Ostrinia furnacalis nuclear receptor hr39 gene, rna interference fragment, dsrna and application thereof

Abstract

The application discloses an Ostrinia furnacalis nuclear receptor HR39 gene, an RNA interference fragment, dsRNA and application thereof, and relates to the field of agricultural pest control. The full-length cDNA sequence of the HR39 gene is shown as SEQ ID NO:1, the amino acid sequence of the encoded protein is shown as SEQ ID NO:2, and the sequence of the RNA interference fragment is shown as SEQ ID NO:3. The full-length cDNA sequence of the HR39 gene is obtained, a dsRNA fragment targeting the gene is designed, the transcription and expression of the HR39 gene are successfully interfered, and it is found that the ovary development of the female insect individual interfering with the HR39 is significantly inhibited, the egg laying amount and egg hatching rate are significantly reduced, and the reproductive capacity is significantly inhibited. The HR39 gene provided by the application provides a molecular target for designing specific and efficient nucleic acid pesticides to inhibit pest reproduction, and has a good application prospect in the green control of the Ostrinia furnacalis.

Description

Technical Field

[0001] This invention relates to the field of agricultural pest control, specifically to the Asian corn borer nuclear receptor HR39 gene, RNA interference fragment, dsRNA, and their applications. Background Technology

[0002] Asian corn borer ( Ostrinia furnacalis The Asian corn borer, commonly known as the corn stem borer, is a major pest affecting corn production. In the field, newly hatched larvae bore into and feed on the whorl of the corn plant; during the tasseling stage, larvae damage the unemerged tassels; after tasseling, larvae bore into the pedicel and the stalk above the female ear; during the grain-filling stage, larvae gnaw on the kernels at the top of the ear. With the continuous expansion of the planting area of ​​sweet and waxy corn varieties, suitable host plants have been provided for the Asian corn borer. The survival rate of corn borer larvae feeding on sweet corn is 3 to 7 times higher than that of ordinary corn, and their development period is 4 to 6 days earlier, making them more suitable for the growth and development of the Asian corn borer, resulting in a significant increase in its damage. Therefore, developing environmentally friendly and target-specific control strategies for the Asian corn borer is imperative.

[0003] Reproduction is a key factor determining the reproductive capacity of insect populations. Vitellogenesis is a core stage of insect reproduction, occurring within a relatively short period and involving several consecutive steps. Vitellogenin (Vg) is synthesized in large quantities within the fat body, transported across the hemolymph and intercellular channels of follicular cells to the oocyte, and absorbed by the immature oocyte through endocytosis mediated by the vitellogenin receptor VgR. Increasing research indicates that vitellogenesis in insects is primarily regulated by juvenile hormone (JH) and ecdysone (20-hydroxyecdysone, 20E), with significant differences in the hormonal regulatory mechanisms among different insect species. In hemimetabolous insects such as the Oriental migratory locust and the German cockroach, JH regulates vitellogenesis independently of 20E. In holometabolous insects such as the red flour beetle, JH regulates Vg synthesis in the fat body, while 20E regulates Vg uptake by the oocyte. The development of yolk sac in the Asian corn borer begins at the end of the pupal stage, but the endocrine regulatory mechanism that controls yolk sac development in female Asian corn borers remains unclear. Summary of the Invention

[0004] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide the HR39 nuclear receptor gene of the Asian corn borer, RNA interference fragments, dsRNA and their applications, so as to inhibit the reproductive capacity of female Asian corn borers based on RNAi technology and apply it to the prevention and control of Asian corn borers.

[0005] The HR39 gene is a member of the NR5A nuclear receptor family, possessing a conserved DNA-binding domain and a carboxyl-terminal ligand-binding domain. It has been reported that female HR39 mutants in Drosophila exhibit underdeveloped or absent seminal vesicles and ovarian accessory glands, leading to female infertility. Further research has revealed that the HR39 nuclear receptor gene in Drosophila plays a crucial regulatory role in the formation and differentiation of secretory cells present in the seminal vesicles and ovarian accessory glands. However, functional studies on the HR39 nuclear receptor in lepidopteran insects are limited, and there are no reports of RNAi targeting HR39 for pest control. Therefore, this invention explores the application of RNAi targeting HR39 for the control of the Asian corn borer.

