse IgG1 Alexa Fluor. TM 568 500 μL, incubate at room temperature in the dark for 1 h. Finally, discard the secondary antibody, wash 3 times with PBST, and then photograph and store under an inverted fluorescence microscope.

[0101] 2.5.2 Western Blot Identification

[0102] Recombinant viruses rHVT-BNT and wild-type HVT were inoculated into 6-well cell culture plates pre-grown with CEF monolayers and cultured at 37°C and 5% CO2 for 48 h. Western blotting was then performed as follows: Cell supernatant was discarded, and 200 μL of RIPA lysis buffer containing protease inhibitors was added to each well for 15 min of lysis. The supernatant was then collected by centrifugation, and 5×SDS loading buffer was added and boiled for 10 min. Appropriate amounts of protein marker and sample were added sequentially to the sample wells. Electrophoresis was stopped once the protein bands reached the appropriate positions, and the protein was transferred to a PVDF membrane. Blocking was performed at room temperature for 1 h using blocking buffer. The membrane was washed three times with TBST for 5 min each time, followed by incubation at 4°C overnight with mouse 6×His monoclonal antibody. The membrane was washed three times with TBST for 5 min each time, followed by incubation at room temperature in the dark with HRP-labeled goat anti-mouse secondary antibody for 1 h. After three TBST washes, the membrane was treated with HRP chromogenic buffer in the dark before observation using an infrared imaging system.

[0103] The test results are as follows: Figure 1E As shown, only specific green fluorescence against HVT virus was observed in the WT-HVT wild-type virus infection wells; while in the recombinant virus rHVT-BNT infection wells, both green fluorescence against HVT virus and specific red fluorescence against the multi-epitope protein were detected simultaneously, and the two fluorescence signals were co-localized (merged). These results indicate that the recombinant virus rHVT-BNT can successfully express the multi-epitope protein; Figure 1F As shown, no specific protein bands were detected in the CEF cell pellet infected with WT-HVT wild-type virus, while a clear protein band of approximately 52.5 kDa was visible in the CEF cell pellet infected with recombinant virus rHVT-BNT.

[0104] 2.6 Identification of the genetic stability of recombinant virus rHVT-BNT

[0105] To test the genetic stability of the recombinant virus rHVT-BNT, rHVT-BNT was passaged 20 times consecutively, and the target band was detected by PCR every 5 generations.

[0106] The testing method was as follows: rHVT-BNT recombinant virus was inoculated into CEF cells and continuously passaged to the 20th generation (P15). During passage, viral genomes were extracted every 5 generations (i.e., P5, P10, P15, P20). Using the extracted genomic DNA as a template, PCR amplification was performed using specific primers rHVT-F / R. The genetic stability of the exogenous gene fragment in the recombinant viral genome was assessed by agarose gel electrophoresis and sequencing analysis.

[0107] The test results are as follows: Figure 2A As shown, the recombinant virus rHVT-BNT amplified the target band of approximately 2895 bp in generations 5, 10, 15, and 20, which is consistent with the expected size of the inserted multi-epitope expression cassette. These results indicate that the recombinant virus rHVT-BNT can still stably integrate into the HVT genome after 20 generations of in vitro passages, demonstrating the good genetic stability of this recombinant virus.

[0108] 2.7 In vitro replication kinetics of recombinant virus rHVT-BNT

[0109] To detect rHVT-BNT growth, viral titers were measured at 24h, 48h, 72h, 96h, and 120h post-infection.

[0110] The test method was as follows: To compare the proliferation characteristics of the parent HVT virus (FC126 strain) and the recombinant virus rHVT-BNT, 100 PFU of virus were inoculated into 6-well plates coated with CEF monolayer and cultured at 37℃ and 5% CO2. Infected cells were collected at five time points: 24h, 48h, 72h, 96h, and 120h post-infection using trypsin digestion. The virus titer was determined as follows: the collected cell suspension was diluted to 1 mL with DMEM medium, and 10 μL of the solution was used to determine the viral titer. -2 and 10 -3 Two dilutions of CEF cells were seeded, and plaque detection was performed after 4 days of culture.

