A SNP site related to agronomic traits of upland cotton and application thereof

Abstract

The application belongs to the technical field of molecular markers, and particularly relates to a SNP site related to agronomic traits of Gossypium hirsutum and application thereof, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the nucleotide at the 100bp site is G or T. The SNP site provided by the application realizes early, rapid, accurate and low-cost selection of key agronomic traits of Gossypium hirsutum, fundamentally overcomes blindness and hysteresis of traditional breeding methods, and significantly accelerates the breeding process of excellent cotton varieties. The SNP site provides an important target for molecular marker-assisted breeding, provides a theoretical basis for shortening the growth period of cotton in the Yangtze River Basin and improving the yield of cotton, and provides a research basis for further research on the regulation pathway of early maturity and high yield of Gossypium hirsutum.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a SNP site related to agronomic traits of upland cotton and its application. Background Technology

[0002] Upland cotton ( Gossypium hirsutum Upland cotton (L.) is the most widely cultivated and highest-yielding type of cotton in my country. The Yangtze River Basin, as a major cotton-producing area, has traditionally relied on upland cotton as its mainstay industry. Early maturity and high yield are important agronomic traits of upland cotton, crucial for increasing cotton production, optimizing planting structure, and enhancing market competitiveness.

[0003] For a long time, the breeding of upland cotton varieties has mainly relied on traditional breeding methods, namely, gradually improving target traits through observation and selection of phenotypic traits, combined with hybridization and progeny screening. However, traditional breeding methods have obvious characteristics of blindness, lag, and labor intensity, mainly manifested in: 1) Agronomic traits such as maturity, yield, and fiber quality are easily affected by cultivation environment, climate conditions, and management measures, making it difficult to accurately identify superior genotypes based solely on phenotypic analysis. 2) Traditional breeding requires multiple generations of self-pollination, hybridization, and field screening, often taking more than ten years from parental selection to variety development, which cannot meet the needs of modern breeding for rapid and precise improvement. 3) The cotton-growing areas of the Yangtze River Basin have long relied on the "Dai Zi Mian 15" and "Jin Zi Mian" derivative lines as the main parents, leading to a decline in genetic diversity and the loss of superior alleles, thus restricting breeding breakthroughs.

[0004] With the development of molecular biology techniques, marker-assisted selection has provided a new approach for crop breeding. However, the number of molecular markers targeting early maturity, high yield, and high quality agronomic traits in upland cotton remains insufficient. Therefore, developing SNP molecular markers closely associated with multiple important agronomic traits of upland cotton and establishing rapid and accurate genotyping methods are of great significance for targeted improvement and accelerating the breeding process. Summary of the Invention

[0005] This invention identifies a SNP locus that is significantly associated with maturity, yield, and fiber quality of upland cotton, and further develops its application methods, providing new tools and ideas for molecular marker-assisted breeding of upland cotton.

[0006] The technical solution adopted in this invention is: This invention provides an SNP molecular marker related to agronomic traits of upland cotton, the nucleotide sequence of which is shown in SEQ ID NO.1, and the nucleotide at the 100bp site is G or T.

[0007] The present invention also provides an application of the SNP molecular marker, which is used to improve the agronomic traits of upland cotton.

[0008] Preferably, the agronomic trait includes at least one of the following: 1) Maturity characteristics; 2) Yield traits; 3) Fiber quality characteristics.

[0009] Preferably, the maturity trait is at least one of the following: full growth period, flowering period, pre-frost flowering rate, flowering and boll-forming period, plant height, height of the first node of the fruiting branch, and height of the first node of the fruiting branch; The yield trait is boll weight; The fiber quality trait is at least one of fiber length, fiber uniformity, and fiber elongation.

[0010] Preferably, the method for improving the agronomic traits of upland cotton is as follows: DNA was extracted from the upland cotton plant to be tested; Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain PCR products; The PCR products were subjected to electrophoresis and sequencing. If the sequencing results are consistent with SEQ ID NO.2, then this upland cotton will be used as the parent to improve the maturity of upland cotton offspring; If the sequencing results are consistent with SEQ ID NO.1, then this upland cotton will be used as the parent to improve the fiber quality of upland cotton offspring.

[0011] Preferably, the DNA is derived from the leaves of upland cotton.

[0012] Preferably, the leaf is a four-week-old leaf.

