Soybean seedling aluminum tolerance related snp molecular marker and application thereof

Abstract

The application provides a soybean seedling aluminum toxicity tolerance related SNP molecular marker and application thereof, and belongs to the technical field of molecular marker assisted breeding. The SNP molecular marker is located at the 9843800th site and / or the 9897807th site of a soybean 18th chromosome GmChr18, the 9843800th site is G or A; the 9897807th site is T or C; the genotype of GmChr18:9843800 is AA, and the aluminum toxicity tolerance of the soybean seedling is significantly higher than that of the soybean with the genotype of GG; the genotype of GmChr18:9897807 is CC, and the aluminum toxicity tolerance of the soybean seedling is significantly higher than that of the soybean with the genotype of TT. The application identifies the SNP site related to the aluminum toxicity tolerance trait through whole genome correlation analysis, and verifies the correlation of the site and the aluminum toxicity, thereby providing a molecular breeding technical support for the genetic improvement of the soybean aluminum toxicity tolerance.

Description

Technical Field

[0001] This invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to SNP molecular markers related to aluminum tolerance in soybean seedlings and their applications. Background Technology

[0002] Soybeans are one of the world's most important food and oil crops, providing humans with abundant plant-based protein and edible oil. However, their growth and development are still affected by various abiotic stresses. When the soil pH is below 5.5, aluminum ions are released from silicates or oxides in the soil, leading to aluminum toxicity. Prolonged exposure to aluminum toxicity stress in crops hinders root tip elongation, severely impacting the root system and limiting nutrient absorption from the soil, resulting in yellowing leaves and reduced crop yield. Soybean aluminum tolerance is a complex quantitative trait, regulated by multiple genes and easily influenced by the environment; traditional breeding methods have long breeding cycles.

[0003] In root research, isoflavones are considered important components of root exudates. Daidzein is one of the main components of soybean isoflavones, which can enhance the resistance of soybean plants to pathogenic fungi and reduce the damage caused by adverse external factors. Chalcone reductase (CHR) is one of the essential key enzymes in the daidzein synthesis pathway, regulating the synthesis of isoglycyrrhizin, a precursor of daidzein.

[0004] Using molecular marker-assisted breeding selection methods can significantly improve breeding efficiency. Currently, molecular markers related to the aluminum tolerance gene CHR in soybean are concentrated on chromosomes 13 and 20, and the development and utilization of other molecular markers are rarely reported. Summary of the Invention

[0005] Therefore, the present invention aims to provide molecular markers of SNPs related to aluminum toxicity tolerance in soybean seedlings and their applications, in order to solve at least one of the technical problems in the background art.

[0006] This invention is implemented as follows: The first aspect of this invention provides a soybean seedling aluminum tolerance-related SNP molecular marker, wherein the SNP molecular marker is located at the 9843800th and / or 9897807th locus on chromosome 18 GmChr18, the 9843800th locus being G or A, and the 9897807th locus being T or C.

[0007] The second aspect of this invention provides primer pairs, reagents, or kits for detecting SNP molecular markers related to aluminum tolerance in soybean seedlings in the identification of aluminum tolerance in soybean seedlings. The SNP molecular markers are located at loci 9843800 and / or loci 9897807 on chromosome 18 (GmChr18), where locus 9843800 is G or A, and locus 9897807 is T or C. Soybean seedlings with the genotype AA (GmChr18:9843800) exhibit significantly higher aluminum tolerance than soybeans with the genotype GG. Similarly, soybean seedlings with the genotype CC (GmChr18:9897807) exhibit significantly higher aluminum tolerance than soybeans with the genotype TT.

[0008] Furthermore, the nucleotide sequence of the primer pair for detecting the SNP molecular marker GmChr18:9843800 is as follows: Upstream primer: 5'-TGAAATCTCTTGGAACATGAAACC-3', as shown in SEQ ID NO.1; Downstream primer: 5'-GGGAGCGACGGAAAATGTTGA-3', as shown in SEQ ID NO.2.

[0009] Furthermore, the 133rd base position of the amplified fragment of the primer pair is GmChr18:9843800.