[0006] The technical solution of the present invention is as follows: In a first aspect, the present invention provides an HR39 gene of the Asian corn borer, the full-length cDNA sequence of which is shown in SEQ ID NO: 1.

[0007] Secondly, the present invention provides a protein encoded by the HR39 gene, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0008] Thirdly, the present invention provides the application of the HR39 gene as a target for RNA interference in inhibiting the reproduction of the Asian corn borer.

[0009] The HR39 gene described in this invention can be used as a target for RNA interference to inhibit the reproduction of the Asian corn borer, thereby enabling its application in the control of the Asian corn borer.

[0010] Optionally, the method of the application includes: An RNA interference fragment targeting the HR39 gene was designed, and dsRNA was synthesized using the RNA interference fragment as a template. The expression of the HR39 gene in Asian corn borer was silenced by the dsRNA.

[0011] Optionally, in the aforementioned application, the nucleotide sequence of the RNA interference fragment targeting the HR39 gene is shown in SEQ ID NO: 3. It should be noted that not all RNA fragments have an interfering effect. Based on the ORF sequence of the HR39 gene, this invention designs an RNA interference fragment targeting the HR39 gene, which exhibits good interference effect on the HR39 gene.

[0012] Fourthly, the present invention provides an RNA interference fragment of the HR39 gene, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0013] Fifthly, the present invention provides the application of the said RNA interference fragment in inhibiting the reproduction of the Asian corn borer.

[0014] In a sixth aspect, the present invention provides a dsRNA, which is synthesized from the aforementioned RNA interference fragment.

[0015] Optionally, the method for synthesizing the dsRNA includes the following steps: S1. Design upstream and downstream primers with T7 promoter sequences based on the RNA interference fragment sequence of the HR39 gene; S2. Using cDNA from the Asian corn borer as a template, RNA interference fragments are amplified by PCR reaction using the upstream and downstream primers containing the T7 promoter sequence, and the PCR product is purified. S3. Using the purified PCR product as a template, dsRNA is synthesized in vitro by transcription.

[0016] Optionally, the sequence of the upstream primer is shown in SEQ ID NO: 4, and the sequence of the downstream primer is shown in SEQ ID NO: 5.

[0017] In a seventh aspect, the present invention provides the application of the dsRNA in inhibiting the reproduction of the Asian corn borer.

[0018] Optionally, the method of application includes: injecting the dsRNA into the female Asian corn borer to silence the expression of the HR39 gene of the Asian corn borer through the dsRNA.

[0019] Optionally, the features of the application are implemented in at least one of the following ways: 1) Inhibits ovarian development in female Asian corn borers; 2) Shorten the oviposition period of female Asian corn borers; 3) Reduce the number of eggs laid by female Asian corn borers; 4) Reduce the hatching rate of eggs laid by female Asian corn borers.

[0020] Optionally, the inhibition of ovarian development in female Asian corn borers can be achieved by at least one of the following methods: reducing the ovarian proportion of female Asian corn borers, reducing the length of the ovarian tubes of female Asian corn borers, or reducing the proportion of mature follicles in female Asian corn borers.

[0021] Specifically, firstly, this invention obtained the full-length cDNA sequence of the Asian corn borer HR39 gene using a rapid cDNA end amplification technique, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0022] Furthermore, this invention designs an RNA interference fragment targeting the HR39 gene, the nucleotide sequence of which is shown in SEQ ID NO:3. This invention synthesizes dsRNA using the RNA interference fragment of the HR39 gene from the Asian corn borer as a template.

