A kasp molecular marker related to lagenaria leucantha long trait, detection primer and application thereof

Abstract

The application discloses a KASP molecular marker related to a long character of luffa fruit, detection primers and application thereof, and belongs to the field of molecular assisted genetic breeding.The application identifies an A / G polymorphic site related to the long character of the fruit at the position 15150285 of the 13th chromosome of luffa, and a specific primer combination for KASP typing is developed and synthesized based on the site, so that the long / short character of the fruit can be accurately identified in the seedling stage of luffa, the application can be stably applied in luffa breeding populations and diversified germplasm resources, and the drawbacks of traditional breeding, such as long period, low efficiency and being easily affected by the environment, can be effectively overcome.The application can shorten the breeding period of the long / short character of the fruit of luffa and accelerate the breeding process of new luffa varieties meeting market demands.

Description

Technical Field

[0001] This invention relates to the field of molecular assisted genetic breeding, and in particular to a KASP molecular marker, detection primer, and application related to the fruit length trait of loofah. Background Technology

[0002] Luffa is an annual herbaceous plant belonging to the genus Luffa in the family Cucurbitaceae. There are two cultivated species: the common luffa [Luffa cylindrica (L.) Roem] and the ridged luffa [Luffa acutangula (L.) Roxb]. As an important vegetable crop, luffa has rich nutritional value and widespread market demand. With the popularization of greenhouse cultivation technology, luffa can now be supplied year-round. However, consumers in different regions have different preferences for fruit length, and shorter fruits are more resistant to damage during transportation. Therefore, breeding luffa varieties that meet specific needs has become crucial for the industry's development. However, fruit length is a quantitative trait controlled by multiple genes. Traditional phenotypic selection breeding methods are greatly affected by environmental factors, have low selection efficiency, and have long breeding cycles, making it difficult to meet the market's demand for rapid variety updates.

[0003] To improve breeding efficiency, molecular marker-assisted selection (MMR) technology is increasingly being applied to loofah breeding. Currently, studies have attempted to use markers such as SSRs and SNPs to perform association analysis on loofah fruit-related traits. However, existing markers often suffer from low detection throughput, insufficient genotyping accuracy, or weak association with target traits. Furthermore, the relatively limited genomic information of loofah means that effective molecular markers for precision breeding remain scarce, resulting in low accuracy in early selection of fruit length traits during the seedling stage and limiting the acceleration of the breeding process.

[0004] In recent years, the combination of competitive allele-specific PCR technology and population segregation analysis has provided an effective tool for gene mapping of quantitative traits. However, its application in the study of fruit length in loofah still faces challenges. The main problem lies in the insufficient coverage and limited site effects of the developed molecular markers, making it difficult to achieve efficient detection of traits controlled by multiple genes. Furthermore, due to the complex genetic background of loofah, developing widely applicable and reliable KASP markers is quite difficult. This results in low accuracy in early selection during breeding and limited reduction in breeding cycle time. Therefore, there is an urgent need to develop new molecular markers to improve detection efficiency and breeding accuracy. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker, detection primers, and their applications related to the fruit length trait of loofah, thereby addressing the problems existing in the prior art. This invention identifies a polymorphic locus related to fruit length at position 15150285 on chromosome 13 of loofah and develops and synthesizes a set of specific primers for KASP genotyping. This allows for accurate identification of fruit length traits during the loofah seedling stage and can be stably applied in loofah breeding populations and diverse germplasm resources, effectively overcoming the drawbacks of traditional breeding methods that rely on phenotypic selection, have long cycles, low efficiency, and are easily affected by environmental factors.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a KASP molecular marker associated with the fruit length trait of loofah. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1. An A / G polymorphic site exists at position 133 of the nucleotide sequence shown in SEQ ID NO.1, and the genotypes include AA, GG, and AG.

[0007] The present invention also provides a primer combination for detecting the KASP molecular marker, the primer combination comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0008] The present invention also provides a kit for detecting KASP molecular markers associated with the fruit length trait of loofah, comprising the primer combination described above.

