Application of Circular RNA CircMAP2 as a Biomarker for Diagnosing Acute Ischemic Stroke

Abstract

This invention belongs to the field of biomedical technology. More specifically, this invention provides a circular RNA CircMAP2, the sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2. This invention is the first to demonstrate that CircMAP2 can serve as a novel biomarker for diagnosing acute ischemic stroke. Compared with traditional imaging diagnostic methods, this invention can diagnose acute ischemic stroke by detecting the expression level of CircMAP2 in the patient's plasma and plasma exosomes. Furthermore, the expression level of CircMAP2 can be used to estimate the infarct area. It has the advantages of simple operation, fast detection speed, and low cost, making it particularly suitable for widespread use in primary healthcare institutions. The product for diagnosing acute ischemic stroke provided by this invention enables rapid and accurate diagnosis of acute ischemic stroke, possessing excellent clinical application prospects and value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. More specifically, it relates to the application of a circular RNA, CircMAP2, as a biomarker for diagnosing acute ischemic stroke. Background Technology

[0002] Acute ischemic stroke (AIS), also known as cerebral infarction, is a clinical syndrome caused by a sudden interruption of blood supply to the brain, leading to localized ischemia, hypoxia, and necrosis of brain tissue, resulting in corresponding neurological deficits. It has a high incidence rate and is a leading cause of death and disability in humans. The key to treating acute ischemic stroke is to open the blocked blood vessel as early as possible and salvage the ischemic penumbra. Currently, the time window for intravenous thrombolysis is 4.5 hours after symptom onset (Class I recommendation, Level A evidence), and the time window for endovascular treatment in patients with large vessel occlusion is 6 hours after symptom onset (Class I recommendation, Level A evidence). Therefore, early diagnosis and rapid intervention are crucial for improving patient prognosis.

[0003] However, current diagnostic methods for acute ischemic stroke mainly rely on imaging techniques (such as CT or MRI). These methods have drawbacks such as expensive equipment, long examination times, and complex procedures, making them difficult to implement, especially in primary healthcare institutions. Currently, there is a lack of effective plasma biomarkers for diagnosing acute ischemic stroke, which severely limits the efficiency and accuracy of early diagnosis. Therefore, developing diagnostic biomarkers for acute ischemic stroke is of great significance.

[0004] Circular RNAs (circRNAs) are a class of non-coding RNA molecules with a unique closed circular structure. Due to their closed covalent structure and resistance to exonucleases, circRNAs are more stable in expression and less susceptible to degradation by exonucleases than linear RNAs. Furthermore, the base sequence and expression of circRNAs are highly conserved across species, giving them a significant advantage as novel clinical diagnostic markers. circRNAs are highly enriched in brain synapses and have been found to have potential value as biomarkers in various neurological diseases. Currently, there is a lack of effective plasma biomarkers for the diagnosis of acute ischemic stroke. Summary of the Invention

[0005] The present invention aims to address the problem of the lack of effective plasma biomarkers for the diagnosis of acute ischemic stroke, and provides a circular RNA CircMAP2, which can be used as a biomarker to detect its expression level and can be used for the diagnosis of acute ischemic stroke.

[0006] The first objective of this invention is to provide a circular RNA CircMAP2 and its applications.

[0007] A second objective of this invention is to provide a product for diagnosing acute ischemic stroke.

[0008] The above-mentioned objective of this invention is achieved through the following technical solution: This invention is the first to discover that the circular RNA CircMAP2 is highly expressed in the plasma of patients with acute ischemic stroke, and experimentally confirms that CircMAP2 can serve as a novel biomarker for diagnosing acute ischemic stroke. Therefore, this invention claims protection for the following technical solutions: The present invention provides a circular RNA CircMAP2, the sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] Specifically, the sequence SEQ ID NO.1 represents the mouse circular RNA CircMAP2; the sequence SEQ ID NO.2 represents the human circular RNA CircMAP2.

[0010] This invention provides the application of the above-mentioned circular RNA CircMAP2 as a diagnostic biomarker for acute ischemic stroke.

[0011] This invention provides the application of the above-mentioned circular RNA CircMAP2 as a target in the preparation of products for the diagnosis of acute ischemic stroke or products for detecting the size of cerebral infarction area.

[0012] This invention provides the application of a reagent for detecting the expression level of the above-mentioned circular RNA CircMAP2 in the preparation of diagnostic products for acute ischemic stroke or products for detecting the size of cerebral infarction area.

[0013] Specifically, the reagents include fluorescent quantitative PCR primers.

