STS molecular marker of major quantitative trait locus for resistance to scab in wheat and its application
Patent Information
- Application Number
- CN202610030364.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2046-01-09
AI Technical Summary
然而,定位的大多数QTL由于其遗传效应小(PVE<10%)且不稳定,不能满足标记辅助选择育种的需要
[0014]本发明所述的小麦抗赤霉病主效QTL的STS分子标记及其应用的优点和积极效果是:
Smart Images

Figure CN121674612B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetics, and in particular to STS molecular markers of major QTLs for wheat resistance to Fusarium head blight and their applications. Background Technology
[0002] wheat( Triticum aestivum Wheat scab (Fusarium head blight) is an important staple food crop in my country. Fusarium headblight, FHB, is caused by Fusarium graminearum (FHB). Fusarium grminearum Fusarium head blight is a global disease caused by various pathogenic fungi of the genus Fusarium, seriously threatening wheat production and food security. Unlike other diseases, wheat scab not only directly affects wheat yield, but the fungal toxins produced by its pathogens, such as deoxynivalenol (DON) and zearalenone, can cause poisoning in humans and animals, resulting in vomiting, decreased immunity, and fetal malformations, seriously threatening human and animal safety.
[0003] The occurrence and spread of wheat scab require high humidity and suitable temperature, and the main disease-affected areas are the winter wheat regions of the middle and lower reaches of the Yangtze River, the winter wheat regions of South China, and the spring wheat regions of Northeast China. In recent years, due to the combined effects of global warming, wheat-maize rotation, and straw return to the field, the occurrence of scab in my country has shown a trend of spreading from south to north and from east to west, with the frequency of infection gradually increasing and the damage becoming more severe. Currently, wheat scab has become one of the main factors limiting wheat production in my country; therefore, accelerating the process of breeding wheat scab-resistant varieties is of great significance.
[0004] Fusarium head blight (FHB) in wheat primarily infects the ears during the flowering stage, characterized by a short infection cycle and rapid disease progression. Currently, the lack of effective pesticides for controlling FHB, coupled with the short window of effective chemical control and the influence of unfavorable natural conditions such as rain during pesticide application, makes chemical control of the disease difficult and inconsistent. Currently, breeding and planting FHB-resistant varieties based on host resistance is the most economical and effective method for controlling FHB. FHB resistance is a quantitative trait, highly influenced by environmental factors, requiring multiple years and locations to accurately identify the resistance phenotype. Therefore, relying solely on phenotypes for FHB resistance identification during breeding is difficult and inefficient. Marker-assisted selection (MAG) is unaffected by environmental conditions, improving the accuracy of selection in segregating generations and significantly increasing the efficiency of FHB resistance breeding.
[0005] Wheat scab resistance is a type of quantitative trait resistance, controlled by quantitative trait loci (QTLs). Currently, over 250 QTLs for wheat scab resistance have been mapped, distributed across all 21 wheat chromosomes. However, most of these mapped QTLs have small genetic effects (PVE < 10%) and are unstable, failing to meet the needs of marker-assisted selection breeding. Furthermore, the genetic distance between identified markers and QTLs, the high requirements of marker genotyping techniques, and low throughput mean that most mapped QTLs fall far short of the needs of molecular breeding. Therefore, developing molecular markers closely linked to major QTLs of wheat scab resistance is crucial for improving the efficiency of molecular breeding for scab resistance. Summary of the Invention
[0006] The purpose of this invention is to provide an STS molecular marker for a major QTL of wheat resistance to Fusarium head blight and its application, in order to solve the aforementioned technical problems. This invention provides an STS marker for a major QTL of wheat resistance to Fusarium head blight; this molecular marker has high diagnostic value and is compatible with... Fhb9 The Fusarium head blight resistance at the locus is closely linked and can be used as an auxiliary selection marker for disease resistance breeding at that locus.
[0007] To achieve the above objectives, this invention provides a primer set for amplifying STS molecular markers that amplify major QTLs for wheat resistance to Fusarium head blight. The forward primer, as shown in SEQ ID NO.1, is 5'-CGGAGCAAGGACCCTAAGAA-3'; The reverse primer, as shown in SEQ ID NO.2, is 5'-CCGACTGCGGCATTGTTAAT-3'.