[0009] This invention also provides the use of the primer combination or the kit described herein in any of the following: (a) Detecting the genotype of the KASP molecular marker in the loofah sample to be tested; (b) Identifying or predicting the fruit length traits of loofah; (c) Screening of germplasm resources of short-fruited loofah; (d) Molecular marker-assisted breeding for improving the short-fruited loofah trait.

[0010] Optionally, when the genotype at the location of the KASP molecular marker is AA, the loofah is a short-fruited loofah; when the genotype at the location of the KASP molecular marker is AG or GG, the loofah is a long-fruited loofah.

[0011] This invention also provides a method for identifying the fruit length trait of loofah, comprising the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, the primer combination is used to perform an amplification reaction, and the genotype of the loofah to be tested is determined based on the amplification results; The loofah with genotype AA has shorter fruit length; the loofah with genotype AG or GG has longer fruit length.

[0012] Optionally, the amplification reaction system is as follows: 1.25 μL DNA template, 1.25 μL 10 μM mixed primers, and 2.5 μL 2 × KASP Master Mix; the volume ratio of upstream primer F1, upstream primer F2, and downstream primer R in the mixed primers is 1:1:3.

[0013] Optionally, the amplification reaction program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing and extension at 61℃ for 60 s, decreasing the temperature by 0.6℃ to 55℃ for each cycle, for a total of 10 cycles; denaturation at 95℃ for 20 s; extension at 55℃ for 60 s, for a total of 27 cycles; and holding at 25℃ for 30 s.

[0014] This invention also provides a method for breeding short-fruited loofah germplasm, comprising the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, the primer combination is used to perform an amplification reaction, and the genotype of the loofah to be tested is determined based on the amplification results; The loofah with genotype AA has shorter fruit length; the loofah with genotype AG or GG has longer fruit length. Germplasm with genotype AA was selected for subsequent breeding and propagation.

[0015] Optionally, the amplification reaction system is as follows: 1.25 μL DNA template, 1.25 μL 10 μM mixed primers, and 2.5 μL 2 × KASP Master Mix; the volume ratio of upstream primer F1, upstream primer F2, and downstream primer R in the mixed primers is 1:1:3; the amplification reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s; 61℃ annealing and extension for 60 s, decreasing the temperature by 0.6℃ to 55℃ for each cycle, for a total of 10 cycles; 95℃ denaturation for 20 s; 55℃ extension for 60 s, for a total of 27 cycles; and 25℃ incubation for 30 s.

[0016] The present invention discloses the following technical effects: The KASP molecular marker located at position 15150285 on chromosome 13 of the loofah plant, and its primer combination provided by this invention, can efficiently and accurately detect key SNP sites controlling the length of loofah fruits. This marker, through seedling genotyping, can accurately predict that the AA genotype will result in short fruits, while the GG or AG genotype will result in long fruits, enabling early and precise selection of quantitative traits controlled by multiple genes. This effectively overcomes the drawbacks of traditional breeding methods, which rely on phenotypic selection, have long cycles, low efficiency, and are easily affected by environmental factors.

[0017] The KASP detection method based on this marker has the advantages of simple operation, high throughput, low cost, and accurate genotyping. Combined with the developed specific primers and optimized reaction system, it can be stably applied in sponge gourd breeding populations and diverse germplasm resources, significantly improving the screening efficiency and accuracy of target plants with short or long fruits. The application of this invention can shorten the breeding cycle for sponge gourd fruit length traits and accelerate the breeding process of new sponge gourd varieties that meet market demands. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a sequence difference diagram of parental materials 32 and 34 at KASP marker positions. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] In this embodiment of the invention, the parental materials P1 is five-leafed loofah (number 32), and P2 is Nanjing long loofah (number 34). Both the parental materials and intermediate breeding materials were sourced from the seed bank of the Jiangsu Academy of Agricultural Sciences.