[0111] The test results are as follows: Figure 2B As shown, the proliferation characteristics of the parental WT-HVT virus (HVT FC126 strain) and the recombinant virus rHVT-BNT were compared. The results showed that there was no significant difference in viral titer between the two at each time point (P>0.05), indicating that the insertion of the multi-epitope expression cassette had no effect on the growth and replication of the recombinant virus.

[0112] Example 2 Immunogenicity analysis of recombinant turkey herpesvirus

[0113] 2.1 Animal experimental grouping and immunization procedures

[0114] This embodiment is divided into 5 groups, with 15 1-day-old SPF chickens or 15 18-day-old SPF embryos in each group.

[0115] The groups were: subcutaneous immunization group of recombinant HVT multiepitope vaccine (rHVT-BNT), intraembryonic immunization group of recombinant HVT multiepitope vaccine (rHVT-BNT-in ovo), HVT empty vector group (WT-HVT), inactivated vaccine group (InV), and control group (M199 medium).

[0116] The immunization schedule is as follows: The subcutaneous immunization group with recombinant HVT multi-epitope vaccine received a subcutaneous injection of 0.2 mL (2.5 x 10) on day 1. 4 Recombinant HVT multi-epitope vaccine (rHVT-BNT) with PFU / mL; the intraembryonic immunization group of the recombinant HVT multi-epitope vaccine was injected intraamnioticly into the amnion of 18-year-old chicken embryos with 0.2 mL (2.5 x 10) PFU / mL. 4 PFU / mL) recombinant HVT multi-epitope vaccine (rHVT-BNT); HVT empty vector group was administered 0.2 mL (2.5 x 10) subcutaneously at 1 day of age. 4 The group receiving the ALV-J whole virus inactivated vaccine (InV) was administered 0.2 mL subcutaneously on day 1 and received a second immunization 14 days later. The control group was administered 0.2 mL subcutaneously on day 1. Detailed groupings for this experiment are shown in Table 3.

[0117] Table 3 Animal experimental grouping and immunization schedule

[0118] rHVT-BNT 15 subcutaneous injection <![CDATA[0.2 mL(2.5ⅹ10 4 PFU / mL) Recombinant HVT Multiepitope Vaccine (rHVT-BNT) / rHVT-BNT-in ovo 15 Intraembryonic injection (amniotic cavity) <![CDATA[0.2 mL(2.5ⅹ10 4 PFU / mL) Recombinant HVT Multiepitope Vaccine (rHVT-BNT) / WT-HVT 15 subcutaneous injection <![CDATA[0.2 mL(2.5ⅹ10 4 PFU / mL) HVT empty vector (WT-HVT) / InV 15 subcutaneous injection 0.2 mL ALV-J inactivated vaccine 0.2 mL ALV-J inactivated vaccine Medium control 15 subcutaneous injection 0.2 mL M199 culture medium /

[0119] 2.2 Detection of ALV-J specific antibodies in chicken serum

[0120] Non-anticoagulated blood was collected at 7, 14, 21, and 28 days post-immunization (DPV). Serum was collected, aliquoted, and stored at -80°C for detecting serum antibody levels. ALV-J specific antibodies were detected using the Guosheng Biotechnology ALV-J Specific Antibody ELISA Kit; specific steps were described in the ALV-J Specific Antibody Detection Kit instructions.

[0121] The results showed that no ALV-J specific antibodies were detected in the serum of the InV group, rHVT-BNT+InV group, and rHVT-BNT-ovo group on days 7, 14, 21, and 28 post-immunization. Figure 4A ).

[0122] 2.3 Detection of IgY, IgM, and IgA antibody levels in chicken serum

[0123] The serum collected 28 days post-immunization was used to detect the levels of IgY, IgM, and IgA antibodies in chicken serum using an ELISA kit. Refer to the respective kit instructions for specific procedures.

