A gene, vector, and strain for multi-gene synergistic expression to enhance reducing power and produce high levels of monensin.
Patent Information
- Application Number
- CN202511987136.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2045-12-26
AI Technical Summary
目前,莫能菌素的工业化生产主要依赖微生物发酵,但野生型菌株的产量较低,且受限于代谢网络中的关键辅因子供应,莫能菌素的生物合成过程需要大量 NADPH和NADH作为还原力(如聚酮链延伸阶段的还原反应),胞内NADPH和NADH的总量是限制其产量的核心瓶颈之一
[0015] Beneficial Effects: This invention achieves the synergistic expression of glucose-6-phosphate dehydrogenase (zwf), 6-phosphate gluconate dehydrogenase (gnd), and 3-hydroxyacyl-ACP dehydratase (fadB) in host bacteria by constructing a highly reducing power donor fusion gene. Specifically, zwf catalyzes the conversion of glucose-6-phosphate to 6-phosphate gluconate, accompanied by NADPH synthesis; gnd catalyzes the conversion of 6-phosphate gluconate to 5-phosphate ribulose, with the generation of another NADPH molecule during this process; and fadB indirectly regulates NADH regeneration through the fatty acid β-oxidation pathway. The synergistic effect of these three enzymes increases the intracellular NADPH and NADH levels in the host cell by approximately two-fold, providing sufficient reducing power support for the biosynthesis of monensin.
Smart Images

Figure CN121699952B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a gene, vector, and strain that enhances reducing power and produces high levels of monensin through multi-gene synergistic expression. Background Technology
[0002] Monensin is a polyether antibiotic produced by Streptomyces (such as *Streptomyces cinnamonii*), possessing broad-spectrum anticoccal and growth-promoting effects, and is widely used in animal husbandry and veterinary medicine. Currently, the industrial production of monensin mainly relies on microbial fermentation, but the yield of wild-type strains is low, and its production is limited by the supply of key cofactors in the metabolic network. The biosynthesis of monensin requires large amounts of NADPH and NADH as reducing agents (such as the reduction reaction in the polyketide chain elongation stage), and the total amount of intracellular NADPH and NADH is one of the core bottlenecks limiting its yield.
[0003] Although some genes can increase the amount of NADPH or NADH, the increase is small and there is a lack of synergistic regulation among the genes; moreover, commonly used vectors such as pSET152 have insufficient integration efficiency or stability in Streptomyces cinnamon, which affects the sustained expression of exogenous genes. Summary of the Invention
[0004] To address the shortcomings of the above technologies, this invention provides a gene, vector, and recombinant strain for multi-gene synergistic expression to enhance reducing power and produce high levels of monensin. Through synergistic overexpression of various genes, the intracellular supply levels of NADPH and NADH are significantly increased, thereby effectively enhancing monensin production.
[0005] Specifically, the present invention provides a high reducing power donor fusion gene, which is composed of the encoding genes of glucose-6-phosphate dehydrogenase, 6-phosphate gluconate dehydrogenase and 3-hydroxyacyl-ACP dehydratase connected in series.
[0006] In a preferred embodiment of the present invention, the nucleotide sequence of the gene encoding glucose-6-phosphate dehydrogenase is shown in SEQ ID No. 1, the nucleotide sequence of the gene encoding 6-phosphate gluconate dehydrogenase is shown in SEQ ID No. 2, and the nucleotide sequence of the gene encoding 3-hydroxyacyl-ACP dehydratase is shown in SEQ ID No. 3.
[0007] The present invention also provides a recombinant expression vector comprising the above-mentioned high-reducing-potency donor fusion gene.
[0008] In a preferred embodiment of the present invention, the recombinant expression vector comprises a PermE strong promoter, a multiple cloning site, and an fd transcription terminator; wherein the high-reducing-potency donor fusion gene is located at the multiple cloning site, and the PermE strong promoter is connected upstream of the high-reducing-potency donor fusion gene, and the fd transcription terminator is located downstream of the high-reducing-potency donor fusion gene; The nucleotide sequence of the PermE strong promoter is shown in SEQ ID No. 4, and the nucleotide sequence of the fd transcription terminator is shown in SEQ ID No. 5.
[0009] In a preferred embodiment of the present invention, the backbone of the recombinant expression vector is the pSET152 plasmid.
[0010] The present invention also provides a method for constructing the above-mentioned recombinant expression vector, comprising the following steps: assembling a zwf gene fragment containing a glucose-6-phosphate dehydrogenase encoding gene, a gnd gene fragment containing a 6-phosphate gluconate dehydrogenase encoding gene, a fadB gene fragment containing a 3-hydroxyacyl-ACP dehydrase encoding gene, and a linearized vector fragment to obtain the recombinant expression vector. The linearized vector fragment contains the PermE strong promoter, the vector backbone, and the fd transcription terminator.