[0026] Example 1: Discovery and localization of a KASP molecular marker associated with the length trait of loofah fruit Using short-fruited loofah (material number 32) as the maternal parent (P1) and long-fruited loofah (material number 34) as the paternal parent (P2), segregating F1 and F2 populations were constructed. Whole-genome resequencing was performed on the parents and the extreme trait pools (short-fruited and long-fruited pools) of the F2 generation using high-throughput sequencing technology. Analysis was conducted using BSA-seq (cluster segregation analysis) combined with QTL (quantitative trait locus) mapping. Finally, a region significantly associated with fruit length was located on chromosome 13 of the loofah reference genome *Luffa cylindrica* cv. P93075. Through deep alignment and screening of sequences within this region, a key SNP locus was identified at position 15150285, with a polymorphism of A / G. Figure 1 As shown.

[0027] The SNP site and its flanking sequence (as shown in SEQ ID NO.1) were developed into a KASP (competitive allele-specific PCR) molecular marker. In the nucleotide sequence of this marker (SEQ ID NO.1), the base at position 133 is the target SNP site, and the base type at this site is significantly correlated with the length of the loofah fruit.

[0028] SEQ ID NO.1: ACCCTATTGGTCATTGTTTTGTTGTGCCAACAGATTAGCCATCAAATTTTGGACTCGCTGAATATATCTTGAACTATGTCCCCACCAAGCTTGATCCTATTGAAAATATTAAAAGTAGGAATTAAAGTAACTTRATAGA CCTCCTATGGCAAGTCAGCAAACATCTCGTTGCTTGTCTTGTATATCTTTGTCTTACCTAATAAAATATTAAAAGAAAAGAATGAGTATTAAAAATAACTAGGAAGTAACTCCACTACCGAGGTCAGTATATGTAAA.

[0029] Further research by the inventors revealed that the correspondence between the genotype of this SNP locus and the fruit length phenotype is as follows: when the genotype of this locus is homozygous AA (defined as 1 / 1 type), the loofah fruit exhibits the short fruit phenotype; when the genotype is homozygous GG (defined as 2 / 2 type) or heterozygous AG (defined as 1 / 2 type), the loofah fruit exhibits the long fruit phenotype.

[0030] Example 2: KASP molecular marker primer set for detecting the length trait of loofah fruit and its application method Based on the SNP sites and sequence 1 discovered in Example 1, a specific primer pair for KASP genotyping was designed and synthesized. This primer pair includes two allele-specific forward primers (F1 and F2) with different 5' adapter sequences, and a common reverse primer (R). The specific sequences are as follows: Forward primer F1 (SEQ ID NO.2): GAAGGTGACCAAGTTCATGCT TGACTTGCCATAGGAGGTCTATC; Forward primer F2 (SEQ ID NO.3): GAAGGTCGGAGTCAACGGATT TGACTTGCCATAGGAGGTCTATT; Reverse primer R (SEQ ID NO.4): CCAGCTTGATCCTATTGAAAATAT.

[0031] The underlined bases are fluorescent linker sequences.

[0032] The specific testing steps are as follows: 1. Extraction of genomic DNA from loofah (1) Select loofah leaves and place them in a centrifuge tube. Add two steel balls with a diameter of 2 mm and grind them for 40 s at a frequency of 35 Hz in a liquid nitrogen environment.

[0033] (2) Add 800 μL of CTAB extraction buffer to the centrifuge tube and mix it thoroughly by inverting the tube. Then extract at 65°C for 30 min, inverting the tube to mix it every 10 min.

[0034] (3) In a fume hood, add an equal volume of chloroform:isoamyl alcohol (24:1, V / V) mixture to each sample, mix by inverting, and centrifuge at 12000 rpm for 10 min. Take 700 μL of the supernatant and add it to a 1.5 mL centrifuge tube containing 700 μL of isopropanol. Mix gently and place in a -20℃ freezer for precipitation for at least 20 min.

[0035] (4) Centrifuge at 10,000 rpm for 8 min, discard the supernatant, and add 200 μL of 70% ethanol to each sample to wash the precipitate. Centrifuge again at 10,000 rpm for 5 min, discard the supernatant, invert the centrifuge tube on absorbent paper to remove excess liquid, and then place it in a fume hood to dry for at least 1 h.

[0036] (5) Add 100-200 μL of sterile water to each sample to dissolve the DNA, place it at 4℃ for 1 day or heat it at 65℃ for 15 min to obtain the loofah genomic DNA to be tested. The DNA can be stored at -20℃ for later use or used immediately.