[0023] The above-mentioned method for preparing dsRNA targeting the HR39 gene is as follows: (1) Design an upstream primer SEQ ID NO: 4 and a downstream primer SEQ ID NO: 5 with the T7 promoter sequence; (2) Amplify the RNA interference fragment by PCR and purify the PCR product; (3) Synthesize dsRNA targeting HR39 using a kit (T7 RiboMAX™ Express RNAi System, Promega).

[0024] This invention also provides an application of RNAi targeting the HR39 gene to inhibit the reproduction of the Asian corn borer.

[0025] Preferably, the RNAi implementation method refers to injecting dsRNA into the female insect body via microinjection, with the injection site being the intersegmental membrane of the female insect's abdomen.

[0026] The results showed that, compared with the control group, the silencing efficiency of the target gene by dsHR39 injection was 71.73% and 69.97% at 48h and 72h, respectively, indicating that the expression of the target gene HR39 was significantly inhibited. Dissection observation revealed that, compared with the control group, the proportion of ovaries, ovarian duct length, and the percentage of mature follicles in HR39-interfered individuals were significantly decreased, proving that their ovarian development was significantly inhibited. Biostatistical analysis showed that, compared with the control group, the oviposition period, egg production, and egg hatching rate of HR39-interfered individuals were significantly decreased, proving that the reproductive capacity of their females was significantly inhibited.

[0027] The use of RNAi to control the Asian corn borer mainly refers to reducing the reproductive capacity of female Asian corn borers. Specifically, this is manifested in a significant decrease in the number of eggs laid by HR39 interference individuals, and a reduction in the hatching rate of the eggs.

[0028] This invention has at least one of the following beneficial effects: This invention provides the Asian corn borer nuclear receptor HR39 gene, an RNA interference fragment, dsRNA, and their applications. The Asian corn borer HR39 gene includes the full-length cDNA sequence shown in SEQ ID NO: 1, the amino acid sequence encoding the protein shown in SEQ ID NO: 2, and the nucleotide sequence of the RNA interference fragment of the HR39 gene shown in SEQ ID NO: 3. This invention designs an interference sequence fragment targeting the HR39 gene and synthesizes a dsRNA targeting this gene (i.e., dsHR39), which, when injected into female Asian corn borers, significantly inhibits the expression of the target gene HR39. Results showed that the oviposition period, oviposition rate, and egg hatching rate of female HR39-interfered individuals were significantly reduced, significantly decreasing their reproductive capacity. Microscopic observation revealed that the ovarian proportion, ovarian duct length, and proportion of mature follicles were all significantly reduced in female HR39-interfered individuals, demonstrating significant inhibition of ovarian development. The HR39 gene described in this invention can be used to design specific and efficient nucleic acid pesticides to reduce the reproductive capacity of pests, providing molecular targets for screening pest reproductive inhibitors. Attached Figure Description

[0029] Figure 1 RACE amplification and ORF segment amplification of the HR39 gene of Asian corn borer. Figure 1 In the figure, A represents the agarose gel electrophoresis detection of HR39 gene 5'RACE and 3'RACE amplification, and M represents the molecular marker. Figure 1 The image shows the agarose gel electrophoresis results of the ORF segment of the HR39 gene in B: M is the molecular marker.

[0030] Figure 2 To detect the silencing effect of the HR39 gene in the Asian corn borer. Figure 2 In the middle, ds GFP : Control group individuals who ingested dsGFP. ds HR39 Individuals in the experimental group who ingested dsHR39. Student's... t The test method was used to perform a significance analysis of the differences. ** and *** represent the differences at... P <0.01 and P The difference was significant at the <0.001 level.

[0031] Figure 3 To investigate the effect of interfering with the HR39 gene on the reproduction of female adult Asian corn borers. Figure 3 A in the figure: The effect of interfering with HR39 on the duration of the pre-oviposition period in female insects. Figure 3 B in the equation: The effect of interfering with HR39 on the oviposition rate of female insects. Figure 3 C in the figure: The effect of interference with HR39 on egg hatching rate.