[0008] The STS molecular marker for the major QTL of wheat resistance to Fusarium head blight is located on the long arm of wheat chromosome 2D, and is... Fhb9 , Fhb9 It is located within a 2.0 cM interval marked AX-111566799 to AX-108841399.
[0009] To achieve the above objectives, the present invention also provides the application of the above primer set in the breeding of wheat varieties resistant to Fusarium head blight.
[0010] To achieve the above objectives, the present invention also provides the application of the above primer set in the preparation of a kit for breeding wheat resistant to Fusarium head blight.
[0011] Furthermore, the present invention also provides a kit for breeding wheat resistant to Fusarium head blight, the kit comprising the above-mentioned primer set.
[0012] To achieve the above objectives, the present invention also provides a method for identifying wheat scab resistance, comprising the following steps: Step 1: Extract genomic DNA from wheat seedling leaves to obtain the genomic DNA to be tested; Step 2: Use the primer set described above to perform PCR amplification on the genomic DNA to be tested, and obtain the PCR product; Step 3: Genuine the PCR product based on its length.
[0013] Furthermore, when the PCR product length is 988 bp, the wheat is of the disease-resistant R type; When the PCR product length is 1578 bp, the wheat is susceptible to the S-type disease.
[0014] The advantages and positive effects of the STS molecular marker for the major QTL of wheat resistance to Fusarium head blight described in this invention and its application are as follows: In this invention, the STS molecular marker of the major QTL for wheat resistance to Fusarium head blight is tightly linked to Fusarium head blight resistance, exhibiting high diagnostic accuracy and can be widely used in assisted breeding of Fusarium head blight-resistant wheat. For identification, a primer set is used to perform PCR amplification of the genomic DNA to be tested; the length of the amplified bands allows for rapid genotyping.
[0015] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0016] Figure 1 The main effect QTL for the resistance to Fusarium head blight of wheat Shi 4185 in this embodiment of the invention is ( Fhb9 The location results; Figure 2 The results of genotyping of the Fhb9-STS marker in this embodiment of the invention are shown, where M: Marker; H: heterozygous type; S: susceptible type; R: resistant type. Detailed Implementation
[0017] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0018] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0019] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental instruments, equipment, and reagents in the following embodiments that do not specify their sources are all commercially available materials.
[0020] Unless otherwise defined or stated, all technical and scientific terms used in this invention have the same meaning as those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention.
[0021] Example 1: Materials and Methods 1. Fusarium head blight resistant parent: Shi 4185 is a winter wheat variety bred by the Shijiazhuang Academy of Agricultural Sciences in Hebei Province through hybridization of Zhi 8094, Yumai 2 and Jimai 26. Field and indoor identification showed that this variety has a moderate to resistant response to Fusarium head blight.
[0022] 2. QTL mapping population: The F1 generation was generated by crossing Shi 4185 with the highly susceptible wheat variety Shijiazhuang 8. After self-pollination to generate the F2 generation, the F6 genetic population of recombinant inbred lines (RILs) was constructed by single-seed transmission.
[0023] 3. Fusarium head blight resistance identification: Under greenhouse conditions, the parent lines and their derived RIL populations were identified for Fusarium head blight resistance using a single-flower drip method.
[0024] After wheat flowering, select spikelets that flower in the middle section, inoculate each spikelet with 10 μl of bacterial solution (approximately 1000 spores), and cover with bags to maintain moisture for 48 hours. Investigate disease incidence 7-15 days after inoculation, using the percentage of diseased spikelets per spikelet as the indicator of disease resistance. For each line, including the parent, two replicates are performed, with 3-5 spikelets inoculated each time.
[0025] 4. DNA Extraction and QTL Mapping: DNA was extracted from the parents and their RIL population using the CTAB method. Genotyping of the “Shi 4185 / Shijiazhuang 8” RIL population was performed using wheat 55K SNP microarray markers. QTL mapping was conducted using the inclusive composite interval mapping of additive (ICIM-ADD) method in the QTL mapping software IciMapping 4.2.