[0011] In a preferred embodiment of the present invention, the zwf gene fragment, gnd gene fragment, and fadB gene fragment are all obtained by amplification from the genome of *Streptomyces cinnamon* via PCR reaction; wherein the nucleotide sequences of the primer pairs used to amplify the zwf gene fragment are as shown in SEQ ID No. 6 and SEQ ID No. 7, the nucleotide sequences of the primer pairs used to amplify the gnd gene fragment are as shown in SEQ ID No. 8 and SEQ ID No. 9, and the nucleotide sequences of the primer pairs used to amplify the fadB gene fragment are as shown in SEQ ID No. 10 and SEQ ID No. 11.
[0012] The present invention also provides a recombinant Streptomyces, wherein the recombinant Streptomyces comprises the above-described recombinant expression vector, or is obtained by transforming Streptomyces with a recombinant expression vector constructed by the above-described construction method.
[0013] The present invention also provides a method for constructing the above-mentioned recombinant Streptomyces, comprising: introducing the above-mentioned recombinant expression vector, or the recombinant expression vector constructed using the above-mentioned construction method, into a Streptomyces host via indirect synergistic transfer, and screening to obtain positive transformants, thereby obtaining the recombinant Streptomyces.
[0014] The present invention also provides a method for producing monensin, comprising: culturing the above-mentioned recombinant Streptomyces and harvesting monensin from the culture product.
[0015] Beneficial Effects: This invention achieves the synergistic expression of glucose-6-phosphate dehydrogenase (zwf), 6-phosphate gluconate dehydrogenase (gnd), and 3-hydroxyacyl-ACP dehydratase (fadB) in host bacteria by constructing a highly reducing power donor fusion gene. Specifically, zwf catalyzes the conversion of glucose-6-phosphate to 6-phosphate gluconate, accompanied by NADPH synthesis; gnd catalyzes the conversion of 6-phosphate gluconate to 5-phosphate ribulose, with the generation of another NADPH molecule during this process; and fadB indirectly regulates NADH regeneration through the fatty acid β-oxidation pathway. The synergistic effect of these three enzymes increases the intracellular NADPH and NADH levels in the host cell by approximately two-fold, providing sufficient reducing power support for the biosynthesis of monensin.
[0016] This invention further constructed an expression vector containing the fusion gene and introduced it into *Streptomyces cinnamon*, significantly increasing monensin production. The obtained recombinant strain exhibited good genetic stability, maintaining a yield retention rate of over 90% after five consecutive generations of passaging. This invention achieves efficient multi-pathway supply of reducing power through a simple gene combination and strong promoter strategy, demonstrating promising prospects for industrial application.
[0017] Biological Preservation Information Streptomyces cinnamon Streptomyces cinnamoneus SDSL6002 was deposited on April 22, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 30409. Attached Figure Description
[0018] Figure 1 The image shows the effect of the single-gene overexpression strain S-zwf. In the image, A: catalytic reaction of zwf, B: glucose-6-phosphate dehydrogenase activity, C: NADPH content, and D: monensin titer. Figure 2 The diagram shows the effect of the single-gene overexpression strain S-gnd. In the diagram, A: catalytic reaction of gnd, B: 6-phosphoglucate dehydrogenase activity, C: NADPH content, and D: monensin titer. Figure 3 The image shows the effect of the single-gene overexpression strain S-fadB. In the image, A represents the catalytic reaction of fadB, B represents the NADH content, and C represents the monensin titer. Figure 4 The image shows the effect of the three-gene co-expression strain S-zwf-gnd-fadB. In the image, A: recombinant vector structure, B: NADPH content, C: NADH content, and D: monensin titer. Figure 5 The image shows the effect of the dual-gene co-expression strain S-zwf-gnd. In the image, A: recombinant vector structure, B: NADPH content, and C: monensin titer. Figure 6 The image shows the effect of the dual-gene co-expression strain S-zwf-fadB. In the image, A: recombinant vector structure, B: NADPH content, C: NADH content, and D: monensin titer. Figure 7 The image shows the effect of the dual-gene co-expression strain S-gnd-fadB. In the image, A: recombinant vector structure, B: NADPH content, C: NADH content, and D: monensin titer. Figure 8 The image shows the effect of the empty vector control strain (S-pSET152, referred to as S-EV in the figure). In the figure, A: NADPH content, B: NADH content, and C: monensin titer. Figure 9 DNA electrophoresis gel image; Figure 10 A schematic diagram of the carrier construction. Detailed Implementation
[0019] This invention provides a high reducing power donor fusion gene, which structurally comprises, in sequence, a glucose-6-phosphate dehydrogenase (zwf) encoding gene, a 6-phosphate gluconate dehydrogenase (gnd) encoding gene, and a 3-hydroxyacyl-ACP dehydratase (fadB) encoding gene.
[0020] The *zwf* gene, encoding glucose-6-phosphate dehydrogenase, catalyzes the conversion of glucose-6-phosphate to 6-phosphogluconic acid, accompanied by NADPH synthesis. The *gnd* gene, encoding 6-phosphoglucate dehydrogenase, participates in the pentose phosphate pathway, further catalyzing the generation of NADPH. The *fadB* gene, encoding 3-hydroxyacyl-ACP dehydratase, indirectly regulates NADH regeneration through the fatty acid β-oxidation pathway. This invention, by fusing and co-overexpressing these three genes, produces a significant synergistic effect, increasing the total amount of NADPH and NADH in the host cell by approximately two times compared to the wild-type strain. This enhancement is significantly superior to overexpressing any single gene or any combination of two genes alone.