[0014] As an alternative implementation, the product for detecting the size of cerebral infarction area calculates the cerebral infarction area by detecting the expression level of the aforementioned circular RNA CircMAP2 and substituting the results into a formula. The formula is: Y = 9.132 * X + 3.696; In the formula, Y represents the area of ​​cerebral infarction (cm²). 3 X represents the relative expression level of the circular RNA CircMAP2.

[0015] This invention provides a product for diagnosing acute ischemic stroke, the product containing a reagent for detecting the expression level of the aforementioned circular RNA CircMAP2.

[0016] Specifically, the product is an acute ischemic stroke diagnostic kit.

[0017] Specifically, the product is a diagnostic product for acute ischemic stroke in mammals, where the mammal is a human or a mouse.

[0018] As an alternative implementation, the product contains a reagent for detecting the expression level of the aforementioned circular RNA CircMAP2 in plasma.

[0019] As an alternative implementation, the reagents include quantitative real-time PCR primers.

[0020] As an alternative implementation, the real-time PCR primers include detection primer 1 and detection primer 2, the sequence of detection primer 1 is shown in SEQ ID NO.3, and the sequence of detection primer 2 is shown in SEQ ID NO.4.

[0021] As an alternative implementation, the real-time PCR primers further include internal reference primers, including internal reference primer 1 and internal reference primer 2, wherein the sequence of internal reference primer 1 is shown in SEQ ID NO.5 and the sequence of internal reference primer 2 is shown in SEQ ID NO.6.

[0022] Specifically, the detection primer 1, detection primer 2, internal reference primer 1, and internal reference primer 2 are reagents for diagnosing acute ischemic stroke in mice.

[0023] As an alternative implementation, the real-time PCR primers include detection primer 3 and detection primer 4, the sequence of detection primer 3 is shown in SEQ ID NO.7, and the sequence of detection primer 4 is shown in SEQ ID NO.8.

[0024] As an alternative implementation, the real-time PCR primers further include internal reference primer 3 and internal reference primer 4, the sequence of internal reference primer 3 is shown in SEQ ID NO.9, and the sequence of internal reference primer 4 is shown in SEQ ID NO.10.

[0025] Specifically, the detection primer 3, detection primer 4, internal reference primer 3, and internal reference primer 4 are reagents for diagnosing acute ischemic stroke in humans.

[0026] As an alternative implementation, the product also contains RNA extraction reagents, reverse transcription reagents, and real-time quantitative PCR reagents.

[0027] As an alternative implementation scheme, in the relevant scheme for diagnosing acute ischemic stroke using circular RNA CircMAP2 as a target, the diagnostic criteria are as follows: when the expression level of circular RNA CircMAP2 is detected to be higher than that of the control sample, the diagnosis is acute ischemic stroke.

[0028] As an alternative implementation, the diagnostic sample is a plasma sample or a plasma exosome sample.

[0029] Specifically, the control group consisted of samples from non-acute ischemic stroke patients.

[0030] Based on the results of this study, as a reference criterion, acute ischemic stroke is diagnosed when the expression level of circular RNA CircMAP2 in plasma samples is detected to be 2.9875 times higher than that in the control group.

[0031] Based on the results of this study, as a reference criterion, acute ischemic stroke is diagnosed when the expression level of circular RNA CircMAP2 in plasma exosome samples is detected to be 1.384 times higher than that in the control group.

[0032] Furthermore, as is known in the art, accurate diagnostic criteria in actual clinical practice require the analysis and summarization of an extremely large amount of clinical sample data. In the present invention's scheme for diagnosing acute ischemic stroke using circular RNA CircMAP2 as a target, the specific correspondence between the expression level of circular RNA CircMAP2 and acute ischemic stroke can also be analyzed and summarized based on an extremely large amount of clinical sample data.

[0033] Therefore, the judgment criteria of "the expression level of CircMAP2 is higher than that of the control sample" and the diagnostic criteria of "the expression level of circular RNA CircMAP2 in plasma samples is 2.9875 times higher than that of the control and the expression level of circular RNA CircMAP2 in plasma exosome samples is 1.384 times higher than that of the control" should not be a limitation of the present invention.

[0034] Therefore, the present invention claims protection for the following judgment scheme: when the expression level of circular RNA CircMAP2 in a plasma sample is detected to be more than twice that of the control, acute ischemic stroke is diagnosed; or when the expression level of circular RNA CircMAP2 in a plasma exosome sample is detected to be more than 1 times that of the control, acute ischemic stroke is diagnosed.