[0124] The results showed no significant difference in serum IgM levels among the groups in terms of antibody subtypes; however, compared with the control group, serum IgY levels were significantly elevated in the rHVT-BNT group (P<0.01), rHVT-BNT-in ovo group (P<0.01), and InV group (P<0.0001); simultaneously, the IgA level in the rHVT-BNT-in ovo group was also significantly higher than that in the control group (P<0.05). Figure 4C-4E )

[0125] 2.4 Detection of the ratio of T lymphocytes to B lymphocytes in chicken peripheral blood

[0126] Changes in the proportion of T lymphocyte subsets in chicken PBMCs after 28 DPV were detected. T cell gating strategies were employed. Figure 3A B cell gate strategy (see...) Figure 3B ;

[0127] Anticoagulated blood was collected on day 28 post-immunization, and peripheral blood mononuclear cells (PBMCs) were isolated from chickens using the appropriate kit. 1 × 10⁶ cells were collected. 6 Cells were transferred to 96-well U-plates and washed with flow cytometry buffer. Flow cytometry antibodies (CD3-APC, CD4-FITC, CD8α-PE, and Bu-1-FITC) were diluted according to the manufacturer's instructions. Cells were resuspended in 100 µL of antibody and incubated at 4°C in the dark for 30 min. Staining was then stopped with flow cytometry buffer, and cells were centrifuged at 440 × g for 5 min, resuspended in 150 µL of flow cytometry buffer, and analyzed using FlowJo software.

[0128] The results showed that the proportion of B cells in PBMCs of the rHVT-BNT group, rHVT-BNT-in ovo group, and InV group was significantly higher than that of the control group (P<0.05). Figure 4B ).

[0129] like Figure 5A As shown in -C, CD8α of the rHVT-BNT group and the rHVT-BNT-in ovo group + The proportion of T cells was significantly higher in the group compared to the InV group. However, CD4 counts varied among the groups. + T cells and CD4 + CD8α + There was no statistically significant difference in the proportion of T cells (P>0.05).

[0130] 2.5 Detection of Immune-Related Gene Expression in PBMCs

[0131] To further investigate the immune response of chickens after immunization, this study used RT-qPCR to detect changes in the mRNA levels of immune-related genes in PBMCs after immunization.

[0132] The specific method is as follows: Total RNA was extracted from isolated PBMCs using the Novizan FastPure® Cell / Tissue Total RNA Isolation Kit and reverse transcribed into cDNA. Primer sequences for quantitative real-time PCR are cited in the references. Using the GAPDH gene as an internal reference, the experimental results were quantitatively analyzed using the ΔΔCt method.

[0133] Document 1: Dai, M., et al., Systematic Identification of Host Immune KeyFactors Influencing Viral Infection in PBL of ALV-J Infected SPF Chicken. 2020. 12(1): p. 114.

[0134] The results showed that, Figures 5D to 5G As shown, the expression levels of inflammation-related genes (IL-1β), CTL-related genes (IL-2 and IFN-γ), innate immunity-related genes (MX1), and Th2-related genes (IL-13) in the rHVT-BNT and rHVT-BNT-ovo groups were higher than those in the InV group.

[0135] 2.6 Detection of T-lymphocyte response in chicken spleen after epitope stimulation immunization

[0136] This study used ELISpot technology to stimulate SPF chicken spleen lymphocytes after immunization with T cell epitopes, and then detected the expression level of IFN-γ to assess the T lymphocyte response induced by epitope immunization. (Based on references...) According to the provided criteria, peptides that can induce significant IFN-γ production in at least two chickens compared to the negative control group are considered to have good immunogenicity.

[0137] Document 2: Reemers, SS, et al., Identification of novel avian influenzavirus derived CD8+ T-cell epitopes. (1932-6203 (Electronic)).