[0021] In one embodiment of the present invention, the nucleotide sequence of the zwf gene is shown in SEQ ID No. 1; the nucleotide sequence of the gnd gene is shown in SEQ ID No. 2; The nucleotide sequence of the gene encoding fadB is shown in SEQ ID No. 3.
[0022] The present invention also provides an expression vector containing the above-mentioned high-reducing-power donor fusion gene.
[0023] In a preferred embodiment of the present invention, the expression vector is based on the pSET152 plasmid as a backbone. Its... The C31 integrase coding sequence, conjugation origin (oriT), and apramycin resistance gene (aac(3)-IV, Apr) were used as selection markers. To drive efficient expression of the fusion genes, the strong promoter PermE, universally used by Streptomyces, was introduced to ensure synchronous and efficient overexpression of the zwf, gnd, and fadB genes in Streptomyces cinnamonis. Downstream of the fadB gene, a transcription terminator fd was connected. The fd terminator effectively avoids the adverse effects on vector stability caused by excessively long exogenous gene transcripts, prevents transcriptional interference between different gene units, ensures the independence of gene expression, and helps improve mRNA stability, thereby indirectly improving the translation efficiency of the target protein.
[0024] In one embodiment of the present invention, the nucleotide sequence of the PermE strong promoter is shown in SEQ ID No. 4: GTGCACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCCACAT. The nucleotide sequence of the transcription terminator fd is shown in SEQ ID No. 5: AAAATCTCCAAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATCGGT.
[0025] The construction process of the pSET152 plasmid containing the ermE promoter and fd terminator in this embodiment of the invention is as follows: (1) Preparation of linearized pSET152 vector fragment Using pSET152 plasmid as a template, polymerase chain reaction (PCR) was employed for amplification. The primer pair used included: upstream primer Fd-F (SEQ ID No. 16), whose 5' end contains a 49-base fd terminator homologous sequence; and downstream primer Fd-R (SEQ ID No. 17). PCR was performed using these primer pairs to obtain a linearized pSET152 vector fragment. This fragment contains homologous regions at both ends to the subsequent insertion fragment: its 5' end carries a complete fd terminator sequence as a homologous arm, and its 3' end contains a sequence complementary to the downstream region of the ermE promoter.
[0026] (2) Amplification of the ermE promoter fragment Using a synthesized ermE promoter DNA fragment (120 bp in length) as a template, an ermE promoter fragment with homologous arms at both ends was obtained by PCR amplification. The primer pair used was: upstream primer ermE-fd-F (SEQ ID No. 18), whose sequence contains a homologous region complementary to the 3' end of the linearized pSET152 vector fragment; downstream primer ermE-fd-R (SEQ ID No. 19), whose sequence contains a homologous region complementary to the fd terminator region. After PCR amplification, the 5' end of the obtained ermE promoter fragment was homologous to the downstream region of the vector, and the 3' end was homologous to the fd terminator sequence.
[0027] Fd-F (SEQ ID No. 16): ACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTATGTTGGGGATCCTCTAGA; Fd-R (SEQ ID No. 17): CTGCGATCGCCGATC; ermE-fd-F (SEQ ID No. 18):GATCGGCGATCGCAGGTGCACGCGGTCGATCT; ermE-fd-R (SEQ ID No. 19): GAGCCTTTAATTGTATCGGTATGTGGATCCTACCAACCGGC.
[0028] This invention also provides a method for constructing the above-mentioned expression vector, comprising the following steps: (1) Using the genome of Streptomyces cinnamonis as a template, amplification was performed using primer pairs zwf-F and zwf-R, gnd-F and gnd-R, and fadB-F and fadB-R, respectively, to obtain the zwf fragment encoding glucose-6-phosphate dehydrogenase, the gnd fragment encoding 6-phosphate gluconate dehydrogenase, and the fadB fragment encoding 3-hydroxyacyl-ACP dehydratase; the nucleotide sequence of zwf-F is shown in SEQ ID No. 6, the nucleotide sequence of zwf-R is shown in SEQ ID No. 7, the nucleotide sequence of gnd-F is shown in SEQ ID No. 8, the nucleotide sequence of gnd-R is shown in SEQ ID No. 9, the nucleotide sequence of fadB-F is shown in SEQ ID No. 10, and the nucleotide sequence of fadB-R is shown in SEQ ID No. 11; (2) Using pSET152 plasmid as template, amplification was performed using primer pair PF and PR to obtain linearized pSET152 plasmid fragment; the nucleotide sequence of PF is shown in SEQ ID No. 12, and the nucleotide sequence of PR is shown in SEQ ID No. 13; (3) The zwf fragment, gnd fragment and fadB fragment obtained in step (1) are combined with the linearized pSET152 plasmid fragment (PermE strong promoter and fd terminator) obtained in step (2) to perform Gibson assembly to obtain the expression vector.