[0035] Alternatively, the preferred diagnostic method is as follows: if the expression level of circular RNA CircMAP2 in a plasma sample is detected to be 2.5 times higher than that in the control, acute ischemic stroke is diagnosed; or if the expression level of circular RNA CircMAP2 in a plasma exosome sample is detected to be 1.3 times higher than that in the control, acute ischemic stroke is diagnosed.

[0036] Alternatively, a more preferred diagnostic method is as follows: if the expression level of circular RNA CircMAP2 in a plasma sample is detected to be 3 times higher than that in the control, the diagnosis is acute ischemic stroke; or if the expression level of circular RNA CircMAP2 in a plasma exosome sample is detected to be 1.5 times higher than that in the control, the diagnosis is acute ischemic stroke.

[0037] The present invention has the following beneficial effects: This invention is the first to discover that the circular RNA CircMAP2 is highly expressed in the plasma and plasma exosomes of patients with acute ischemic stroke, and experimental results confirm that CircMAP2 can serve as a novel biomarker for the diagnosis of acute ischemic stroke, laying the foundation for the development of diagnostic products for acute ischemic stroke.

[0038] Compared to traditional imaging diagnostic methods (such as CT or MRI), this invention utilizes conventional qPCR to detect the expression level of CircMAP2 in patient plasma to diagnose acute ischemic stroke. It offers advantages such as ease of operation, rapid detection, and low cost, making it particularly suitable for widespread use in primary healthcare institutions. The product provided by this invention enables rapid and accurate diagnosis of acute ischemic stroke and can also estimate the infarct area through CircMAP2 expression levels, helping doctors to promptly assess the condition, optimize treatment decisions, and thus improve patient prognosis. It possesses excellent clinical application prospects and value. Attached Figure Description

[0039] Figure 1 Heatmaps of primary neuronal and exosome sequencing and circular RNA screening flowcharts for the ischemia-reperfusion (I / R) and normoxic groups are presented (Figure A: Heatmap of neuronal sequencing results in the I / R and normoxic groups; Figure B: Heatmap of neuronal and exosome sequencing results in the I / R and normoxic groups; Figure C: Volcano diagram of neuronal sequencing results in the I / R and normoxic groups; Figure D: Volcano diagram of neuronal and exosome sequencing results in the I / R and normoxic groups; Figure E: Flowchart of circular RNA screening; Figure F: Venn diagram of common differential circRNAs in neurons and exosomes).

[0040] Figure 2 The results of extraction and identification of primary neuronal exosomes are shown in Figure A (Polymer precipitation method for extracting neuronal exosomes; Figure B (Nanoparticle tracking analysis for measuring neuronal exosome diameter); Figure C (Western Blot analysis for detecting CD63, CD81, TSG101 and Calnexin exosome protein markers in primary neuronal exosomes).

[0041] Figure 3 The results of qPCR validation of the screened circular RNA in primary neurons and exosomes of the normoxic and I / R groups were shown in Figure A (expression of circular RNA in primary neurons of the normoxic and I / R groups, n=3, two-tailed t-test); Figure B (expression of circular RNA in exosomes of primary neurons of the normoxic and I / R groups, n=3, ns: no statistical significance, *). P <0.05, two-tailed t-test).

[0042] Figure 4 The results show the expression level of CircMAP2 in mice with middle cerebral artery embolism / reperfusion (MCAO / R) (Figure A shows the expression of CircMAP2 in the serum of MCAO / R model mice, n=6, two-tailed t-test; Figure B shows the expression of CircMAP2 in the brain tissue of the peri-infarct area of ​​MCAO / R mice, n=6, two-tailed t-test; Figure C shows the expression of CircMAP2 in the brain tissue of the infarct core area of ​​MCAO / R mice, n=6, two-tailed t-test).

[0043] Figure 5 The expression of CircMAP2 in plasma of healthy controls and patients with acute ischemic stroke (AIS) is shown in Figure A, which shows the expression level of CircMAP2 in plasma of healthy controls and AIS patients within 24 hours of onset, using the Mann-Whitney test; Figure B shows the expression level of CircMAP2 in AIS patients on day 1 (n=19), day 3 (n=18), and day 7 (n=9) of onset.

[0044] Figure 6 ROC curve of plasma CircMAP2 expression level within 24 hours of AIS onset.

[0045] Figure 7 A diagram showing the magnetic resonance DWI sequence and CircMAP2 expression level of AIS patients.