[0026] Using the “Shi 4185 / Shijiazhuang 8” RIL population and wheat 55K SNP chip markers, the major QTL controlling Fusarium head blight resistance in Shi 4185 was located on the long arm of the second chromosome of wheat (2DL), and named […]. Fhb9 ( Figure 1 (As shown). This QTL is stable in different environments, and it can resolve 18.65%-21.33% of the phenotypic variation of Fusarium head blight resistance in different years, with an average of 18.49%.
[0027] Based on the average phenotypic data of Fusarium head blight resistance Fhb9 It is located within a 2.0 cM interval marked AX-111566799 to AX-108841399 (as shown in Table 1).
[0028] Table 1 Fhb9 Genetic effects and their flanking markers
[0029] 5. Development of STS markers: Alignment with the known wheat reference genome (accession number: SAMC3172726) (https: / / ngdc.cncb.ac.cn / biosample / browse / SAMC3172726) sequence information revealed that within the target QTL region, Fhb9 The disease-resistant allele donor parent variety "Shi 4185" contains a rare InDel (deletion) polymorphic site.
[0030] In order to better Fhb9 For breeding wheat scab resistance, closely linked polymorphic sites were developed into sequence-tagged sites (STS) based on PCR (polymerase chain reaction) technology. Primer sequence information is as follows: The sequence of forward primer F (SEQ ID NO.1) is: 5'-CGGAGCAAGGACCCTAAGAA-3'; The reverse primer R (SEQ ID NO.2) sequence is: 5'-CCGACTGCGGCATTGTTAAT-3'.
[0031] The binding sites for the forward primers in the Shi4185 reference genome are: positions 532392658-532392677; The binding sites of the reverse primer are: positions 532393645-532393626.
[0032] 6. Implementation of STS markup in Fhb9: 1) STS-labeled PCR reaction system (10 μl): PCR reaction system: DNA 1 μl (~100 ng), primer F 0.2 μl, primer R 0.2 μl, ddH2O 3.6 μl, 2×Es Taq MasterMix (Dye) 5.0 μl.
[0033] 2) STS-labeled PCR reaction procedure: PCR reaction procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min 30 s, 34 cycles; 72℃ extension for 5 min; store at 12℃.
[0034] Result Analysis of Example 2 Fhb9 Development and validation of closely linked markers: Comparative analysis of sequences within the initially located QTL interval revealed a rare allelic variant, InDel, with a difference of 590 bp between the resistant and insensitive materials.
[0035] In wheat strain 4185 resistant to Fusarium head blight, the sequence amplified by this primer is (SEQ ID NO.3): CGGAGCAAGGACCCTAAGAATCTGGAAGATATCTCGAGAAAAGGTTTTAGCCTGGAACCATTCCGGTGTCCGAATATAGTCATCCAATATATCAATCTTCATGTCTCGACCATTTCGAGACTCCTCGTCATGTCCGTCATCACATCCGGGACTCCGAACAACCTTCGGTACATCAAAACATATAAACTCATAATATAACTGTCATCGAAACGTTAAGTGTGCGGACCCTACGGGTTCGAGAACTATGTAGACATGACCGAGACACGTCTCCGGTCAAAAACCAATAGCAGAACCTAGATGCTCATATTGGCTCCCACATATTCTACGAAGATCTTTATCGGTCAAACCGCATAACAACATACGTTGTTCCCTTTGTCATCGGTATGTTACTTGCCCGAGATTCGATCGTCGGTATCTCAATACCTAGTTCAATCTCGTTACCGGCAAGTCTCTTTACTCGTTCCGTAATACATCATCCCGCAACTAACTCATTAGTTACAATGCTTGCAAGGCTTATAGTGATGTGCATTACTGAGTGGGCCCAGAGATACCTCTCCGACAATCGGAGTGACAAATCCTAATCTCGAAATACGCCAACCCAACAAGTACCTTCAGAGACACATGTAGAGCACCTTTATAATCACCCAGTTACGTTCTGACGTTTGGTAGCACACAAAGTGTTCCTCCGGTAAACGGGAGTTCCATAATCTCATAGTCATAGGAACATGTGTAAGCCAGGGACAAGCCAGTGAGTACGTTTGAATGTACCCGCAAACATTAAGAACACGGGTATAATATAACAAGGGGTAATCATACTCCAAAATATTTTATGATGATAACGTCTTCCATGAAGTAAACCAAAATCTGTGATGCACGCATGTAGGTAAAATAGGAGCATGCAATACGGGAGTAGAAATAGAATGCGCTGATCGAGTGTCTCAAATGACTCCTCGAAAGGGTGCAAATAAATTAACAATGCCGCAGTCGG。
[0036] In the wheat variety Shijiazhuang 8, which is susceptible to Fusarium head blight, the sequence amplified by this primer is (SEQ ID NO.4):
[0037] The InDel site and Fhb9 Because of the close linkage, it was transformed into a simplified STS marker, named Fhb9-STS, for use in marker-assisted selection breeding. After PCR amplification and agarose gel electrophoresis of the parents “Shi 4185 / Shijiazhuang 8” and their F6 RIL population using this STS marker, it was found that Fhb9-STS could clearly distinguish between the two parents and the heterozygous type (e.g., Figure 2 (as shown), and can be applied to marker analysis of the offspring of exchanged single plants screened in the remaining heterozygous lines.