[0029] In one embodiment of the present invention, when amplifying the zwf fragment using the high-fidelity enzyme 2×Super Pfx Master Mix for PCR amplification, the extracted *Streptomyces cinnamon* genome is used as a template, and zwf-F and zwf-R are used as primers. The PCR amplification program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 26 s, for 30 cycles; and 72℃ final extension for 4 min.
[0030] zwf-F (SEQ ID No. 6): GGTTGGTAGGATCCACATAACACCATCGCGGGCAC; zwf-R (SEQ ID No. 7): GAGCCTTTAATTGTATCGGTTTGATGACCACGAGGGTGC.
[0031] In one embodiment of the present invention, when amplifying the gnd fragment using the high-fidelity enzyme 2×Super Pfx Master Mix, the extracted *Streptomyces cinnamon* genome is used as a template, and gnd-F and gnd-R are used as primers. The PCR amplification program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 26 s, 30 cycles; and a final extension at 72℃ for 3 min.
[0032] gnd-F (SEQ ID No. 8):GGTTGGTAGGATCCACATTACAAGTACCTGATCATGCCTGTACG; gnd-R (SEQ ID No. 9): GAGCCTTTAATTGTATCGGTTTGGTCTTGCCCTGTCCGT.
[0033] In one embodiment of the present invention, when amplifying the fadB fragment using the high-fidelity enzyme 2×Super Pfx Master Mix, the extracted *Streptomyces cinnamon* genome is used as a template, and fadB-F and fadB-R are used as primers. The PCR amplification reaction program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 60℃ annealing for 35 s, 72℃ extension for 26 s, 30 cycles; and 72℃ final extension for 5 min.
[0034] fadB -F (SEQ ID No.10):GGTTGGTAGGATCCACATTACGCCTGATGACGCAGC; fadB -R (SEQ ID No. 11): GAGCCTTTAATTGTATCGGTTACGGGAGTTGTCCCGTACG.
[0035] In one embodiment of the present invention, using pSET152 plasmid as a template and PF and PR as primers, a reverse PCR amplification reaction is performed using a high-fidelity enzyme 2×Super Pfx Master Mix. The PCR amplification reaction program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 45 s, 30 cycles; and 72℃ final extension for 7 min to obtain a linearized pSET152 plasmid fragment.
[0036] PF (SEQ ID No. 12): ACCGATACAATTAAAGGCTC; PR (SEQ ID No. 13): ATGTGGATCCTACCAACCGGC.
[0037] This invention involves using the linearized pSET152 plasmid fragment containing the strong promoter PermE and the fd terminator, along with zwf, gnd, and fadB, and performing Gibson assembly using the Hieff Clone® Plus Multi One Step Cloning Kit to obtain pSET152-PermE. zwf-gnd-fadB-fd Ter recombinant vector; reaction conditions 50℃, 20~30 min; 10μL reaction system consisted of: 5 μL Clone® Plus Multi One Step Cloning Kit, 0.02pmol linearized pSET152 plasmid fragment, 0.02pmol zwf, 0.02pmol gnd, and 0.02pmol fadB.
[0038] The present invention also provides a recombinant Streptomyces containing the above-described expression vector or an expression vector constructed using the above-described construction method.
[0039] In one embodiment of this invention, *Streptomyces cinnamonensis* is used as the host strain. Specifically, the host strain is *Streptomyces cinnamonensis* SDSL6002, with accession number CGMCC No. 30409. Compared to the wild-type strain, the recombinant *Streptomyces* strain constructed in this invention exhibits a two-fold increase in total intracellular NADPH and NADH, providing sufficient reducing power for monensin biosynthesis. Simultaneously, the monensin yield of the recombinant strain is 45%–55% higher than that of the wild-type strain, and it demonstrates good genetic stability, maintaining a yield retention rate of over 90% after five consecutive passages. The present invention also provides a method for constructing the above-mentioned recombinant Streptomyces, comprising the following steps: transforming the above-mentioned expression vector or the expression vector constructed using the above-mentioned method into E. coli ET12567 / pUZ8002 donor bacteria, performing genus-to-generic ligation transfer with competent cells of Streptomyces, selecting conjugates, and obtaining the recombinant Streptomyces.
[0040] In this embodiment of the invention, the pSET152-PermE is first... The zwf-gnd-fadB-fd Ter recombinant vector was transformed into E. coli JM109 competent cells. Positive clones were initially screened by PCR and sequenced for verification. The correct recombinant plasmid was then further transformed into... E. coli The ET12567 / pUZ8002 donor strain (a kind gift from the laboratory of Jiangnan University, and previously published in the article: Xin Ying, Zhang Shanfei, Liu Minwei, et al. Heterologous expression of the vgb gene of *Streptomyces cinnamonis* producing high monensin [J]. Food and Fermentation Industries, 2024, 50(10): 1-9. DOI: 10.13995 / j.cnki.11-1802 / ts.037949.) was amplified in LB medium with triple antibodies (25 μg / mL Apr, 15 μg / mL Chl and 20 μg / mL Kan), and then washed with antibiotic-free LB medium with MgCl2 to a final concentration of 20 mM to obtain a donor strain suitable for indirect genus fusion transfer.