[0032] Figure 4 To investigate the effect of interfering with the HR39 gene on ovarian development in female adult Asian corn borers. Figure 4 A in the text: injection ds GFP The ovarian morphology of the control group individuals was observed 2 days after treatment. Figure 4 B in: injection ds GFP Observation of follicular morphology in the ovary 2 days after individual treatment. Figure 4 C in: injection ds HR39 Ovarian morphology was observed in the experimental group individuals two days after treatment. Figure 4 D in: injection ds HR39 Observation of follicular morphology in the ovary 2 days after individual treatment.

[0033] Figure 5 To quantitatively analyze the effect of interfering with the HR39 gene on ovarian development in female adult Asian corn borers. Figure 5 A in the figure: The effect of interfering with the HR39 gene on ovarian tube length 24 hours and 48 hours later. Figure 5 B in the figure: The effect of interfering with the HR39 gene on ovarian specific gravity 24 and 48 hours later. Figure 5 C in the figure: The effect of interfering with the HR39 gene on the proportion of mature follicles 24 hours and 48 hours later. Figure 5 In the diagram, D represents the follicle grading at different developmental stages: I represents the pre-vitiligo stage, II represents the vitelline stage, and III represents the maturation stage. ds GFP : intake of ds GFP The control group. ds HR39 : intake of ds HR39 The experimental group of individuals. Using Student's... t The test method was used to perform a significance analysis of the differences. *, **, and *** represent the differences at... P <0.05、 P <0.01 and P The difference was significant at the <0.001 level. Detailed Implementation

[0034] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0035] Adult Asian corn borers were collected from the maize experimental field of Jiangxi Agricultural University and cultured in the laboratory using artificial feed. Eggs were hatched in an intelligent artificial climate chamber at a temperature of 25℃±1℃ and a relative humidity of 40%-50%. Larval rearing conditions: Asian corn borer larvae were reared using artificial feed at a temperature of 25℃±1℃, a relative humidity of 40%-50%, and a light-dark ratio of 14h:10h.

[0036] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following specific embodiments.

[0037] Example 1: Obtaining the full-length cDNA sequence of the HR39 gene from the Asian corn borer. 1. Extraction of total RNA from Asian corn borer Take a female adult of Asian corn borer that has emerged one day ago and place it in a sterile mortar. Add liquid nitrogen and grind it thoroughly into powder. Take an appropriate amount of powder and add it to a 1.5 mL RNase-free PE tube containing 1 mL of total RNA extraction reagent (TRNzol Universal, Tiangen Biotech). Shake to mix well, incubate on ice for 2 min, and then use the total RNA extraction reagent to separate and extract total RNA.

[0038] 2. Synthesis of cDNA template from Asian corn borer Using the extracted total RNA as a template, the 5'-end amplified cDNA template (5'-RACE cDNA) and the 3'-end amplified cDNA template (3'-RACE cDNA) were synthesized by reverse transcription according to the instructions using the SMARTer® RACE 5' / 3' Kit (Takara Bio).

[0039] 3. Rapid amplification of cDNA ends (RACE) Based on the Asian corn borer transcriptome database, a transcript encoding the HR39 gene of the Asian corn borer was obtained using a local BLAST method. 3'-RACE amplification-specific primers (3' GSP) and 5'-RACE amplification-specific primers (5' GSP) were designed. The primer sequences are as follows: 3' GSP: CGACTCACGCCTGACATACCCCCATTATTGC (SEQ ID NO: 6) 5' GSP: CTTGGAGACCTCGGCGTCGGTGGAGTC (SEQ ID NO: 7) Two PCR reaction systems, a 5' RACE system and a 3' RACE system, were prepared in separate PCR tubes. The 3' RACE system used 3' GSP as the upstream primer and universal primers (UPM) as the downstream primer, with the 3' end amplified cDNA template (3'-RACE cDNA) as the template for PCR amplification. The reaction system is shown in Table 1 below. Table 1 The 5' RACE reaction system used universal primer UPM as the upstream primer and 5' GSP as the downstream primer. PCR amplification was performed using the 5' end amplified cDNA template (5'-RACE cDNA) as the template. The reaction system is shown in Table 2 below: Table 2 The landing PCR method was used, and the reaction conditions were: 95℃ for 30s, 72℃ for 3min (5 cycles); 95℃ for 30s, 70℃ for 30s, 72℃ for 3min (5 cycles); 95℃ for 30s, 68℃ for 30s, 72℃ for 3min (25 cycles).