[0037] 2. KASP-PCR reaction and genotyping (1) Primer mixture preparation: Dilute the synthesized primers to 100 μM with TE buffer (pH 8.0). When using, mix the upstream genotyping primer F1 : upstream genotyping primer F2 : downstream universal primer R = 1 : 1 : 3 to prepare the genotyping primer working mixture (total primer concentration is 10 μM).

[0038] (2) Preparation of PCR reaction system (total volume 5 μL): In a 96-well PCR plate, add 2.5 μL of 2× KASPMaster Mix, 1.25 μL of typing primer working mixture, and 1.25 μL of the loofah genomic DNA template (20-50 ng / μL) to each well.

[0039] (3) After sealing the plate and briefly centrifuging to mix, place the reaction plate in a real-time PCR instrument for amplification. The reaction procedure is as follows: Pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing and extension at 61℃ for 60 s (decreasing by 0.6℃ to 55℃ per cycle, for a total of 10 cycles); denaturation at 95℃ for 20 s; extension at 55℃ for 60 s, for a total of 27 cycles; holding at 25℃ for 30 s.

[0040] (4) Data Analysis: After the reaction, the instrument automatically collects the endpoint fluorescence signals of the FAM and HEX channels. The results are usually displayed in the form of a scatter plot, where the X-axis and Y-axis represent the fluorescence intensity of the FAM (associated with the F1 primer) and HEX (associated with the F2 primer) channels, respectively. Homozygous AA genotype (1 / 1) samples will cluster in the region where the FAM channel is strong and the HEX channel is weak (usually displayed as orange clusters); homozygous GG genotype (2 / 2) samples will cluster in the region where the HEX channel is strong and the FAM channel is weak (usually displayed as blue clusters); heterozygous AG genotype (1 / 2) samples will be located in the middle position where the fluorescence signals of both channels are relatively strong (usually displayed as green clusters). Based on the genotyping results, it can be determined that: plants with genotype AA correspond to the short fruit trait; plants with genotype GG or AG correspond to the long fruit trait.

[0041] Example 3: Validation of KASP molecular markers in loofah breeding populations and germplasm resources To verify the effectiveness, accuracy, and broad applicability of the KASP molecular markers provided by this invention, the invention was validated in multiple genetic backgrounds.

[0042] 1. F2 Separation Population Validation Using the method in Example 2, genotyping and field fruit length phenotype surveys were conducted on the parents P1 (32, short fruit), P2 (34, long fruit), and 172 F2 individual plants constructed from them. The genotyping results are shown in Table 1.

[0043] Table 1. Correspondence between genotypes and fruit length phenotypes of individual plants in the parental and F2 populations. As shown in Table 1, F2 plants with genotype 1 / 1 (AA) exhibited short fruit, while plants with genotypes 2 / 2 (GG) or 1 / 2 (AG) exhibited long fruit. This indicates that the marker completely co-segregated with the long fruit trait in the F2 population, demonstrating extremely high predictive accuracy.

[0044] 2. BC1 backcross population validation: The effectiveness of the marker in the backcross context was further verified by constructing the BC1 population through backcrossing the (P1 × P2) F1 generation with the short-fruited parent P1. Genotyping of the BC1 population (data shown in Table 2) revealed that plants with genotype 1 / 1 exhibited short fruit, while plants with genotype 1 / 2 exhibited long fruit, further confirming the linkage between the marker and fruit length trait, with a significant dominant effect.

[0045] Table 2. Correspondence between genotypes and fruit length phenotypes of some individual plants in the BC1 population. 3. Validation of intermediate materials for loofah breeding To assess the universality of this marker across different genetic resources, 32 intermediate loofah breeding materials from diverse sources with significant differences in fruit length were randomly selected for testing. The results are shown in Table 3.