[0041] The E. coli JM109 competent cells described in this invention can be prepared by the CaCl2 method, which includes the following steps: Day 1: Activate the strain: streak the frozen strain at -80℃ onto LB agar plates (without antibiotics) and incubate overnight at 37℃. Pick a single colony and transfer it to 3 mL SOB, then pre-incubate overnight at 37℃ and 200 rpm.
[0042] Second day, main culture: Transfer 300 μL of overnight bacteria at a 1:100 ratio to a 30 mL SOB (250 mL Erlenmeyer flask), and incubate at 37°C with shaking at 200 rpm until OD is reached. 600 =0.4~0.5 (approximately 2~2.5h).
[0043] Immediately place in an ice bath for 10 minutes, then stop shaking. Centrifuge at 4℃ and 4000g for 10 minutes, then discard the supernatant.
[0044] Wash with CaCl2, resuspend in 10 mL of ice-cold TFBII, and gently pipette. Incubate on ice for 30 min.
[0045] Centrifuge at 4000g for 10 min at 4℃, and discard the supernatant. Resuspend each 30 mL original bacterial culture in 600 μL of TFBII (≈50× concentration). Aliquot 50 μL / tube on ice, flash freeze in liquid nitrogen, and then store at -80℃.
[0046] This invention uses *Streptomyces cinnamonensis* SDSL6002 as the recipient bacterium. After culturing the recipient bacterium SDSL6002 on SM medium, competent cells are prepared by repeatedly washing the mycelium with 2×YT medium. The culturing time is 30–48 hours.
[0047] During the indirect cloning transfer, donor and recipient bacteria were mixed at a 1:1 volume ratio and plated on antibiotic-free MS plates. The donor bacteria (ET12567) at the time of mixing were approximately 1-2 × 10⁻⁶. 9 CFU / mL, recipient bacteria 1×10 8 ~10 9 Spores / mL. After co-culturing at 30℃ for 18 h, the cells were covered with sterile water containing Nal (naphthylpyridinol acid, final concentration 20 μg / mL) and Apr (amprolium 50 μg / mL) for resistance screening. After 7 days of culture, conjugates were picked, and genomic PCR was performed using 2×Taq MasterMix (Dye) with aac(3)-IV-F and aac(3)-IV-R as primers to amplify the ampramycin resistance marker. The amplification program included: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, 30 cycles; and a final extension for 2 min. After the positive strain was verified to be stable genetically after three generations of relaxation culture on antibiotic-free slant medium, spores were collected for strain preservation. The entire process was confirmed by DNA sequencing to ensure the correct integration of the genome and the successful construction of the overexpression strain.
[0048] aac(3)-IV-F (SEQ ID No. 14): GTGCAATACGAATGGCGAAA; aac(3)-IV-R (SEQ ID No. 15): TCAGCCAATCGACTGGCGAG.
[0049] The present invention also provides the application of the above-mentioned recombinant Streptomyces or the recombinant Streptomyces constructed using the above-mentioned construction method in high-yield monensin production.
[0050] This invention relates to the production of monensin via shake-flask fermentation. In the experiment, the recombinant Streptomyces was inoculated into a shake-flask seed culture (100 mL / 500 mL) and cultured at 33.0 °C and 180 rpm for 24 h. Then, 10% of the inoculum was transferred to fermentation medium (50 mL / 500 mL) and fermented at 33.0 °C and 200 rpm for 12 days.
[0051] The culture medium contained in the shake flask seed of the present invention is: 15 g / L soybean meal, 5 g / L glucose, 20 g / L dextrin, 2.5 g / L yeast extract, and 1 g / L light calcium carbonate. The fermentation culture medium is: 35 g / L soybean meal, 35 g / L glucose, 2.2 g / L Na2SO4, 0.08 g / L K2HPO4, 0.1 g / L FeSO4·7H2O, 0.7 g / L Al2(SO4)3, 45 g / L soybean oil, and 2.5 g / L CaCO3.
[0052] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a gene, vector, and strain for multi-gene synergistic expression that enhances reducing power and produces high levels of monensin, is provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0053] Unless otherwise specified, the experimental methods used in the embodiments of this invention are conventional methods in the art, wherein: 1. Enzyme activity assay *Streptomyces cinnamonensis* cells were resuspended in 100 mM Tris-HCl buffer (pH 7.5) containing 20% glycerol and 1 mM dithiothreitol. The cell suspension was then placed on ice and subjected to sonication to disrupt the cells. Enzyme activities were determined spectrophotometrically. Glucose-6-phosphate dehydrogenase (G6PDH) activity was calculated by monitoring the increase in absorbance at 340 nm for NADPH at 30 °C [Improved oxytetracycline production in *Streptomyces rimosus* M4018 by metabolic engineering of the G6PDH gene in the pentose phosphate pathway]; 6-phosphate gluconate dehydrogenase activity was determined according to the method described in the reference [Red cell metabolism. A manual of biochemical methods]. Changes in absorbance per minute were expressed in units of 0.01 and calculated using the following formula.