[0010] Furthermore, the primer pair nucleotide sequence for detecting the SNP molecular marker GmChr18:9897807 is as follows: Upstream primer: 5'-GAGGCACGAAGTGTCTCTCT-3', as shown in SEQ ID NO.3; Downstream primer: 5'-GGTTGAAGTATAGTGTCCAATTCAC-3', as shown in SEQ ID NO.4.

[0011] Furthermore, the 95th base position of the amplified fragment of the primer pair is GmChr18:9897807.

[0012] A third aspect of the present invention provides a method for identifying aluminum toxicity tolerance in soybean seedlings, the method comprising: detecting the above-mentioned SNP molecular markers related to aluminum toxicity tolerance in soybean seedlings in the soybean germplasm to be tested, and identifying the aluminum toxicity tolerance in soybean seedlings based on the detection results.

[0013] Furthermore, the genomic DNA of the soybean to be tested was detected, and PCR amplification was performed using primer pairs for identifying the SNP molecular markers. The molecular markers in the amplification products were detected, thereby identifying the aluminum toxicity tolerance of soybean seedlings. The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9843800 are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9897807 are shown in SEQ ID NO.3 and SEQ ID NO.4; Among the SNP molecular markers, soybean seedlings with the genotype AA (GmChr18:9843800) showed significantly higher aluminum toxicity tolerance than soybeans with the genotype GG; soybean seedlings with the genotype CC (GmChr18:9897807) showed significantly higher aluminum toxicity tolerance than soybeans with the genotype TT.

[0014] The third aspect of this invention provides a soybean breeding method, which involves detecting nucleotides at the 9843800th and / or 9897807th sites of chromosome 18 GmChr18 in the genomic DNA of soybean; selecting soybeans with genotype AA for GmChr18:9843800 and / or genotype CC for GmChr18:9897807 as parents for breeding; and screening soybeans with genotype AA for GmChr18:9843800 and / or genotype CC for GmChr18:9897807 from the offspring to obtain soybeans resistant to aluminum toxicity.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention identifies SNP loci associated with aluminum toxicity through genome-wide association analysis and verifies the correlation between these loci and aluminum toxicity, providing molecular breeding technology support for the genetic improvement of aluminum toxicity tolerance in soybeans.

[0016] 2. The molecular markers GmChr18:9843800 and GmChr18:9897807 disclosed in this invention are significantly associated with aluminum tolerance in soybeans. The p values ​​of these two sites are less than 7.20E-07, which enables early identification of aluminum tolerance in soybean seedlings.

[0017] 3. This invention screens and innovates soybean germplasm resources and varieties with aluminum toxicity resistance, and identifies soybean genotypes related to aluminum toxicity resistance.

[0018] 4. This invention provides a new approach for screening and cultivating soybeans with aluminum toxicity tolerance. Attached Figure Description

[0019] Figure 1 This is the result of genome-wide association analysis of the relative elongation of the primary root under aluminum toxicity treatment during the soybean seedling stage in Example 1 of this invention; Figure 2The results of the correlation analysis between GmChr18:9843800 and GmChr18:9897807 in the GWAS population of Example 1 of this invention and the relative elongation of soybean taproot are shown. Figure 3 This is the result of the correlation analysis between the relative elongation of soybean taproot and the populations GmChr18:9843800 and GmChr18:9897807 in Example 1 of this invention. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0021] Example 1 Screening for SNP molecular markers related to aluminum tolerance in soybean seedlings, as detailed below: 1. Sample From soybean populations with different genetic backgrounds and geographical origins (Anhui, Beijing, Fujian, Guangdong, Guangxi, Hebei, Henan, Hubei, Hunan, Jilin, Jiangsu, Jiangxi, Liaoning, Shandong, Shanxi, Shanghai, Sichuan, Yunnan, Zhejiang, and Chongqing), 254 samples were randomly selected as training population samples and 88 samples were selected as validation population samples.