[0013] Preferably, the PCR amplification procedure is as follows: Pre-denaturation: 95℃ for 3 min, 1 cycle; Denaturation at 95℃ for 15 seconds, annealing at 52℃ for 15 seconds, extension at 72℃ for 35 seconds, 32 cycles; Final extension: 72℃ for 10 minutes, 1 cycle.

[0014] Compared with the prior art, the beneficial effects of the present invention are: This invention provides a SNP molecular marker associated with agronomic traits of upland cotton. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, with the nucleotide at the 100bp site being either G or T. Addressing the problems of phenotypic selection dependence, long breeding cycles, convergent genetic backgrounds, and lack of molecular markers in existing traditional upland cotton breeding methods, this invention provides an SNP locus significantly associated with maturity, yield, and fiber quality in upland cotton. Utilizing this SNP locus enables a leap from phenotypic selection to genotypic selection, allowing for precise and stable screening in the early stages of upland cotton development, significantly shortening the breeding cycle, and supporting synergistic improvement of multiple traits. This invention not only provides an efficient and low-cost practical tool for marker-assisted breeding of upland cotton but also provides important theoretical basis and technical support for broadening the genetic base and accelerating the selection of superior varieties. Attached Figure Description

[0015] Figure 1 Box plot analysis for the early maturity trait. A~G represent, in order: total growth period, flowering period, pre-frost flowering rate, flowering and boll-forming period, plant height, height of the first fruiting branch node, and position of the first fruiting branch node. *** P <0.001,** P <0.01, * P <0.05.

[0016] Figure 2 Box plot analysis of yield traits. A through C represent lint percentage, boll weight, and leaf index, respectively. *** P <0.001,** P <0.01, * P <0.05.

[0017] Figure 3 Box plot analysis of fiber quality traits. A~E represent fiber length, fiber strength, fiber uniformity, fiber elongation, and micronaire value, respectively.

[0018] Figure 4 Table 3 shows the detection results for the first 15 test materials. A represents the PCR results, with lanes from left to right corresponding to the first 15 test materials in Table 3; B represents the sequencing results, with sequences from top to bottom corresponding to the first 15 test materials in Table 3.

[0019] Figure 5 Table 3 shows the detection results for the last 15 test materials. A represents the PCR results, with lanes from left to right corresponding to the last 15 test materials in Table 3; B represents the sequencing results, with sequences from top to bottom corresponding to the last 15 test materials in Table 3. Detailed Implementation

[0020] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0021] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0022] The list of abbreviations for this invention is shown in Table 1.

[0023] Table 1. List of abbreviations for this invention Example 1 A SNP locus associated with agronomic traits of upland cotton and its application are detailed below: 1. Materials and Methods.

[0024] (1) Experimental materials.

[0025] Fifty-nine accessions were selected from the "Jinzi Mian" and "Daizi Mian 15" derivative varieties developed in the cotton-growing areas of the Yangtze River Basin between 1950 and 2020 to form modern germplasm. Twenty-seven basic parents introduced or bred between 1890 and 1988 that made significant contributions to the cotton industry in the Yangtze River Basin were used as test materials. Therefore, the total experimental materials of this invention consist of 86 upland cotton germplasm resources from the cotton-growing areas of the Yangtze River Basin. Among them, basic parents refer to superior varieties or excellent germplasm resources that are frequently used in breeding practice and have many derivative varieties.

[0026] (2) Resequencing data collection.

[0027] The experimental data used in this invention come from three studies: 355 natural populations of upland cotton and 86 upland cotton germplasm resources from the cotton-growing areas of the Yangtze River Basin. Their whole-genome resequencing data can be downloaded from the NCBI BioProiect database, with project numbers PRINA399050, PRINA389777, and PRINA605345.

[0028] (3) Phenotypic data collection.

[0029] The phenotypic data used for haplotype analysis in this invention are relevant traits from previous articles published by our laboratory, including: 3 yield traits, 7 early maturity traits, and 5 fiber quality traits.

[0030] Yield traits: seed index, lint percentage, and boll weight.

[0031] Early maturity traits: flowering period, total growth period, flowering and boll-forming period, pre-frost flowering rate, height of the first fruiting branch node, height of the first fruiting branch node, and plant height.

[0032] Fiber quality characteristics: fiber length, fiber strength, fiber uniformity, micronaire value, and fiber elongation.