[0040] PCR products were detected by agarose gel electrophoresis. Figure 1 (A) The target fragment was gel-cleaved and recovered, then ligated into the pMD19-T cloning vector to obtain a recombinant vector, which was then transformed into E. coli Trans1. Positive clones were selected from T1 competent cells by bacterial PCR and sequenced for verification.

[0041] 4. Validation of the ORF sequence of the HR39 gene in the Asian corn borer Using DNAMAN 6.0 software, the 5' and 3' sequences obtained from the RACE reaction were spliced ​​with the HR39 transcript sequence to obtain the full-length cDNA sequence of the HR39 gene (SEQ ID NO: 1).

[0042] Based on the full-length cDNA sequence of HR39, specific primers HR39-ORF-F and HR39-ORF-R were designed to amplify its ORF region, and the agarose gel electrophoresis was performed for detection. Figure 1 (B in the sequence), and then sequenced to verify.

[0043] HR39-ORF-F (SEQ ID NO: 8):ATGAGCGCGATGTCGAGCGA; HR39-ORF-R (SEQ ID NO: 9): TCAATGGTCCCCCCTTAATAGTTCC.

[0044] Example 2: Design of RNA interference fragments and synthesis of dsRNA from the HR39 gene 1. Preparation of dsRNA targeting the HR39 gene of the Asian corn borer (1) Based on the ORF sequence of the HR39 gene, an RNA interference fragment targeting the HR39 gene (SEQ ID NO: 3) was designed, and then specific primers with the T7 promoter were designed to amplify the fragment. The primer sequences are as follows: dsHR39-F: TAATACGACTCACTATAGGCGCAGCTGTCAGAGCTAAAAT (SEQ ID NO: 4); dsHR39-R: TAATACGACTCACTATAGGGTAGTGGAAGCCGCTTATCTTG (SEQ ID NO: 5); (2) Using Asian corn borer cDNA as a template, PCR amplification was performed using Ex-Taq DNA polymerase (Takara Bio). The reaction system is shown in Table 3 below: Table 3 (3) Mix all components well. The PCR reaction conditions are: pre-denaturation 94℃ 1min; 94℃ 30s, 59℃ 30s, 72℃ 40s (35 cycles); extension 72℃ 5min.

[0045] (4) Using the purified PCR product as a template (containing DNA at a concentration higher than 200 ng / μL), dsRNA was synthesized in vitro using a kit (T7RiboMAX™ Express RNAi System, Promega). The reaction system is shown in Table 4 below: Table 4 After mixing, briefly centrifuge, incubate at 37°C for 90 min, and then at 70°C for 10 min.

[0046] (5) Add 1 μL RNase (200 times dilution) and 1 μL DNase to the reaction system of step (4) in sequence, mix well and digest at 37°C for 30 min.

[0047] (6) Add 2.2 μL sodium acetate (pH 5.2) and 24 μL isopropanol to the reaction system of step (5) to precipitate dsRNA. After mixing, incubate on ice for 5 min and then centrifuge at 14,000g for 10 min.

[0048] (7) Remove the supernatant from step (6), wash the dsRNA precipitate with 70% pre-cooled ethanol, dry it in a clean bench for 15 min, and dissolve it in an appropriate amount of nuclease-free water. Take 1 μL of the dsRNA product and dilute it with 9 μL of nuclease-free water. Then, use agarose gel electrophoresis to detect the purity and quality of the synthesized dsRNA. In addition, use a full-wavelength spectrophotometer (TGemUltra) to detect the concentration of dsRNA.