[0022] 2. Germplasm screening 2.1 Aluminum toxicity treatment and soybean root trait measurement Aluminum toxicity treatment was conducted on 254 natural soybean populations during the seedling stage using hydroponics. The specific method for aluminum toxicity treatment was as follows: Seeds from training samples with plump and uniform grain size were selected and sown evenly in 25cm×25cm square flowerpots. On the 5th day, seedlings with similar growth were transferred to a 0.5mmol / L CaCl2 solution (pH=4.3±0.01) for transition. After 24 hours, they were transferred to a treatment solution containing 100μmol / L AlCl3 (pH=4.3±0.01) for aluminum toxicity treatment. Each treatment solution contained 1 / 16 Hoagland nutrient solution and 0.5mmol / L CaCl2 solution. Four single plants were used for each treatment, and the treatment was repeated three times. The treatment without AlCl3 solution served as the control group. The seedlings were cultured in a light-controlled incubator for 7 days at a temperature of 26℃ / 22℃ (day / night) and a relative humidity of 75%, with a L / D ratio of 14h / 10h. The taproot length of each plant was measured before and after aluminum toxicity treatment, and the relative elongation rate of taproots in 254 natural soybean populations under aluminum toxicity treatment was calculated.

[0023] Relative elongation of the main root = (main root length after aluminum poisoning treatment - main root length before aluminum poisoning treatment) / (main root length after control group treatment - main root length before control group treatment).

[0024] In the evaluation of aluminum toxicity during the seedling stage, changes in roots can be used to assess aluminum toxicity. The relative elongation rate of the taproot is a rapid, simple, accurate, and reliable indicator for identifying aluminum toxicity.

[0025] 2.2 Correlation Analysis The genomic SNP data of 254 soybean population samples were detected using the "Zhongdouxin No. 1" SNP chip (Beijing, Compson).

[0026] Based on the GAPIT software package in the R language platform, MLM and GLM models were used to perform correlation analysis on SNP data and relative primary root elongation. A batch of SNPs that were significantly correlated with relative primary root elongation under aluminum toxicity stress in soybean seedlings were obtained. The results are as follows: Figure 1 As shown.

[0027] The phenotypic differences of haplotypes at sites significantly associated with relative primary root elongation were detected using the ggpubr package based on the R language. SNP sites with a significance threshold (p < 7.20E-07) were selected as sites significantly associated with aluminum tolerance in soybeans. Through phenotypic and SNP correlation analysis, GmChr18:9843800 and GmChr18:9897807 on chromosome 18 were identified as significantly associated SNP molecular markers. The coexistence of GmChr18:9843800 (G / A) and GmChr18:9897807 (T / C) could divide the population into two haplotypes. The results showed that the relative elongation of the primary root of genotypes AA (GmChr18:9843800) and CC (GmChr18:9897807) was significantly higher than that of genotypes GG (GmChr18:9843800) and TT (GmChr18:9897807). Figure 2 As shown.

[0028] 3. Verification Genomic SNP loci of soybean germplasm from 88 validation population samples were detected using the "Zhongdouxin No. 1" SNP chip (Beijing, Compson). Aluminum toxicity treatment and soybean root trait measurement experiments were conducted on these 88 validation populations using the same methods described in section 2.1 above. In the validation populations, the ggpubr package based on R language was used to detect phenotypic differences between haplotypes corresponding to GmChr18:9843800 (G / A) and GmChr18:9897807 (T / C). The results showed that the relative elongation of the primary root of genotypes AA (GmChr18:9843800) and CC (GmChr18:9897807) was significantly higher than that of genotypes GG (GmChr18:9843800) and TT (GmChr18:9897807). Figure 3The test results were consistent with the screening results above, thus verifying that GmChr18:9843800 and GmChr18:9897807 can distinguish between aluminum-tolerant and aluminum-sensitive germplasm during the seedling stage.

[0029] Example 2 Design primer pairs for identifying the SNP molecular markers described in the above technical solutions.

[0030] 1. Primer pairs were designed using the soybean reference genome DNA sequence from chromosome 18 (GmChr18) at position 9843800 (200 bp upstream and downstream) as a template. The nucleotide sequences of the primer pairs for detecting the SNP marker GmChr18:9843800 were as follows: upstream primer: 5'-TGAAATCTCTTGGAACATGAAACC-3', as shown in SEQ ID NO.1; downstream primer: 5'-GGGAGCGACGGAAAATGTTGA-3', as shown in SEQ ID NO.2. PCR amplification was performed using these primer pairs.