[0138] Chicken IFN-γ ELI-Spot Determination Reference Chicken IFN-γ ELI-Spot BASIC Follow the kit instructions. Add mouse anti-ChIFN-γ monoclonal antibody to each well of the ELISpot 96-well plate and incubate overnight at 4°C. Block the plate for 2 hours with RPMI 1640 medium containing 10% FBS, then add chicken spleen lymphocytes. Add a single peptide to each experimental group, a mixture of PMA and Ionomycin to the positive control wells, and an equal volume of DMSO to the negative control wells. After adding samples, incubate the PVDF 96-well plate in a 37°C cell culture incubator. After incubation, discard the cells, wash, and add biotin-conjugated mouse anti-ChIFN-γ monoclonal antibody. Incubate at room temperature for 2 hours, then with horseradish peroxidase (HRP)-labeled streptavidin monoclonal antibody for 1 hour at room temperature. Finally, add 100 μL of TMB chromogenic solution to each well until obvious spots appear. Wash with ultrapure water to stop the reaction, and count the spots using an automated spot analyzer.

[0139] The results showed that, Figures 6A to 6D As shown, the Gag epitope of T cells in the rHVT-BNT group 403-411 Pol 652-660 and Pol 270-280 It can stimulate a significant increase in the secretion level of IFN-γ in splenic lymphocytes (P<0.05) and meet the above criteria. The rHVT-BNT-in ovo group T cell epitope Gag... 403-411 and Pol 270-280 The stimulation significantly increased the secretion level of IFN-γ in splenic lymphocytes (P<0.05) and met the above criteria. However, there was no significant difference between the epitope stimulation wells in the InV group and the WT-HVT group and the negative control wells.

[0140] Example 3: Challenge Protection Experiment of Recombinant Turkey Herpesvirus

[0141] To investigate the protective effect against ALV-J after immunization, 10 doses were administered 28 days after immunization with the recombinant HVT multiepitope vaccine. 4 TCID 50 The ALV-J CHN06 strain was challenged, and viremia was detected at 7, 14, 21, and 28 days post-challenge.

[0142] 3.1 Attacking the virus

[0143] 28 days after immunization, use 10 4 TCID 50The ALV-J CHN06 strain was used for challenge via intraperitoneal injection. Non-anticoagulated blood samples were collected at 7, 14, 21, and 28 days post-infection (DPI).

[0144] 3.2 Detection of viremia positivity rate in chickens after viral infection

[0145] Non-anticoagulated blood was collected at 7 DPI, 14 DPI, 21 DPI, and 28 DPI, and serum was separated. The separated serum was inoculated into DF-1 cells with a cell density of approximately 80% and in good condition in 48-well plates and incubated at 39°C for 2 h, followed by culture in DMEM medium containing 2% FBS at 39°C for 5 days. After culture, the cells were frozen and thawed three times, and p27 antigen was detected according to the instructions of the avian leukosis virus antigen detection kit.

[0146] As shown in Table 4, at 7 DPI, the viremia positivity rate was 90% (1 / 10) in the medium control+ALV-J group, the InV+ALV-J group, and the WT-HVT+ALV-J group; 50% (5 / 10) in the rHVT-BNT+ALV-J group; and 60% (6 / 10) in the rHVT-BNT-in ovo+ALV-J group. At 14 DPI, the viremia positivity rate was 80% (8 / 10) in the medium control+ALV-J group and the InV+ALV-J group; 70% (7 / 10) in the WT-HVT+ALV-J group; and 50% (5 / 10) in both the rHVT-BNT+ALV-J group and the rHVT-BNT-in ovo+ALV-J group. At 21 DPI, viremia had completely turned negative in the rHVT-BNT+ALV-J group and the rHVT-BNT-in ovo+ALV-J group, but the InV+ALV-J group still had a 10% (1 / 10) viremia positivity rate.