[0033] (4) Genome-wide association analysis.

[0034] Genome-wide association analysis (BLUP) was performed on 15 traits of 86 upland cotton germplasm resources from the Yangtze River cotton region. The analysis was conducted using a linear mixture model constructed with GEMMA software, and data processing was performed using the vcf2gwas tool. The significance threshold was set according to the Bonferroni correction method. P =2.28×10 -3 However, to avoid overcorrection leading to the loss of potentially significant sites, the screening threshold was ultimately relaxed to... P =2.60×10 -3 In the R language environment, the "CMplot" package is used to draw Manhattan plots; the "agricolae" package is used to perform multiple comparisons based on the least significant difference method; the "LDheatmap" tool is used to analyze the LD characteristics of SNP sites, and the "ggplot2" package is used to realize the visualization analysis of haplotype regions.

[0035] (5) Screening of candidate genes.

[0036] Based on genetic diversity analysis, candidate genomic regions that have undergone significant artificial selection in modern germplasm were screened. Simultaneously, QTL hotspots associated with early maturity and yield reported by previous studies were integrated, overlapping IBD fragments were screened, and genes within these regions were systematically mined. The potential functions of candidate genes were analyzed through Arabidopsis homologous gene annotation and transcriptome data integration. Furthermore, local GWAS was performed on the artificially selected candidate genomic regions, their overlapping regions with IBD fragments, and phenotypic data from 355 natural populations to precisely locate candidate genes significantly associated with early maturity, yield, and fiber quality traits in cotton. The transcriptome data used were previously published data from our laboratory and have been uploaded to NCBI (project number PRJNA509318).

[0037] 2. Results.

[0038] Based on the reference genome "TM-1", this invention identified 2,021,444 high-quality SNPs in upland cotton germplasm resources composed of 86 upland cotton species. The A08 chromosome had the highest number of SNP markers (261,408), while the D03 chromosome had the lowest (31,348). Genome-wide analysis showed an average SNP density of 896 markers per Mb. Specifically, the A08 chromosome had the densest SNP distribution, with an average of 2,125 markers detected per Mb, while the A02 chromosome had the lowest density, with an average of only 515 markers detected per Mb.

[0039] (1) Identification of SNP sites.

[0040] Within the artificially selected region of chromosome D01 (52.3Mb–52.7Mb), there is an overlap with the IBD region. Through local GWAS, the hotspot candidate region D01 (52.4Mb–52.8Mb) was co-located for seven traits, containing 12 important candidate genes (Table 2). To accurately identify candidate genes, this invention integrates SNP linkage disequilibrium relationships within the region, Arabidopsis homologous gene functional annotation information, and jointly analyzes gene haplotypes with phenotypic data of 15 target traits. By exploring the correlation between gene haplotypes and phenotypes, the potential association between candidate genes and target traits is analyzed. Ultimately, key candidate genes were successfully identified. Ghir_D01G017360 This gene has shown important value in cotton genetic improvement research and is expected to provide a theoretical basis for subsequent functional verification and molecular breeding.

[0041] Table 2 Annotation information for 12 candidate genes On genes Ghir_D01G017360 Detection of variant sites within 2kb up and down revealed an SNP site 1253bp upstream, where the base mutated from G to T, and its nucleotide sequence is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0042] SEQ ID NO.1: GAAGAAAGAAAAGGAAAAGAGAAGAAGAAGAAGAAGAAGAAAAAGAAGAAGGGGAAGGAGGCGTAGAAGGAAGAAAAAGGAAAAAAAAGAAGAAGAAGAGGGATGGAAGGAAAAAGAAAAGAAAAAATAAAGGGTAAACATAGCACAGGTGCCGCCTATGACAGTGGCACCTTTGGTGCCTCCTGTGACAGACCCTTGAC.

[0043] SEQ ID NO.2: GAAGAAAGAAAAGGAAAAGAGAAGAAGAAGAAGAAGAAGAAAAAGAAGAAGGGGAAGGAGGCGTAGAAGGAAGAAAAAGGAAAAAAAAGAAGAAGAAGATGGATGGAAAAAGAAAAGAAAAAATAAAGGGTAAACATAGCACAGGTGCCGCCTATGACAGTGGCACCTTTGGTGCCTCCTGTGACAGACCCTTGAC.