[0031] Total PCR reaction volume: 1.0 μL template DNA, 1.0 μL upstream primer, 1.0 μL downstream primer, 10 μL PCR mix, 7 μL sterile water, total 20 μL.

[0032] PCR reaction program: 94℃, 3 min; 94℃, 45 s; 58℃, 45 s; 72℃, 1 min, 30 cycles; 72℃, 5 min; store at 12℃.

[0033] The nucleotide sequence of the SNP molecular marker PCR product of GmChr18:9843800 is as follows: TGAAATCTCTTGGAACATGAAACCAAAAATGCAAAAATTGATCTAAAATCAATTCTAGACAGAGAATAAATTTTCCACGTGAAACCAAACACACACTAAGAGGTGAGGGGCATTTTTGTCTGTTTCATTTTCK(G / A)TGGGGT TCGGGAAGCAAAACTAGAAGTGCAGGAATCAACACCCCAAGCGAGCAAAGCAATACCAAACTCATTAACTCAACATTTTCCGTCGCTCCCACACTCCCTCTTTAGAATAAACGTTGAATAGAACAAAATCATGTTCTAAGTTT.

[0034] Note: K marked in the sequence is the mutation site, and the allele mutation base in parentheses; the position of the 133rd base of the amplified fragment is GmChr18:9843800.

[0035] 2. Primer pairs were designed using the soybean reference genome DNA sequence from chromosome 18 (GmChr18) at position 9897807 (200 bp upstream and downstream) as a template. The primer pair for detecting the SNP molecular marker GmChr18:9897807 was as follows: upstream primer: 5'-GAGGCACGAAGTGTCTCTCT-3', as shown in SEQ ID NO.3; downstream primer: 5'-GGTTGAAGTATAGTGTCCAATTCAC-3', as shown in SEQ ID NO.4. PCR amplification was performed using this primer pair, and the 95th base of the amplified fragment was located at position GmChr18:9897807.

[0036] Total PCR reaction volume: 1.0 μL template DNA, 1.0 μL upstream primer, 1.0 μL downstream primer, 10 μL PCR mix, 7 μL sterile water, total 20 μL.

[0037] PCR reaction program: 94℃, 3 min; 94℃, 45 s; 58℃, 45 s; 72℃, 1 min, 30 cycles; 72℃, 5 min; store at 12℃.

[0038] The nucleotide sequence of the SNP molecular marker PCR product of GmChr18:9897807 is as follows: GAGGCACGAAGTGTCTCTCTTTCCTTAATAATAATGGTTGTGAAGTCGAGAGAATAAACATCAAAGAAAGATCTAGTCTATCTTATTCGTCK(T / C)GAGTCCGTTCAAGGGAGATATACACCGAAGAGATTTTACAACAATAGGTCATGAGTAATCACATAAGTGAATTGGACACTATACTTCAACCAAAAACTTTAAGACTTAGGTTTATGGG.

[0039] Note: K marked in the sequence indicates a mutation site, and the allele mutation base is in parentheses; the amplified fragment is... Using specific primer pairs, reagents, or kits designed at the GmChr18:9843800 and GmChr18:9897807 loci, the genotypes of soybean samples at the GmChr18:9843800 and GmChr18:9897807 loci were detected by PCR, quantitative real-time PCR, high-throughput sequencing, and gene chip technology to identify their aluminum toxicity resistance.

[0040] A soybean breeding method was developed using the GmChr18:9843800 and GmChr18:9897807 loci. Nucleotides at loci 9843800 and / or 9897807 on chromosome 18 of soybean genomic DNA were detected. Soybeans with genotype AA (GmChr18:9843800) and / or genotype CC (GmChr18:9897807) were selected as parents for breeding. Soybeans with genotype AA (GmChr18:9843800) and / or genotype CC (GmChr18:9897807) were selected from the offspring to obtain soybeans resistant to aluminum toxicity.