[0054] ; In the formula: U: enzyme activity; A: Change in absorbance value during reaction time; t: Reaction time (min); D: Dilution factor.
[0055] 2. Determination of NADPH and NADH content Kit method: Take an appropriate amount of mycelium, homogenize with 0.1M Tris-HCl (pH 7.5), centrifuge and take the supernatant; detect NADPH (refer to Beyotime NADP+ / NADPH Detection Kit (WST-8 method)) and NADH (refer to Beyotime NAD+ / NADH Detection Kit (WST-8 method)).
[0056] 3. Shake-flask fermentation of monensin Single-cell cultures were inoculated into shake flask seed culture (100 mL / 500 mL) and cultured at 33.0 ℃ and 180 rpm for 24 h. Then, 10% of the inoculum was transferred into fermentation medium (50 mL / 500 mL) and fermented at 33.0 ℃ and 200 rpm for 12 days.
[0057] 4. Monensin content determination 1.0 g of fermentation broth was mixed thoroughly with 50 mL of methanol. The mixture was then sonicated at 260 W power, with a pulse on for 2 seconds and a pulse off for 2 seconds, for a total duration of 30 minutes. The crude extract was then filtered through a 0.45 µm organic filter and transferred to a HPLC vial. High-performance liquid chromatography (HPLC) was used with a C18 column (250 × 4.6 mm, 5 µm) and a mobile phase of methanol:water:glacial acetic acid (94:6:0.1). The flow rate was set to 0.7 mL / min. The detection wavelength was 520 nm, and the injection volume was 20.0 µL. The derivatization temperature was maintained at 98 °C. The diluent consisted of a 90:10 mixture of methanol and water.
[0058] Example 1 according to Figure 10 The following experiments were conducted using the procedure shown: (1) PCR amplification fragments and recovery Using the extracted *Streptomyces cinnamon* genome as a template, and zwf-F and zwf-R as primers, PCR amplification was performed using the high-fidelity enzyme 2×Super Pfx Master Mix to obtain... Figure 9 The zwf fragment shown; Using the extracted *Streptomyces cinnamon* genome as a template, and gnd-F and gnd-R as primers, PCR amplification was performed using the high-fidelity enzyme 2×Super Pfx Master Mix to obtain... Figure 9 The gnd fragment shown; Using the extracted *Streptomyces cinnamon* genome as a template, and fadB-F and fadB-R as primers, PCR amplification was performed using a high-fidelity enzyme 2×Super Pfx Master Mix to obtain... Figure 9 The fadB segment shown; Using pSET152 plasmid (containing the ermE promoter and fd terminator) as a template, and PF and PR as primers, reverse PCR amplification was performed using high-fidelity enzyme 2×Super Pfx Master Mix to obtain the linearized pSET152 plasmid fragment. (2) Gibson assembly The linearized vector was assembled with zwf, gnd, fadB, and the three fragments using the Hieff Clone® PlusMulti One Step Cloning Kit to obtain pSET152-PermE. zwf-fd Ter、pSET152-PermE gnd-fd Ter、pSET152-PermE fadB-fd Ter、pSET152-PermE zwf-gnd-fd Ter, pSET152-PermE zwf-fadB-fd Ter, pSET152-PermE gnd-fadB-fd Ter and pSET152-PermE zwf-gnd-fadB-fd Ter recombinant vector; The reaction conditions were: single-fragment ligation at 50℃ for 10 min; multi-fragment ligation at 50℃ for 20-30 min; the reaction system consisted of: Clone® Plus Multi One Step Cloning Kit 5 μL, pre-linearized pSET152 containing the initiator PermE and fd terminator 0.02 pmol, and zwf / gnd / fadB 0.02 pmol.
[0059] (3) Bacterial transformation, colony PCR identification, and identification of binding transfer and recombinant plasmids The recombinant plasmid was transformed into E. coli JM109 competent cells, and positive clones were screened by PCR and sequenced for verification. The confirmed recombinant plasmid was further transformed into E. coli ET12567 / pUZ8002 donor cells. Subsequent intermolecular fusion transfer was performed. The donor cells were amplified on LB medium with triple antibodies (Apr, Chl, Kan) and then washed with antibiotic-free LB medium containing MgCl2. The recipient cells, SDSL6002, were cultured on SM medium and the mycelia were repeatedly washed with 2×YT medium to prepare competent cells. Donor and recipient cells were mixed at a 1:1 ratio and plated on antibiotic-free MS plates. After co-culturing at 30 °C for 18 h, the plates were covered with sterile water containing Na1 and Apr for resistance screening. After 7 days of culture, conjugates were picked, and genomic PCR was performed using 2×Taq MasterMix (Dye) with aac(3)-IV-F and aac(3)-IV-R as primers to amplify the apramycin resistance marker. After the positive strain was stabilized through three generations of relaxation culture on antibiotic-free slant medium, spores were collected. The entire process was confirmed by DNA sequencing to ensure correct genome integration and successful construction of the overexpression strain.