[0044] On genes Ghir_D01G017360 Analysis of potential cis-regulatory elements in the promoter region revealed that the gene contains cis-regulatory elements related to light response, auxin response, and meristematic expression. Genetic diversity analysis showed that nucleotide diversity within the gene region gradually decreased with decreasing latitude, with the highest genetic diversity in the Northwest Inland and Northern Extra-early Maturing cotton regions, and the lowest in the Yangtze River Basin cotton region and the United States. Simultaneously, analysis according to different breeding periods revealed that genetic diversity within this gene region gradually decreased with the progression of the breeding period, with varieties bred between the 1950s and 1970s and between the 1980s and 1990s exhibiting higher genetic diversity, while the genetic diversity of varieties bred after the 2000s gradually decreased.

[0045] Haplotype analysis was performed on 3 yield traits, 7 early maturity traits, and 5 fiber quality traits: 1) Results for the precocious trait are shown in Figure 1 Regarding the early maturity trait, the entire growth period and flowering period of the hap2 material were significantly shorter than those of the hap1 material.

[0046] The entire growth period of the hap1 material is 118.00d~144.00d, the flowering period is 65.00d~82.00d, the pre-frost flowering rate is 25.58%~86.88%, the flowering and boll-forming period is 46.06d~61.58d, the plant height is 50.75cm~101.04cm, the height of the first fruiting branch node is 12.67cm~29.42cm, and the first fruiting branch node is 3.94cm~7.24cm.

[0047] The entire growth period of the hap2 material is 119.00d~135.00d, the flowering period is 68.00d~78.00d, the pre-frost flowering rate is 42.83%~87.53%, the flowering and boll-forming period is 47.17d~56.46d, the plant height is 52.50cm~93.65cm, the height of the first fruiting branch node is 12.38cm~26.94cm, and the first fruiting branch node is 4.68cm~6.77cm.

[0048] The mean length of the entire growth period of the hap1 material was 129.09 days with a standard error of 5.51; the mean length of the flowering period was 74.70 days with a standard error of 3.15; the mean pre-frost flowering rate was 60.79% with a standard error of 12.48; the mean length of the flowering and boll-forming period was 53.02 days with a standard error of 3.10; the mean plant height was 79.18 cm with a standard error of 9.49; the mean height of the first fruiting branch node was 20.11 cm with a standard error of 3.02; and the mean height of the first fruiting branch node was 5.84 with a standard error of 0.66.

[0049] The mean growth period of the hap2 material was 124.88 days with a standard error of 4.12; the mean flowering period was 72.10 days with a standard error of 2.51; the mean pre-frost flowering rate was 69.54% with a standard error of 11.15; the mean flowering and boll-forming period was 50.95 days with a standard error of 2.37; the mean plant height was 74.02 cm with a standard error of 11.05; the mean height of the first fruiting branch node was 18.41 cm with a standard error of 3.26; and the mean node position of the first fruiting branch was 5.48 cm with a standard error of 0.51.

[0050] 2) Results of yield traits are shown in Figure 2 Regarding yield traits, apart from boll weight, there were no significant differences in the other two traits.

[0051] 3) Results of fiber quality traits are shown in Figure 3 In terms of fiber quality properties, hap1 material is superior to hap2.

[0052] The fiber length of hap1 material is 24.30mm~32.84mm, the fiber strength is 24.63cN / tex~38.60cN / tex, the fiber uniformity is 80.48%~86.29%, the fiber elongation is 6.51%~6.88%, and the micronaire value is 3.30~5.40.

[0053] The fiber length of HAPH2 material is 25.75 mm to 31.37 mm, the fiber strength is 25.12 cN / tex to 34.90 cN / tex, the fiber uniformity is 82.60% to 86.12%, the fiber elongation is 6.55% to 6.75%, and the micronaire value is 4.00 to 5.37.

[0054] The average fiber length of PH1 material is 28.62 mm with a standard error of 1.32; the average fiber strength is 29.05 cN / tex with a standard error of 2.43; the average fiber uniformity is 84.34% with a standard error of 0.94; the average fiber elongation is 6.67% with a standard error of 0.06; and the average micronaire value is 4.55 with a standard error of 0.36.

