A primer set of a molecular marker for identifying corn kernel pericarp thickness and application thereof

Abstract

This invention belongs to the field of plant genetics and breeding, specifically disclosing a primer set for identifying the thickness of maize kernel pericarp and its application. The primer set includes Primer_X, Primer_Y, and Primer_C, with the molecular marker being the SNP locus 6_159521083. Using the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 as the reference genome, the SNP is located at 159521083 bp on chromosome 6, representing a C / T mutation. This invention identifies a locus significantly correlated with maize kernel pericarp thickness. This locus is located at 159521083 bp on chromosome 6. A C / C genotype corresponds to a thin maize kernel pericarp, while a T / T genotype corresponds to a thick maize kernel pericarp. This molecular marker allows for early identification and screening of maize varieties with thin kernel pericarps suitable for consumption, and varieties with thick kernel pericarps suitable for feed and exhibiting good insect resistance, thereby significantly reducing production costs and improving production efficiency.

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding, and in particular to a primer set for a molecular marker used to identify the pericarp thickness of maize kernels and its application. Background Technology

[0002] The pericarp is the outer protective layer of the corn kernel. It protects the embryo and endosperm from mechanical damage and pests. Furthermore, it regulates the rate of kernel dehydration and maturation, as well as water absorption during germination. Studies have shown that corn pericarp thickness is related to seed quality, popcorn quality, resistance to pathogens, seed maturity, and moisture content.

[0003] Pericarp thickness is one of the key traits in maize breeding. For common maize used as feed, excessively thin pericarps can easily lead to kernel cracking during the milk stage, increasing water loss and the risk of pathogen infection, thereby reducing seed germination rate and storage quality. Therefore, screening for materials with suitable pericarp thickness through genetic mapping is of great significance for breeding crack-resistant and storage-resistant feed maize varieties, and helps to achieve the goal of high-quality breeding of common maize for feed use.

[0004] Traditional breeding methods mainly rely on direct phenotypic measurement and selection of pericarp thickness. This process is time-consuming, labor-intensive, highly susceptible to environmental factors, and cannot effectively screen for recessive genes in early generations (such as seedlings). With the development of molecular biology, marker-assisted selection (MAS) technology can be used to select genotypes through DNA markers closely linked to the target trait, which can significantly improve breeding efficiency and accuracy.

[0005] Competitive allele-specific PCR (KASP) is a high-throughput genotyping technique based on SNPs. Its principle is to use specific primers designed for SNP sites to determine the genotype of a sample through fluorescence signals. KASP technology has significant advantages such as high throughput, low cost, high accuracy, high flexibility (no need to customize special fluorescent probes for each site), and relatively relaxed requirements on DNA quality, and has been widely used in molecular breeding of crops such as rice and wheat.

[0006] However, in the field of maize pericarp thickness breeding, there is still a technological gap in developing a dedicated SNP marker and detection system by associating KASP technology with identified and re-validated key QTLs / genes related to pericarp thickness. Existing technologies have failed to effectively integrate the complete chain of "trait genetic analysis - high-throughput SNP genotyping - efficient breeding selection". Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides a primer set of molecular markers for identifying the pericarp thickness of maize kernels and its application.

[0008] To achieve the above objectives, the present invention is implemented according to the following technical solution: One objective of this invention is to provide a primer set for molecular markers used to identify the pericarp thickness of maize kernels, the primer set comprising: Primer_X:GATGGTGTCAAGGTAGTGCAAC; Primer_Y:GTGATGGTGTCAAGGTAGTGCAAT; Primer_C:GCTCCAGCTCCGCCATTGCTT; The molecular marker is SNP site 6_159521083, which is located at 159521083 bp on chromosome 6 of the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 and is a C / T mutation. The sequences of 50 bp before and after SNP site 6_159521083 are shown in SEQ ID NO.1.

[0009] Furthermore, the Primer_X has a FAM fluorescent group attached to its end, and the Primer_Y has a HEX fluorescent group attached to its end.

[0010] The second objective of this invention is to provide an application of the above-mentioned primer set in assisted selection breeding for identifying maize kernel pericarp thickness, comprising the following steps: S1. Genomic DNA was extracted from the young leaves of the corn to be identified, and quantitative real-time PCR was performed using a primer set of molecular markers for identifying the thickness of the corn kernel pericarp. S2. If the genotype of SNP locus 6_159521083 is C / C, the corn kernels to be identified have thin pericarps; if the genotype of SNP locus 6_159521083 is T / T, the corn kernels to be identified have thick pericarps.

[0011] Further, in step S1, the real-time PCR reaction system consists of 5 μL DNA, 5 μL 2×KASPMasterMix, and 0.14 μL of a mixture of primers consisting of primer_X, primer_Y, and primer_C in a volume ratio of 1:1:2.5; the PCR reaction program is 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 32 cycles.