[0049] Synthesize dsRNA targeting GFP (Green Fluorescent Protein) using the same steps (hereinafter referred to as dsRNA). GFP As a negative control, the upstream and downstream primer sequences used to amplify the GFP fragment were ds and ds, respectively. GFP -F and ds GFP -R.

[0050] ds GFP -F (SEQ ID NO: 10): TAATACGACTCACTATAGGGAAGTTCAAGCGTGTCCG; ds GFP -R (SEQ ID NO: 11): TAATACGACTCACTATAGGGCACCTTGATGCCGTTC.

[0051] Example 3: Screening for dsRNAs targeting the HR39 gene to inhibit the reproductive capacity of female Asian corn borers. 1. Microinjecting dsRNA into adult female Asian corn borers Female adult Asian corn borers (within 6 hours of emergence) were selected and injected with ds GFP Female insects were used as the control group, while the treatment group was injected with ds HR39 Before injection, female adult insects were anesthetized with CO2 gas for 60 seconds. The anesthetized females were then transferred to agar plates, abdomen facing upwards, and the synthesized dsRNA was injected into the abdominal intersegmental membrane using a microinjector (Nanoliter 2020). The injection volume was 1 μL, and the dsRNA concentration was 2 μg / μL. The injected female Asian corn borers were then housed individually in transparent plastic cups, supplemented with 10% sugar water for nutrition.

[0052] 2. Detection of HR39 gene silencing effect by qRT-PCR Samples were taken at 24h, 48h, 72h, and 96h after dsRNA injection to detect the interference effect on the target gene. Five individuals from each of the treatment and control groups were used, and three biological replicates were set up. Total RNA was extracted from individuals in the Asian corn borer experimental and treatment groups according to the method in Example 1. Then, cDNA was synthesized using the FastKing one-step genomic cDNA first-strand synthesis kit (Tiangen Biotech).

[0053] Quantitative real-time PCR (qRT-PCR) was performed on a CFX96 Touch Real-time Detection System (Bio-Ray). Using the synthesized cDNA as a template, quantitative PCR detection was performed using a dedicated reagent (SuperRealPreMix Plus, Tiangen Biotech). The reaction system is shown in Table 5. Table 5 The reaction procedure for real-time PCR is as follows: pre-denaturation at 95℃ for 15 min; 95℃ for 10 s, 60℃ for 20 s, and 72℃ for 30 s (40 cycles).

[0054] The internal reference gene RPS3 was used to correct for differences in the expression levels of the target gene among different samples, and 2... – CT Method for calculating target genes HR39 The relative expression levels of the treated and control samples, and the primer sequences of the internal reference gene and the target gene are as follows: RPS3-qF (SEQ ID NO: 12): ATCGCGCAAGCAGAGTCTTTGAGA; RPS3-qR (SEQ ID NO: 13): AACTTCATTGACTTGGCACGCTGG; HR39-qF (SEQ ID NO: 14): TCGACAAGTGCTTAGGGTGC; HR39-qR (SEQ ID NO: 15): GGATAGCAGCGAGCCTGTAG; The results of quantitative fluorescence showed that, compared with the control group, ds HR39 The interference efficiencies at 24h, 48h, 72h, and 96h post-injection were 50.20%, 71.73%, 69.97%, and 50.58%, respectively, indicating that the target gene... HR39 The expression of [the substance] was significantly suppressed, and the interference effect lasted for at least 4 days. Figure 2 ).

[0055] 3. Interference HR39 Impact on the reproduction of female adult Asian corn borers After the female adult insect is injected with dsRNA, HR39 Individual moths from both the interference and control groups were individually reared in transparent plastic cups, with the cup openings sealed with gauze. Sugar water was provided via suspended cotton balls, and the cotton balls and gauze were changed daily. The number of eggs laid by the female moths was counted. After hatching, the number of successfully hatched individuals in the treatment and control groups was counted, and the hatching rate was calculated. Furthermore, daily observations and records were kept. HR39 Whether the interference and control individuals survived. Each group contained at least 10 experimental individuals, with 3 biological replicates.