[0147] Table 4. Detection of ALV-J viremia positivity rate

[0148] Note: PVR: Viremia positivity rate; PR: Protection rate

[0149] The above in vitro experiments confirmed that its replication ability was consistent with that of the parent strain, and indirect immunofluorescence verified that the multi-epitope protein remained stably expressed after 20 passages. To evaluate the immunogenicity of the vaccine and the effects of different immunization routes, this invention used two methods to inoculate rHVT-BNT: subcutaneous injection in 1-day-old SPF chickens and intraembryonic immunization in 18-day-old SPF chicken embryos. Simultaneously, a control was established by subcutaneous injection of whole-virus inactivated vaccine (InV) into 1-day-old SPF chickens followed by a booster immunization 14 days post-immunization. The humoral immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting ALV-J specific antibodies in serum, the proportion of B cells in PBMCs, and the levels of IgM, IgY, and IgA in serum on day 28 post-immunization. The cellular immune effects of rHVT-BNT chick immunization and intraembryonic immunization were evaluated by detecting the proportion of T cells in PBMCs, detecting the expression of immune-related factors by RT-qPCR, and detecting IFN-γ secretion by chicken spleen lymphocytes using ELISpot. Twenty-eight days after vaccination, the experimental animals were challenged with ALV-J via intraperitoneal injection at a viral dose of 1 mL of 10 4 TCID 50 Chicken viremia was assessed using 100 μL ALV-J (CHN06 strain) at days post-infection (DPI) of 7, 14, 21, and 28 to evaluate the protective effect against challenge after rHVT-BNT chick immunization and intraembryonic immunization.

[0150] The embodiments presented herein are merely selected implementations based on combinations of all possible embodiments. The appended claims should not be limited to the embodiments described herein. Some numerical ranges used in the claims include sub-ranges within them, and variations within these ranges should also be covered by the appended claims.

Claims

1. A recombinant turkey herpesvirus, characterized in that, A tandem epitope expression cassette is inserted between UL45 and UL46 of the recombinant turkey herpesvirus; the tandem epitope expression cassette is used to express multiple B cell epitopes and multiple T cell epitopes. The amino acid sequence of the tandem epitope expression cassette is shown in SEQ ID NO.

13.

2. A method of producing a recombinant turkey herpesvirus according to claim 1, wherein the recombinant turkey herpesvirus is produced by transfecting a turkey herpesvirus with a vector according to claim 1. Includes the following steps: Step 1: Insert the tandem epitope expression cassette into the first vector to obtain the first plasmid; Step 2: Using the genome of turkey herpesvirus as a template, amplify the homologous arm fragment that matches the insertion site of recombinant turkey herpesvirus; amplify the fragment of the tandem epitope expression cassette from the first plasmid; Step 3: Clone the homologous arm fragment and the fragment of the tandem epitope expression cassette into the second plasmid to obtain the transfection donor plasmid; Step 4: Transfect recipient cells with the donor plasmid, infect them with turkey herpesvirus, and after rescue and sorting purification, remove the GFP expression cassette using the Cre / loxP system to obtain the recombinant turkey herpesvirus.

3. The preparation method according to claim 2, characterized in that, The first vector is plasmid pcDNA3.1-ALV-JBNT; the second plasmid is plasmid pcDNA3.1-LoxN-GFP-BNT-UL45 / UL46.

4. The production method according to claim 2, characterized by, The base sequences of the homologous arm fragments are shown in SEQ ID NO.14 and SEQ ID NO.

15.

5. Use of the recombinant turkey herpesvirus as described in claim 1 to prepare avian leukosis vaccine.

6. An avian leukosis vaccine, characterized in that, Including the recombinant turkey herpesvirus as described in claim 1.

Citation Information

Patent Citations

  • Identification and application of ALV-J MHC-B2 restrictive epitope peptide

    CN114349829A

  • ALV-J MHC-B21 restrictive epitope peptide and application thereof

    CN115991733A

  • ALV-J MHC-B21 restrictive epitope peptide as well as screening method and application thereof

    CN117143206A

  • Construction and application of recombinant turkey herpesvirus expressing H7N9 subtype highly pathogenic avian influenza virus HA protein

    CN110218706A

  • ALV-J multi-epitope recombinant baculovirus, preparation method, application and vaccine

    CN118460620A