[0012] Compared with existing technologies, this invention identifies a locus that is significantly correlated with the thickness of corn kernel pericarps. This locus is located at 159521083 bp on chromosome 6. When the genotype is C / C, the corn kernel pericarps are thin, and when the genotype is T / T, the corn kernel pericarps are thick. This molecular marker can be used to identify and screen corn varieties with thin kernel pericarps that are suitable for consumption at an early stage, and to identify and screen corn varieties with thick kernel pericarps that are suitable for feed and have good insect resistance, thereby greatly saving production costs and improving production efficiency. Attached Figure Description

[0013] Figure 1 Frequency distribution of pericarp thickness on the dorsal side of the kernel in a population of inbred lines of maize.

[0014] Figure 2 Manhattan plot of pericarp thickness on the dorsal embryo side of maize kernels obtained using the MLM method in TASSEL software.

[0015] Figure 3 This is a schematic diagram for analyzing the superior haplotype effect.

[0016] Figure 4 A schematic diagram illustrating the development and utilization of the optimal haplotype functional marker for 6_159521083. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0018] Example 1: Identification of SNP sites significantly correlated with corn kernel pericarp thickness 1. Materials A total of 543 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.

[0019] 2. Experimental Methods 2.1 Determination of corn kernel pericarp thickness using a thickness gauge Several maize kernels from an inbred line population harvested in Lingshui, Hainan were randomly selected. After drying, the kernels were soaked in a diluted glycerol solution (glycerol:water = 3:1) for 24 hours to soften (Reference: Hong Yunian. Determination of sweet corn pericarp thickness using a micrometer [J]. Shanghai Journal of Agricultural Sciences, 1995, 11(4):51-54.). Then, the kernels were removed and the top third of each kernel was cut off horizontally with a double-edged blade. Subsequently, the pericarp of the middle region (2×4mm) on the dorsal embryo side of the kernel was cut off. The pericarp thickness was measured using a YHT127 digital thickness gauge and the data were recorded. The frequency distribution of pericarp thickness on the dorsal embryo side of the maize kernels from the inbred line population is shown in the figure below. Figure 1 As shown in Table 1.

[0020] Table 1 Statistical analysis of pericarp thickness on the dorsal side of corn kernels ; Note: a Represents μm; h2 b It indicates broad heritability.

[0021] Depend on Figure 1 As shown in Table 1, the thickness of the pericarp on the dorsal embryo of maize kernels in the Lingshui environment of Hainan ranges from 38.80 to 241.40 μm with an average of 106.49 μm, and the skewness and kurtosis are 0.96 and 1.17, respectively.

[0022] 2.2 Genome-wide association analysis This embodiment uses the mixed linear model (MLM) of TASSEL 5.0 software to perform phenotypic association analysis on Lingshui, Hainan.

[0023] Manhattan plot of maize kernel pericarp thickness obtained using the MLM method in TASSEL software is shown below. Figure 2 As shown.

[0024] Before visualizing the results, SNP sites with P-values ​​> 2.E-03 were removed. Based on the Bonferroni correction method, a threshold P = -log[…]. 10 (1e-5) To eliminate false negatives caused by overly strict Bonferroni correction and to identify more candidate genes affecting maize kernel pericarp thickness, another threshold, P=1 / SNP count, was set as a reference. Manhattan plots were then generated using the CMplot package in R. The significant SNP sites from the GWAS results were named as follows: SNP chromosome number_physical location.

[0025] In 2023, 251 SNP loci were identified in Lingshui, Hainan Province, including 172 on chromosome 6, 64 on chromosome 5, and 15 on chromosome 2. The major SNPs were located on chromosome 6, and two closely adjacent SNPs were located within the target region on chromosome 6. To reduce redundancy in subsequent analyses, we selected a core tagSNP (6_159521083) as the representative of this linkage region for further research, using r² ≥ 0.8 as the criterion.

[0026] This embodiment identifies a locus controlling maize kernel pericarp thickness based on genome-wide association analysis. This locus is located at 159521083 bp on chromosome 6 (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as maize B73V5 reference genome), named SNP locus 6_159521083. When the genotype of SNP locus 6_159521083 is C / C, the maize kernel pericarp is thin; when the genotype of SNP locus 6_159521083 is T / T, the maize kernel pericarp is thick.

[0027] For SNP site 6_159521083, 50 bp sequences were extracted from the front and rear of chromosome 6 at position 159521083 of the maize B73V5 reference genome: TCCAGCGCCGATGGCATGCATGTGAATGTGATGGTGTCAAGGTAGTGCAA Y AGGAAGCAATGGCGGAGCTGGAGCCGGAGCCCGGGCATGTTCCTAGGCTT (See SEQ ID NO.1, the underlined Y indicates SNP site 6_159521083).

[0028] The KASP marker detection primer sequences obtained according to the primer design principles are shown in Table 2.