[0046] Table 3 Phenotypes and Genotypes of Intermediate Materials The comparison between genotyping and phenotype showed that the markers had high predictive accuracy. For example, the genotypes of short-fruited varieties such as "Changshu Loofah" (LG-2) and "Yuantong Xiang Loofah" (LG-11) were all 1 / 1; the genotypes of long-fruited varieties such as "Chang Loofah" (LG-24) and "Dongtai Chang Loofah" (LG-32) were all 2 / 2; and the genotype of some medium-long-fruited or heterozygous materials such as "White-skinned Loofah" (LG-1) was 1 / 2 (Table 3). These results indicate that the KASP markers developed in this invention can effectively distinguish between long and short-fruited loofah varieties under different genetic backgrounds, and have important application value in germplasm resource identification and assisted selection breeding.

[0047] In summary, the KASP molecular marker located at position 15150285 on chromosome 13 of loofah and its detection method provided by this invention can rapidly, accurately, and cost-effectively identify fruit length traits during the loofah seedling stage, significantly improving the efficiency and accuracy of breeding loofah varieties with long and short fruits, and shortening the breeding cycle.

[0048] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A KASP molecular marker associated with the fruit length trait of loofah, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

1. An A / G polymorphic site exists at position 133 of the nucleotide sequence shown in SEQ ID NO.1, and the genotypes include AA, GG, and AG.

2. A primer combination for detecting the KASP molecular marker of claim 1, characterized in that, The primer combination includes primer F1 with the nucleotide sequence shown in SEQ ID NO.2, primer F2 with the nucleotide sequence shown in SEQ ID NO.3, and primer R with the nucleotide sequence shown in SEQ ID NO.

4.

3. A kit for detecting KASP molecular markers associated with the fruit length trait of loofah, characterized in that, It includes the primer combination as described in claim 2.

4. The use of the primer combination of claim 2 or the kit of claim 3 in any of the following: (a) Detecting the genotype of the KASP molecular marker in the loofah sample to be tested; (b) Identifying or predicting the fruit length traits of loofah; (c) Screening of germplasm resources of short-fruited loofah; (d) Molecular marker-assisted breeding for improving the short-fruited loofah trait.

5. The application according to claim 4, characterized in that, When the genotype at the location of the KASP molecular marker is AA, the loofah is a short-fruited loofah; when the genotype at the location of the KASP molecular marker is AG or GG, the loofah is a long-fruited loofah.

6. A method for identifying the fruit length characteristics of loofah, characterized in that, Includes the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, the primer combination described in claim 2 is used to perform an amplification reaction, and the genotype of the loofah to be tested is determined based on the amplification results; Loofah with the genotype AA is short-fruited loofah; loofah with the genotype AG or GG is long-fruited loofah.

7. The method according to claim 6, characterized in that, The amplification reaction system consisted of: 1.25 μL DNA template, 1.25 μL 10 μM mixed primers, and 2.5 μL 2 × KASP Master Mix; the volume ratio of primer F1, primer F2, and primer R in the mixed primers was 1:1:

3.

8. The method according to claim 6, characterized in that, The amplification reaction procedure is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing and extension at 61℃ for 60 s, decreasing the temperature by 0.6℃ to 55℃ for each cycle, for a total of 10 cycles; denaturation at 95℃ for 20 s; extension at 55℃ for 60 s, for a total of 27 cycles; and holding at 25℃ for 30 s.

9. A method for breeding short-fruited loofah germplasm, characterized in that, Includes the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, the primer combination described in claim 2 is used to perform an amplification reaction, and the genotype of the loofah to be tested is determined based on the amplification results; Loofah with the genotype AA is short-fruited loofah; loofah with the genotype AG or GG is long-fruited loofah. Germplasm with genotype AA was selected for subsequent breeding and propagation.

10. The method according to claim 9, characterized in that, The amplification reaction system consisted of: 1.25 μL DNA template, 1.25 μL 10 μM mixed primers, and 2.5 μL 2 × KASP Master Mix; the volume ratio of primer F1, primer F2, and primer R in the mixed primers was 1:1:3; the amplification reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s; 61℃ annealing and extension for 60 s, decreasing the temperature by 0.6℃ to 55℃ for each cycle, for a total of 10 cycles; 95℃ denaturation for 20 s; 55℃ extension for 60 s, for a total of 27 cycles; and 25℃ incubation for 30 s.

Images