[0056] Biostatistical results showed that, compared with the control group, HR39 The duration of the oviposition period in disturbed individuals decreased by 1.07 days. Furthermore, HR39 The number of eggs laid by disturbed individuals decreased by 37.41%, and the hatching rate of the eggs decreased by 29.88%. Figure 3 The above results indicate that interference with female adults... HR39 Genes can significantly reduce a person's reproductive capacity.

[0057] 4. Interference HR39 Effects on ovarian development of female adult Asian corn borer After the female adult insect is injected with dsRNA, HR39 Individuals subjected to interference and those in the control group were housed individually in transparent plastic cups, with the cup openings sealed with gauze and sugar water provided via suspended cotton balls. At 24 and 48 hours post-interference, 10 individuals from each group were selected and dissected in pre-cooled PBS on wax trays. Observation was performed using a stereomicroscope (SZX16, Olympus), and the length of the ovarian ducts was measured with a micrometer. The number of follicles at different developmental stages (I. pre-vitiligo development, II. vitelline development, III. mature development) was counted. Three biological replicates were established for each treatment.

[0058] Dissection using a stereomicroscope revealed that 2 days after dsRNA injection, the control group (injected with dsRNA) showed... GFP The ovaries of the experimental group reached full maturity and were filled with numerous plump, mature follicles. In contrast, the experimental group (injected with ds...) HR39 The ovaries of the affected individuals show signs of decline in development, containing only a small number of mature follicles. Figure 4 ).

[0059] Quantitative comparison of various indicators of ovarian development revealed that 24 hours after dsRNA injection, compared with the control group, HR39In the affected individuals, the proportion of ovarian tissue decreased by 13.49%, the length of ovarian ducts decreased by 20.00%, and the proportion of mature follicles decreased by 35.99%. 48 hours after treatment, compared with the control group, HR39 The proportion of ovaries decreased by 11.60%, the length of ovarian ducts decreased by 23.46%, and the proportion of mature follicles decreased by 21.31% in the affected individuals. Figure 5 The above results prove that interference with female adults... HR39 The gene significantly inhibits the development of her ovaries.

[0060] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. The application of the Asian corn borer nuclear receptor HR39 gene as a target for RNA interference in inhibiting the reproduction of the Asian corn borer, characterized in that... The full-length cDNA sequence of the HR39 gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The application method includes: An RNA interference fragment targeting the HR39 gene was designed, and dsRNA was synthesized using the RNA interference fragment as a template. The expression of the HR39 gene in Asian corn borer was silenced by the dsRNA.

3. An RNA interference fragment of the HR39 gene, a nuclear receptor for the Asian corn borer, characterized in that... The full-length cDNA sequence of the HR39 gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the RNA interference fragment is shown in SEQ ID NO:

3.

4. The application of the RNA interference fragment of claim 3 in inhibiting the reproduction of the Asian corn borer.

5. A dsRNA, characterized in that, The dsRNA is synthesized from the RNA interference fragment described in claim 3.

6. The application of the dsRNA according to claim 5 in inhibiting the reproduction of the Asian corn borer.

7. The application according to claim 6, characterized in that, The method of application includes: injecting the dsRNA into the female Asian corn borer to silence the expression of the Asian corn borer nuclear receptor HR39 gene through the dsRNA.

8. The application according to claim 7, characterized in that, The application is implemented in at least one of the following ways: 1) Inhibits ovarian development in female Asian corn borers; 2) Shorten the oviposition period of female Asian corn borers; 3) Reduce the number of eggs laid by female Asian corn borers; 4) Reduce the hatching rate of eggs laid by female Asian corn borers.

Images