[0029] Table 2 Primer Sequences ; Using genomic DNA from a maize inbred line population as a template, quantitative real-time PCR amplification was performed using the primers described above. The quantitative real-time PCR reaction system consisted of 5 μL DNA, 5 μL 2×KASPMasterMix (2×KASP Master Mix is ​​a universal kit from LGC (Laboratory of the Government Chemist), applicable to all KASP experiments, and operated according to the product instructions), and 0.14 μL of a mixture of primers X, Y, and C in a volume ratio of 1:1:2.5. The PCR reaction program was 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 32 cycles. The FAM and HEX signals were then scanned and the results were output using a qPCR instrument (CFX96 Real-Time PCR Deduction System, BIO-RAD, USA), and finally converted to genotypes.

[0030] like Figure 3 As shown, the 543 maize inbred lines were divided into two haplotypes, Hap1 and Hap2, according to SNP locus 6_159521083. The differences in maize kernel pericarp thickness between the two haplotypes were then compared. 284 inbred lines had a C / C genotype (or Hap1 allele) at SNP locus 6_159521083, and 169 lines had a T / T genotype (or Hap2 allele). Other heterozygous loci were excluded. Compared to haplotype Hap1, the average maize kernel pericarp thickness of haplotype Hap2 inbred lines was 12.6% higher (p<0.0001). Therefore, Hap2 is the haplotype with the thickest maize kernel pericarp, accounting for 31%.

[0031] Example 2: Assisted selection breeding for identifying corn kernel pericarp thickness Genomic DNA was extracted from the young leaves of the maize to be identified, and quantitative real-time PCR was performed using a primer set of molecular markers for identifying the thickness of the maize kernel pericarp (the quantitative real-time PCR reaction system and reaction procedure are the same as in Example 1). If the genotype of SNP locus 6_159521083 is C / C, the maize kernel pericarp to be identified is thin; if the genotype of SNP locus 6_159521083 is T / T, the maize kernel pericarp to be identified is thick.

[0032] Twenty maize inbred lines with a pericarp thickness of 100 μm or less and 20 maize inbred lines with a pericarp thickness greater than 130 μm were randomly selected. Three plants from each inbred line were pooled, and DNA was extracted. Genotyping was performed using KASP primers developed from the optimal allele of SNP locus 6_159521083 in Example 1. The results are shown in Table 3 and... Figure 4 As shown.

[0033] Table 3. KASP marker 6_159521083 used for the evaluation of corn pericarp thickness. ; Note: All inbred lines in Table 3 can be found in the database at https: / / www.ncbi.nlm.nih.gov / .

[0034] From Table 3 and Figure 4 It was found that inbred lines with a pericarp thickness of 100 μm or less all belonged to the Hap1 allele, while 20 inbred lines with a pericarp thickness greater than 130 μm all belonged to the Hap2 allele. These results confirm that the developed functional markers can be used for early identification and screening of corn varieties with thin pericarps suitable for consumption, and for identifying and screening corn varieties with thick pericarps suitable for feed and with good insect resistance, thereby greatly saving production costs and improving production efficiency.

[0035] In summary, this invention can identify and screen corn varieties with thin kernel pericarps suitable for consumption at an early stage by using SNP locus 6_159521083; and identify and screen corn varieties with thick kernel pericarps suitable for feed and with good insect resistance.

[0036] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. The application of a primer set of molecular markers for identifying maize kernel pericarp thickness in assisted selection breeding for identifying maize kernel pericarp thickness, characterized in that, Includes the following steps: S1. Genomic DNA was extracted from the young leaves of the corn to be identified, and quantitative real-time PCR was performed using a primer set of molecular markers for identifying the thickness of the corn kernel pericarp. The primer set for molecular markers used to determine the thickness of maize kernel pericarps includes: Primer_X:GATGGTGTCAAGGTAGTGCAAC; Primer_Y:GTGATGGTGTCAAGGTAGTGCAAT; Primer_C:GCTCCAGCTCCGCCATTGCTT; The molecular marker is SNP site 6_159521083, which is located at 159521083 bp on chromosome 6 of the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 and is a C / T mutation. The sequences of 50 bp before and after SNP site 6_159521083 are shown in SEQ ID NO.

1. S2. If the genotype of SNP locus 6_159521083 is C / C, the corn kernels to be identified have thin pericarps; if the genotype of SNP locus 6_159521083 is T / T, the corn kernels to be identified have thick pericarps.

2. The application according to claim 1, characterized in that: The Primer_X has a FAM fluorescent group attached to its end, and the Primer_Y has a HEX fluorescent group attached to its end.

3. The application according to claim 1, characterized in that, In step S1, the real-time PCR reaction system consists of 5 μL DNA, 5 μL 2×KASPMasterMix, and 0.14 μL of a mixture of primers (primer_X, primer_Y, and primer_C) in a volume ratio of 1:1:2.

5. The PCR reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 32 cycles.

Images