[0046] Figure 8 The results of correlation analysis between cerebral infarction volume and CircMAP2 expression level (n=35, P<0.05).

[0047] Figure 9 The results of CircMAP2 expression level detection in plasma exosomes of control group and AIS patients (20 patients in ischemic stroke group and 25 healthy controls, P<0.001, two-tailed t test).

[0048] Figure 10 ROC curve of plasma exosome Circ MAP2 expression level within 24 hours of AIS onset. Detailed Implementation

[0049] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0050] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0051] The murine CircMAP2 (CircMAP2 mmu_circ_0008896) sequence is shown as SEQ ID NO.1 (5'-3'), and its corresponding parental gene is located at chr1:66408776-66427347, SEQ ID NO.1: AAAGAAGCCAGAACATACCACCAGCCGTTTGAGAATACAACATAGCAAACTTCACTACTTTACAACTTCCTTGAATTGGCGACAGTACAGAGATCTGAAAGATGGCCGACGAGCGGAAAGATGAAGGAAAGGCACCACACTGGACATCAGCCTCACTCACAGAGGCAGCTGCACACCCTCACTCTCCAGAGATGAAGGACCAGGGTGGGGCAGGGGAAGGGCTGAGCCGCAACGCCAATGGATTTCCATACAGAGAGGAGGAGGAAGGCGCCTTTGGGGAGCACAGGTCACAGGGCACCTATTCAGATACCAAAGAGAACGGGATCAACGGAGAGCTGACCTCAGCTGACAGAGAAACAGCAG。

[0052] The human CircMAP2 (CircMAP2 hsa_circ_0118964) sequence is shown as SEQ ID NO.2 (5'-3'), and its corresponding parental gene is located at chr2:210489776-210518156, SEQ ID NO.2: AAAGAAGCCAGAAAATATTATCAACCCTTTGAGAACACGACACAACGAACTTTATATTTTACCACTTCCTTGAATAGTTGCAGGAGAAATAACAAGGCATTGAAGAATGGCAGATGAACGGAAAGATGAAGCAAAGGCACCTCACTGGACCTCAGCACCGCTAACAGAGGCATCTGCACACTCACATCCACCTGAGATTAAGGATCAAGGCGGAGCAGGGGAAGGACTTGTCCGAAGCGCCAATGGATTCCCATACAGGGAGGATGAAGAGGGTGCCTTTGGAGAGCATGGGTCACAGGGCACCTATTCAAATACCAAAGAGAATGGGATCAACGGAGAGCTGACCTCAGCTGACAGAGAAACAGCAG。

[0053] The RNA codes for mouse-derived CircMAP2 (CircMAP2 mmu_circ_0008896) and human-derived CircMAP2 (CircMAP2hsa_circ_0118964) can be retrieved from the circBase database.

[0054] The primers for detecting mouse-derived CircMAP2 include mouse-derived detection primer 1 and mouse-derived detection primer 2.

[0055] The sequence of mouse-derived detection primer 1 (upstream primer) is shown in SEQ ID NO.3 (5'-3'), SEQ ID NO.3: CAGAGAAACAGCAGAAAGAAG.

[0056] The sequence of mouse-derived detection primer 2 (downstream primer) is shown in SEQ ID NO.4 (5'-3'), SEQ ID NO.4: TCCTTCATCTTTCCGCTCGTC.

[0057] The internal reference for detecting mouse-derived CircMAP2 is actin, and the primers for detecting actin include mouse-derived internal reference primer 1 and mouse-derived internal reference primer 2.

[0058] The sequence of the mouse internal reference primer 1 (upstream primer) is shown in SEQ ID NO.5 (5'-3'), SEQ ID NO.5: AGAGGGAAATCGTGCGTGAC.

[0059] The sequence of the mouse internal reference primer 2 (downstream primer) is shown in SEQ ID NO.6 (5'-3'), SEQ ID NO.6: CAATAGTGATGACCTGGCCGT.

[0060] The primers for detecting human CircMAP2 include human detection primer 3 and human detection primer 4.

[0061] The sequence of human detection primer 3 (upstream primer) is shown in SEQ ID NO.7 (5'-3'), SEQ ID NO.7: CCTTTGGAGAGCATGGGTCA.

[0062] The sequence of human detection primer 4 (downstream primer) is shown in SEQ ID NO.8 (5'-3'), SEQ ID NO.8: ATATTTTCTGGCTTCTTTCTGCT.

[0063] The internal reference for detecting human CircMAP2 is actin, and the primers for detecting actin include human internal reference primer 3 and human internal reference primer 4.