[0060] Using the method described in this invention, single-gene overexpression strains (S-zwf, S-gnd and S-fadB), dual-gene overexpression strains (S-zwf-gnd, S-zwf-fadB, S-gnd-fadB), triple-gene co-expression strains (S-zwf-gnd-fadB), and empty vector control strains (S-pSET152) were successfully constructed.
[0061] Compared with the wild-type WT strain SDSL6002, the intracellular NADPH level and monensin fermentation titer of the single-gene overexpression strain S-zwf were as follows: Figure 1 As shown, overexpression of the glucose-6-phosphate dehydrogenase gene (zwf) effectively enhances the pentose phosphate pathway. The results showed that the intracellular NADPH content of the recombinant strain S-zwf was significantly increased compared to the wild-type strain, with an increase of approximately 1.8-fold, confirming the key role of this gene in enhancing reducing power supply. However, the monensin fermentation titer of this strain did not show a significant improvement compared to the wild-type. This result indicates that although overexpression of the zwf gene alone successfully drives intracellular NADPH production, the single enhancement of reducing NADPH is insufficient to effectively promote the biosynthesis of monensin. This result indirectly demonstrates that the efficient synthesis of monensin is a complex metabolic engineering problem, which, in addition to reducing power supply, strictly depends on the sufficient supply of synthetic precursors (such as methylmalonyl-CoA).
[0062] Compared with wild-type WT, the assay results of the single-gene overexpression strain S-gnd are as follows: Figure 2 As shown, overexpression of the 6-phosphoglucate dehydrogenase gene (gnd) also aims to enhance the latter part of the pentose phosphate pathway. The results showed that the intracellular NADPH content of the recombinant strain S-gnd was significantly increased compared to the wild-type strain, similar to the effect of overexpressing the zwf gene, further confirming the effectiveness of the strategy of enhancing reducing power supply by modifying the pentose phosphate pathway. However, consistent with the results of the S-zwf strain, despite the significantly increased NADPH level, the monensin fermentation titer of the S-gnd strain was not effectively improved. This result is consistent with... Figure 1 Together, these findings form a strong chain of evidence indicating that while enhancing the pentose phosphate pathway (either the first or second half) to provide NADPH can successfully increase intracellular reducing power levels, it is not the sole key factor limiting monensin synthesis. This further supports the aforementioned analysis: high monensin production requires a synergistic effect between reducing power supply and precursor supply. Compared with wild-type WT, the assay results of the single-gene overexpression strain S-fadB are as follows: Figure 3As shown, strain S-fadB directly intervenes in the fatty acid β-oxidation pathway by overexpressing the 3-hydroxyacyl-ACP dehydratase gene. Experimental data show that the intracellular NADH content of this strain was significantly increased, indicating that overexpression of the fadB gene effectively enhances the reducing power regeneration capacity of this metabolic pathway. More importantly, unlike strains that overexpress zwf or gnd genes alone, strain S-fadB showed a significant increase in monensin fermentation titer. This result confirms that regulating the fatty acid metabolic pathway through the fadB gene not only directly replenishes the reducing power NADH required for monensin synthesis, but more importantly, promotes fatty acid degradation, providing essential precursors for monensin synthesis, thereby achieving an effective increase in yield.
[0063] The results of the assay for the three-gene co-expression strain S-zwf-gnd-fadB are as follows: Figure 4 As shown, the zwf, gnd, and fadB genes are co-expressed in tandem through a strong promoter. Figure 4 (A); Compared with wild-type WT, the NADPH and NADH contents of the three-gene co-expression strain S-zwf-gnd-fadB were significantly increased ( Figure 4 The co-expression of the three genes (BC) enhanced intracellular reducing power supply; the monensin titer of the engineered strain was significantly higher than that of the wild type, indicating that the co-expression of the three genes effectively promoted the biosynthesis of monensin by enhancing reducing power. Figure 4 (D).
[0064] The assay results of the dual-gene overexpression strain S-zwf-gnd are as follows: Figure 5 As shown, the zwf and gnd genes are co-expressed in tandem under the strong promoter PermE. Figure 5 (A); Compared with wild-type WT, the NADPH content of the dual-gene overexpression strain S-zwf-gnd was significantly increased ( Figure 5 (B); the monensin titer of this engineered strain was also significantly higher than that of the wild type ( Figure 5 (C). In summary, overexpression of both zwf and gnd genes provides sufficient reducing power for monensin biosynthesis by enhancing intracellular NADPH synthesis, ultimately significantly improving monensin potency.
[0065] Dual gene overexpression strains S- The measurement results of zwf-fadB are as follows: Figure 6 As shown, the zwf and fadB genes are co-expressed in tandem under the strong promoter PermE. Figure 6 Compared with wild-type WT, the NADPH and NADH contents of the dual-gene overexpression strain S-zwf-fadB were significantly increased (A); Figure 6 The monensin titer of this engineered strain was significantly higher than that of the wild type (BC), which enhanced the supply of intracellular reducing power. Figure 6 (D). In summary, overexpression of the zwf and fadB genes provides sufficient energy for monensin biosynthesis by enhancing intracellular reducing power (NADPH, NADH), ultimately significantly improving monensin potency.