[0055] The average fiber length of HAPH2 material is 28.42 mm with a standard error of 1.29; the average fiber strength is 28.97 cN / tex with a standard error of 2.13; the average fiber uniformity is 84.28% with a standard error of 0.92; the average fiber elongation is 6.65% with a standard error of 0.06; and the average micronaire value is 4.58 with a standard error of 0.28.

[0056] In summary, materials with the hap2 haplotype have a shorter overall growth period, earlier flowering period, higher pre-frost flowering rate, shorter flowering and boll-forming period, shorter fruit branch initial node height, shorter plant height, shorter first fruit branch node height, and lighter boll weight. The seed index and lint percentage are not significantly different from those of the hap1 haplotype. However, materials with the hap1 haplotype have better fiber length, fiber uniformity, and micronaire value than those with the hap1 haplotype.

[0057] The sequence information of the above-mentioned haplotype hap1 is shown in SEQ ID NO.1; the sequence information of haplotype hap2 is shown in SEQ ID NO.2.

[0058] (2) Application of SNP sites.

[0059] 1) Ghir_D01G017360 Expression level detection.

[0060] In this invention, 30 samples were randomly selected from both the hap1 and hap2 populations for subsequent experimental analysis. Real-time quantitative PCR results showed that, at 30 dpa, the hap2 type materials... Ghir_D01G017360 The expression level of this SNP was significantly lower than that of the hap2 type material. Phenotypic analysis showed that the hap2 type material matured earlier, with a significantly shorter growth period than the hap1 type material; yield-related traits showed no significant differences between the two haplotypes; however, the fiber quality traits of the hap2 type material were generally poorer, with many phenotypic indicators significantly lower than those of the hap1 type material. These results confirm that this SNP locus is closely related to cotton precocity and fiber quality traits, and can be used as a molecular marker for cotton genetic improvement.

[0061] 2) Verification of SNP sites.

[0062] Thirty accessions were randomly selected from 355 natural population germplasm resources, and DNA was extracted. PCR was performed using the primers shown in SEQ ID NO.3 and SEQ ID NO.4. Ghir_D01G017360 The SNP site at 1253 bp upstream was used for validation. Information from the 30 materials is shown in Table 3.

[0063] SEQ ID NO. 3: CATCCCAGCCTTATAATGGTC.

[0064] SEQ ID NO.4: GATTTTGAGTAATAAAATGTCGAAATTAT.

[0065] The PCR results of all 30 samples showed bright single target bands. Sequencing confirmed that the 15 samples carrying hap1 all had G bases at the SNP sites, with an accuracy of 100.00%; the 15 samples carrying hap2 all had T bases at the SNP sites, also with an accuracy of 100.00%. The results are as follows: Figure 4 and Figure 5 As shown.

[0066] Table 3. Names of Test Materials The methods for DNA extraction are as follows: Four weeks after cotton planting, young leaves were selected, collected, and placed in 2 mL centrifuge tubes for DNA extraction using the CTAB method. After DNA extraction, ddH2O was added to dissolve the DNA, and RNase was used to remove RNA impurities. Agarose gel electrophoresis was used to assess DNA integrity, and a Thermo Scientific Nano Drop 2000c spectrophotometer was used to determine DNA concentration. The total DNA volume of each sample was ensured to be no less than 5 µg to meet the requirements of subsequent high-throughput sequencing experiments.

[0067] PCR amplification and agarose gel electrophoresis: Using the extracted DNA as a template, amplification was performed using the primers shown in SEQ ID NO.3 and SEQ ID NO.4. The PCR amplification procedure is shown in Table 4.

[0068] Table 4 PCR Amplification Program Note: "-" in Table 4 indicates that this item is not available.

[0069] After PCR amplification, 6 µL of each PCR product was subjected to agarose gel electrophoresis. Electrophoresis was performed at a constant voltage of 150 V / cm for 25 min. The electrophoretic products were then collected, purified, and subsequently sequenced for analysis.

[0070] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0071] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of a SNP molecular marker detection reagent in upland cotton assisted breeding, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide at the 100bp site of the SNP molecular marker is G or T; When the nucleotide at the 100bp site is T, upland cotton exhibits precocious traits; Early maturity traits refer to a shorter overall growth period, earlier flowering period, higher pre-frost flowering rate, shorter flowering and boll-forming period, shorter height of the first fruiting branch node, shorter plant height, and shorter height of the first fruiting branch node.

Images