[0064] The sequence of human internal reference primer 3 (upstream primer) is shown in SEQ ID NO.9 (5'-3'), SEQ ID NO.9: CGTGGACATCCGCAAAGA.

[0065] The sequence of human internal reference primer 4 (downstream primer) is shown in SEQ ID NO.10 (5'-3'), SEQ ID NO.10: GAAGGTGGACAGCGAGGC.

[0066] Example 1: The screening process of CircMAP2 I. Experimental Methods (1) Normoxia group: The primary neuron culture medium (neurobasel + 2% B27 + 1% Pen-Strep Solution) was used for medium replacement, and the cells were incubated in a normal cell culture incubator for 3 hours. After incubation, the medium was replaced, and the cell samples were processed 24 hours later.

[0067] (2) Ischemia / reperfusion (I / R), or Oxygen and glucose deprivation / reperfusion (OGD / R) group: Sugar-free DMEM medium was used for medium replacement; the conditions of the three-gas incubator were: 95% nitrogen, 5% carbon dioxide, and 0% oxygen. After the gas reached the preset conditions, the culture dish was placed in the three-gas incubator for 3 hours. After the incubation, the primary neuronal complete medium was replaced. The samples were processed 24 hours later.

[0068] II. Experimental Results To screen for biomarkers associated with ischemia and hypoxia, we performed next-generation sequencing analysis on primary cortical neurons and exosomes from I / R and normoxic mice. The results are as follows: Figure 1 Figures A through D show that the results indicate that by intersecting the differentially expressed circular RNAs (LogFC>1, FDR<0.05) in exosomes of the I / R group with those differentially expressed in both exosomes and neurons of the I / R group (LogFC>1, FDR<0.05), 322 circular RNAs (n=322) that were differentially expressed in both I / R exosomes and neurons of the I / R group were identified. The intersection yielded 322 commonly differentially expressed circRNAs, of which 20 were found in the circbase database. Bioinformatics screening identified 6 circular RNAs associated with ischemia and hypoxia. Figure 1 (E-F diagram).

[0069] Neuronal exosomes were extracted using polymer precipitation, and the size of primary neuronal exosomes was measured by nanoparticle tracking analysis (NTA). Simultaneously, Western blotting was used to detect common neuronal exosome protein markers such as CD63, CD81, TSG101, and Calnexin. The results are shown below. Figure 2 As shown, the results indicate that the particle size of neuronal exosomes is 137 nm, which falls within the range of 50-150 nm for exosome size. Western blotting experiments also confirmed the presence of exosomal protein markers such as CD63, CD81, TSG101, and Calnexin in primary neuronal exosomes.

[0070] We performed qPCR validation on six selected circular RNAs in primary neurons and exosomes from the I / R group and the normoxic group. The results are as follows: Figure 3 As shown, the results indicate that only CircMAP2 expression in exosomes and neurons remained consistent with the sequencing results, showing significantly high expression in both. P <0.05), other circular RNA expression trends differed from or were opposite to the sequencing results.

[0071] Example 2: Validation of CircMAP2 in the MCAO / R mouse model I. Experimental Methods We constructed a middle cerebral artery occlusion / reperfusion (MCAO / R) mouse model (MCAO / R, n=6) and a sham surgery (SHAM) model (n=6).

[0072] The experimental subjects used in MCAO / R were healthy male C57BL / 6 mice weighing 22–25 g and specific pathogen-free (SPF).

[0073] The specific steps for establishing the MCAO / R surgical model are as follows: Mice were anesthetized with isoflurane gas. Under a stereomicroscope, a midline cervical incision was made, the carotid artery and common carotid artery were separated to their bifurcation, the external carotid artery and common carotid artery were ligated, and the internal carotid artery was clamped with a vascular clamp. The external carotid artery was cut open from the proximal end, and a suture embolization was inserted into the internal carotid artery along the external carotid artery for about 10 mm. The suture embolization was fixed with silk suture above the incision, followed by hemostasis, and the muscles and skin were sutured layer by layer. The left middle cerebral artery of the mouse was embolized using the suture embolization method and fixed for 1 hour. After 1 hour, the suture embolization was removed, and after reperfusion for 24 hours, the mouse was sacrificed for tissue sampling, followed by subsequent experiments. The volume of cerebral infarction was observed using a blood perfusion imaging system and 2,3,5-triphenyltetrazolium chloride (TTC) staining as a quality control indicator for the successful construction of the MCAO model.