[0066] The assay results of the dual-gene overexpression strain S-gnd-fadB are as follows: Figure 7 As shown, the gnd and fadB genes are co-expressed in tandem under the strong promoter PermE. Figure 7 (A); Compared with wild-type WT, the NADPH and NADH contents of the dual-gene overexpression strain S-gnd-fadB were significantly increased ( Figure 7 The monensin titer of this engineered strain was significantly higher than that of the wild type (BC), which enhanced the supply of intracellular reducing power. Figure 7 (D). In summary, overexpression of both gnd and fadB genes provides sufficient energy for monensin biosynthesis by enhancing intracellular reducing power (NADPH, NADH), ultimately significantly improving monensin potency.
[0067] Compared with wild-type WT, the assay results of the empty vector control strain (S-pSET152) are as follows: Figure 8 As shown, the NADPH and NADH contents of the empty vector control strain S-EV were not significantly different from those of the wild-type WT. Figure 8 The results (AB) indicate that the introduction of the empty vector did not change the intracellular reducing power level; the monensin titers of the two were also basically the same. Figure 8 (C). This indicates that the vector itself does not interfere with the reducing power metabolism and monensin synthesis of the strain, verifying that the phenotypic changes in the previously overexpressed strains were caused by the target gene (not the vector), thus ensuring the validity of the experimental control.
[0068] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A high-reducing-power donor fusion gene, characterized in that, It is composed of the genes encoding glucose-6-phosphate dehydrogenase, 6-phosphate gluconate dehydrogenase, and 3-hydroxyacyl-ACP dehydratase, which are linked in series. The nucleotide sequence of the gene encoding glucose-6-phosphate dehydrogenase is shown in SEQ ID No. 1, the nucleotide sequence of the gene encoding 6-phosphate gluconate dehydrogenase is shown in SEQ ID No. 2, and the nucleotide sequence of the gene encoding 3-hydroxyacyl-ACP dehydratase is shown in SEQ ID No.
3.
2. A recombinant expression vector, characterized in that, It contains the high reducing power donor fusion gene as described in claim 1.
3. The recombinant expression vector according to claim 2, characterized in that, The recombinant expression vector contains a PermE strong promoter, a multiple cloning site, and an fd transcription terminator; wherein the high-reducing-potency donor fusion gene is located at the multiple cloning site, and the PermE strong promoter is connected upstream of the high-reducing-potency donor fusion gene, and the fd transcription terminator is located downstream of the high-reducing-potency donor fusion gene. The nucleotide sequence of the PermE strong promoter is shown in SEQ ID No. 4, and the nucleotide sequence of the fd transcription terminator is shown in SEQ ID No.
5.
4. The recombinant expression vector according to claim 3, characterized in that, The backbone of the recombinant expression vector is the pSET152 plasmid.
5. The method for constructing the recombinant expression vector according to any one of claims 2 to 4, characterized in that, Includes the following steps: The zwf gene fragment encoding glucose-6-phosphate dehydrogenase, the gnd gene fragment encoding 6-phosphate gluconate dehydrogenase, and the fadB gene fragment encoding 3-hydroxyacyl-ACP dehydratase were assembled with a linearized vector fragment to obtain the recombinant expression vector. The nucleotide sequence of the zwf gene fragment is shown in SEQ ID No. 1, the nucleotide sequence of the gnd gene fragment is shown in SEQ ID No. 2, and the nucleotide sequence of the fadB gene fragment is shown in SEQ ID No.
3. The linearized vector fragment contains the PermE strong promoter, the vector backbone, and the fd transcription terminator.
6. The construction method according to claim 5, characterized in that, The zwf, gnd, and fadB gene fragments were all obtained by amplification from the genome of *Streptomyces cinnamon* via PCR; wherein, the amplified zwf, gnd, and fadB gene fragments were... zwf The nucleotide sequences of the primer pairs used to amplify the gene fragment are shown in SEQ ID No. 6 and SEQ ID No. 7, the nucleotide sequences of the primer pairs used to amplify the gnd gene fragment are shown in SEQ ID No. 8 and SEQ ID No. 9, and the nucleotide sequences of the primer pairs used to amplify the fadB gene fragment are shown in SEQ ID No. 10 and SEQ ID No.
11.
7. A recombinant Streptomyces, characterized in that, The recombinant Streptomyces comprises the recombinant expression vector according to any one of claims 2 to 4, or is obtained by transforming Streptomyces with a recombinant expression vector constructed by the construction method according to claim 5 or 6.
8. A method for constructing the recombinant Streptomyces of claim 7, characterized in that, include: The recombinant expression vector according to any one of claims 2 to 4, or the recombinant expression vector constructed using the construction method of claim 5 or 6, is introduced into a Streptomyces host via indirect synergistic transfer, and positive transformants are obtained by screening, thus obtaining the recombinant Streptomyces.
9. A method for producing monensin, characterized in that, include: The recombinant Streptomyces of claim 7 is cultured, and monensin is harvested from the culture product.