[0041] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A combination of soybean seedling aluminum toxicity tolerance related SNP molecular markers characterized in that, The SNP molecular marker combination consists of the SNP molecular marker GmChr18:9843800 and the SNP molecular marker GmChr18:9897807. The specific nucleotide sequence of the SNP molecular marker GmChr18:9843800 is as follows: TGAAATCTCTTGGAACATGAAACCAAAAATGCAAAAATTGATCTAAAATCAATTCTAGACAGAGAATAAATTTTCCACGTGAAACCAAACACACACTAAGAGGTGAGGGGCATTTTTGTCTGTTTCATTTTCKTGGGGTTCGGGAAGCAA AACTAGAAGTGCAGGAATCAACACCCCAAGCGAGCAAAGCAATACCAAACTCATTAACTCAACATTTTCCGTCGCTCCCACACTCCCTCTTTAGAATAAAACGTTGAATAGAACAAAATCATGTTCTAAGTTT; the K marked in the sequence is the mutation site, which is G or A; The nucleotide sequence of the SNP molecular marker GmChr18:9897807 is as follows: GAGGCACGAAGTGTCTCTCTTTCCTTAATAATAATAATGGTTGTGAAGTCGAGAGAATAAACATCAAAGAAAGATCTAGTCTATCTTATTCGTCKGAGTCCGTTCAAGGGAGATATACACCGAAGAGATTTTACAACAATAGGTCATGAGTAATCACATAAGTGAATTGGACACTATACTTCAACCAAAAACTTTAAGACTTAGGTTTATGGG; K marked in the sequence is the mutation site, which is T or C.

2. The use of the primer pair or reagent or kit for detecting the soybean seedling aluminum toxicity tolerance related SNP molecular marker combination of claim 1 in the identification of soybean seedling aluminum toxicity tolerance, characterized in that, Soybean seedlings with genotype AA (GmChr18:9843800) and genotype CC (GmChr18:9897807) showed significantly higher aluminum toxicity tolerance than soybeans with genotype GG (GmChr18:9843800) and genotype TT (GmChr18:9897807).

3. Use according to claim 2, characterized in that, The nucleotide sequence of the primer pair for detecting the SNP molecular marker GmChr18:9843800 is as follows: Upstream primer: 5'-TGAAATCTCTTGGAACATGAAACC-3', as shown in SEQ ID NO.1; Downstream primer: 5'-GGGAGCGACGGAAAATGTTGA-3', as shown in SEQ ID NO.

2.

4. Use according to claim 2, characterized in that, The primer pair nucleotide sequence for detecting the SNP molecular marker GmChr18:9897807 is as follows: Upstream primer: 5'-GAGGCACGAAGTGTCTCTCT-3', as shown in SEQ ID NO.3; Downstream primer: 5'-GGTTGAAGTATAGTGTCCAATTCAC-3', as shown in SEQ ID NO.

4.

5. A method for identifying soybean seedlings for aluminum toxicity tolerance, characterized by, The method includes: detecting the genomic DNA of the soybean to be tested, performing PCR amplification using primer pairs for identifying SNP molecular marker combinations, detecting the molecular markers in the amplification products, and then identifying the aluminum toxicity resistance of soybean seedlings; the SNP molecular marker combination consists of the SNP molecular marker GmChr18:9843800 and the SNP molecular marker GmChr18:9897807. The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9843800 are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9897807 are shown in SEQ ID NO.3 and SEQ ID NO.

4. Soybean seedlings with the genotype AA for GmChr18:9843800 and the genotype CC for GmChr18:9897807 showed significantly higher aluminum toxicity tolerance than soybeans with the genotype GG for GmChr18:9843800 and the genotype TT for GmChr18:9897807.

6. A method of breeding soybeans, characterized by, The genomic DNA of soybean was detected by PCR amplification using primer pairs for identifying SNP molecular marker combinations. The molecular markers in the amplification products were then detected to identify the aluminum toxicity resistance of soybean seedlings. The SNP molecular marker combination consisted of the SNP molecular markers GmChr18:9843800 and GmChr18:9897807. The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9843800 are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the primer pairs for detecting the SNP molecular marker GmChr18:9897807 are shown in SEQ ID NO.3 and SEQ ID NO.

4. Soybeans with genotype AA (GmChr18:9843800) and genotype CC (GmChr18:9897807) were selected as parents for breeding. Soybeans with genotype AA (GmChr18:9843800) and genotype CC (GmChr18:9897807) were then selected from the offspring to obtain soybeans resistant to aluminum toxicity.

Images