[0074] The sham surgery group (SHAM) used the same surgical incision as the MCAO group and dissected the carotid artery, but did not insert a suture embolus. The sample was taken 24 hours after the sham surgery and the subsequent experiments were completed.

[0075] After modeling, RNA was extracted from mouse serum, brain tissue in the peri-infarct area and infarct core area, and the expression level of CircMAP2 was detected by quantitative real-time PCR (qPCR).

[0076] II. Experimental Results The expression of CircMAP2 was detected in serum, infarct core, and peri-infarct area brain tissues of MCAO / R model mice. The results are as follows: Figure 4 As shown, the results indicate that CircMAP2 levels in the serum of MCAO / R mice ( P =0.0066), peri-infarction zone ( P <0.001) and infarct core region ( P High expression of <0.001% in brain tissue ( Figure 4 (Figures A, B, and C).

[0077] Example 3: Biomarker role of CircMAP2 in patients with acute ischemic stroke (clinical validation) and analysis of diagnostic specificity and sensitivity. I. Experimental Methods We collected venous blood from 79 patients with acute ischemic stroke (AIS) admitted within 24 hours of onset and 41 healthy controls (HCs) in the Department of Neurology, First Affiliated Hospital of Jinan University. We used qPCR to detect the expression level of CircMAP2 in their plasma and analyzed the biomarker role, diagnostic specificity, and sensitivity of CircMAP2 in patients with acute ischemic stroke.

[0078] II. Experimental Results The expression levels of CircMAP2 in the plasma of the control group and AIS patients are as follows: Figure 5 As shown, the results indicate that CircMAP2 is significantly highly expressed in the plasma of AIS patients ( P <0.05)( Figure 5 Figure A); A graph was plotted on the CircMAP2 expression levels of AIS patients on days 1, 3, and 7 of onset. The results showed that the expression level of CircMAP2 decreased with the progression of the disease. P <0.05)( Figure 5 (Figure B).

[0079] ROC curves of plasma CircMAP2 from AIS patients and healthy controls were plotted. The ROC curves of CircMAP2 are shown below. Figure 6 As shown, the results indicate that CircMAP2 has diagnostic value for AIS (AUC=0.641, P <0.05), the diagnostic threshold of CircMAP2 was selected as 2.9875 using ROC curve, with a sensitivity of 43.00% and a specificity of 85.40%.

[0080] The volumetric lesion of AIS patients was assessed using DWI imaging results from MRI on day 1 of admission, and analyzed in conjunction with the patients' CircMAP2 expression levels. The volumetric lesion data and corresponding CircMAP2 expression level data are shown below. Figure 7 As shown.

[0081] Correlation analysis was performed on infarct volume and CircMAP2 expression level. The results of the correlation analysis are as follows: Figure 8 As shown, the results indicate that the expression level of CircMAP2 in the plasma of AIS patients is positively correlated with the volume of cerebral infarction (n=35, r=0.4290, ...). P <0.05).

[0082] Example 5: Increased expression levels of CircMAP2 in plasma exosomes of AIS patients We extracted exosomes from the plasma of the study subjects and detected the expression level of CircMAP2 in the exosomes. The study included 20 patients with ischemic stroke (AIS) and 25 healthy controls (HCs). We used RT-qPCR to detect the expression level of CircMAP2 in the plasma exosomes of the AIS group and the healthy controls. The results are as follows: Figure 9 As shown, the results indicate that the plasma exosome CircMAP2 expression level in the AIS group was significantly higher than that in the control group ( P <0.001).

[0083] ROC curves were used to evaluate the value of plasma exosome CircMAP2 expression level within 24 hours of AIS onset as a diagnostic biomarker for AIS. The results are as follows: Figure 10 As shown, the results indicate that the area under the curve (AUC) is 0.842; the Youden index is highest when the diagnostic threshold for CircMAP2 is selected as 1.384, with a sensitivity of 80.00% and a specificity of 88.00%. Figure 10 ).

[0084] In summary, the results indicate that CircMAP2 is highly expressed in the plasma and plasma exosomes of AIS patients, and that CircMAP2 has specificity and good sensitivity in the diagnosis of AIS, thus it has diagnostic value for AIS and can be used as a diagnostic biomarker for AIS patients.

[0085] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting the expression level of circular RNA CircMAP2 in the preparation of diagnostic products for acute ischemic stroke or products for detecting the size of cerebral infarction area, wherein the sequence of the circular RNA CircMAP2 is shown in SEQ ID NO.2.

Images