[0038] Example 3 Specific Application Genotypes of 450 natural populations were identified using the Fhb9-STS marker. The results showed that resistance alleles were relatively rare in the natural populations, with only 6 varieties (1.3%) exhibiting resistance alleles. The results are shown in Table 2.
[0039] Table 2 Genotypes of 450 natural populations
[0040] Note: S: susceptible type; R: resistant type.
[0041] Therefore, the STS molecular marker of the major QTL for wheat resistance to Fusarium head blight in this invention is closely linked to Fusarium head blight resistance, has high diagnostic accuracy, and can be widely used for auxiliary breeding of wheat resistant to Fusarium head blight. During identification, the primer set is used to perform PCR amplification of the genomic DNA to be tested, and the typing can be quickly achieved by the length of the amplified band.
[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. The application of primer sets in the breeding of wheat varieties resistant to Fusarium head blight, characterized in that, The primer sequence is as follows: The forward primer, as shown in SEQ ID NO.1, is 5'-CGGAGCAAGGACCCTAAGAA-3'; The reverse primer, as shown in SEQ ID NO.2, is 5'-CCGACTGCGGCATTGTTAAT-3'; In application, the primer set is used to perform PCR amplification of the genomic DNA to be tested, and PCR products are obtained; Genotyping is performed based on the length of the PCR product; When the PCR product is 988 bp in length, the wheat is of the disease-resistant R type; When the PCR product length is 1578 bp, the wheat is susceptible to the S-type disease.
2. The application of primer sets in the preparation of reagent kits for breeding wheat resistant to Fusarium head blight, characterized in that, The primer sequence is as follows: The forward primer, as shown in SEQ ID NO.1, is 5'-CGGAGCAAGGACCCTAAGAA-3'; The reverse primer, as shown in SEQ ID NO.2, is 5'-CCGACTGCGGCATTGTTAAT-3'; In application, the primer set is used to perform PCR amplification of the genomic DNA to be tested, and PCR products are obtained; Genotyping is performed based on the length of the PCR product; When the PCR product is 988 bp in length, the wheat is of the disease-resistant R type; When the PCR product length is 1578 bp, the wheat is susceptible to the S-type disease.
3. A method for identifying wheat scab resistance, characterized in that, Includes the following steps, Step 1: Extract genomic DNA from wheat seedling leaves to obtain the genomic DNA to be tested; Step 2: Use primer sets to perform PCR amplification of the genomic DNA to be tested, and obtain PCR products; The primer sequence is as follows: The forward primer, as shown in SEQ ID NO.1, is 5'-CGGAGCAAGGACCCTAAGAA-3'; The reverse primer, as shown in SEQ ID NO.2, is 5'-CCGACTGCGGCATTGTTAAT-3'; Step 3: Genuine the PCR product based on its length; When the PCR product is 988 bp in length, the wheat is of the disease-resistant R type; When the PCR product length is 1578 bp, the wheat is susceptible to the S-type disease.
Citation Information
Patent Citations
KASP marker primer group of wheat scab resistance candidate gene TaRAR1 and identification method
CN115717175A
KASP molecular marker closely linked with wheat scab resistance major QTL and application of KASP molecular marker closely linked with wheat scab resistance major QTL
CN117867165A