Application of CsPHT gene in improving the resistance of tea plant to Ectropis oblique and Guignardia theae
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TEA RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-02-27
- Publication Date
- 2026-05-26
Smart Images
Figure CN121718570B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tea tree gene application technology, specifically relating to tea trees. CsPHT Application of genes in improving tea plant resistance to tea geometrid moth and tea anthracnose. Background Technology
[0002] tea tree( Camellia sinensis Tea is an important perennial woody economic crop in my country, and its tender buds and leaves are the main raw materials for various tea products. Under natural growing conditions, tea trees are often subjected to biological stresses such as pests, fungi, bacteria, and viruses, which seriously affect the growth of tea trees and lead to a significant decline in tea yield and quality. Among them, the tea geometrid moth (… Ectropis obliqua Camellia spinylospora is one of the main leaf-eating pests, and during outbreaks, it can feed on large quantities of leaves and tender stems; while Camellia spinylospora ( Colletotrichum camelliae Anthracnose, caused by _____, is one of the most serious leaf diseases in tea gardens and poses a threat to the safe production of tea.
[0003] In recent years, significant progress has been made in the identification and functional study of genes related to disease and insect resistance in tea plants. For example, the gene encoding tea plant glycoside transferase... CsUGT89AC1 and CsUGT95B11 By promoting the synthesis of quercetin glycosides, the resistance of tea plants to tea geometrid moths is enhanced; laccase-encoded gene CsLAC17 Regulating tea plant resistance to tea ring spot disease by mediating lignin synthesis pathway; sweet protein-like protein encoding gene CsTLP30 This enhances tea plant resistance to anthracnose by mediating the accumulation of hydrogen peroxide. However, existing research has largely focused on identifying resistance genes that regulate single diseases or pests affecting tea plants, while gene resources that can synergistically regulate tea plants to cope with both disease and pest stresses remain to be discovered.
[0004] Phenolic amides are an important class of plant defense-related metabolites. Studies have shown that plants such as rice, tomato, and tobacco can utilize phenolic amides to defend against pathogens or herbivorous insects. Currently, only one acyltransferase gene capable of catalyzing the synthesis of feruloylputrescine has been identified in tea plants. CsHT9 They also discovered that this gene can regulate the resistance of tea plants to anthracnose. Summary of the Invention
[0005] To address the problems existing in the prior art, the purpose of this invention is to design and provide a tea tree CsPHT A technical solution for applying genes to improve the resistance of tea plants to tea geometrid moth and tea anthracnose. Specifically, this invention is the first to demonstrate... CsPHTThis gene is an important regulator of dual resistance (i.e., resistance to both insects and diseases) in tea plants. It positively regulates the resistance of tea plants to tea geometrid moths and anthracnose by catalyzing the synthesis of cinnamyl putrescine, ferulicyl putrescine, and p-coumaryl putrescine. This invention provides a new gene resource for breeding new tea varieties with dual resistance using this gene.
[0006] The present invention is specifically implemented using the following technical solutions:
[0007] The first aspect of the present invention provides the above-mentioned tea tree CsPHT Application of genes in regulating resistance of tea trees to tea geometrid moth, the tea tree CsPHT The gene CDS sequence is shown in SEQ ID NO.1.
[0008] The second aspect of the present invention provides the above-mentioned tea tree CsPHT Application of genes in regulating resistance of tea trees to anthracnose, the tea trees CsPHT The gene CDS sequence is shown in SEQ ID NO.1.
[0009] The third aspect of the present invention provides the above-mentioned tea tree CsPHT Application of genes in simultaneously regulating tea plant resistance to tea geometrid moth and tea anthracnose, the tea plant CsPHT The gene CDS sequence is shown in SEQ ID NO.1.
[0010] Furthermore, the regulation is positive regulation, specifically through transient overexpression. CsPHT Genes promote the synthesis of defense-related metabolites (such as p-coumaryl putrescine and ferulicyl putrescine), inhibit the growth and development of the tea geometrid moth and the infection of tea anthracnose, thereby enhancing the dual resistance of tea plants; by inhibiting CsPHT The expression of the gene reduces the content of coumaroyl putrescine and feruloyl putrescine in tea plants, thereby weakening the resistance of tea plants to tea geometrid moth and tea anthracnose.
[0011] A fourth aspect of the present invention provides a tea tree model that enhances susceptibility to tea geometrid moths and tea anthracnose, the model containing inhibitors for tea tree growth. CsPHT The product of gene expression, the tea tree CsPHT The gene CDS sequence is shown in SEQ ID NO.1.
[0012] Furthermore, the product comprises antisense oligonucleotides with sequences as shown in SEQ ID NO.11-15.
[0013] The fifth aspect of this invention provides a method for cultivating plant varieties resistant to tea geometrid moths and tea anthracnose, using tea trees... CsPHT Genes were introduced into target plants to obtain transgenic plants with enhanced resistance to tea geometrid moth and tea anthracnose. CsPHTThe gene CDS sequence is shown in SEQ ID NO.1.
[0014] The sixth aspect of this invention provides a method for inhibiting tea plant resistance to tea geometrid moth and tea anthracnose, by introducing antisense oligonucleotides as shown in SEQ ID NO. 11-15 into tea plants to inhibit the resistance of tea plants. CsPHT Transcriptional expression of genes.
[0015] The present invention has the following beneficial effects:
[0016] (1) The tea tree was revealed for the first time CsPHT Genes possess both disease resistance and insect resistance functions; it has been clarified that CsPHT The key role of genes in the positive regulation of tea plant resistance to tea geometrid moth and tea anthracnose provides a new perspective for in-depth analysis of the molecular mechanisms of tea plant resistance to diseases and pests.
[0017] (2) Completed CsPHT Functional validation in tea plants and heterologous tobacco. The invention not only validated the function of this gene through transient overexpression in tea plants, but also conducted heterologous validation in tobacco, demonstrating the conservation of its function.
[0018] (3) First clarification CsPHT A novel mechanism mediating dual resistance in tea plants by regulating the accumulation of key metabolites. This invention confirms CsPHT The encoded acyltransferase can catalyze the synthesis of cinnamyl putrescine, ferulicyl putrescine, and p-coumaryl putrescine in vitro. Cinnamyl putrescine, ferulicyl putrescine, and p-coumaryl putrescine were found to have in vitro anti-tea geometrid moth and anti-tea anthracnose effects, verifying the regulation of the tea plant's internal... CsPHT The expression level of these substances can alter the accumulation of ferulic acid putrescine and p-coumaric acid putrescine in tea plants, thereby changing the resistance of tea plants to tea geometrid moth and tea anthracnose. This links gene function, metabolic changes and resistance phenotypes, laying a key foundation for breeding new tea varieties with multiple resistances and high quality. Attached Figure Description
[0019] Figure 1 The in vitro recombinant protein diagram of GST-CsPHT and the in vitro enzyme activity verification are shown, including:
[0020] (a) is an SDS-PAGE electrophoresis image (Coomassie brilliant blue staining) of the purified recombinant protein GST-CsPHT; (b) is a schematic diagram of the in vitro catalytic synthesis products of GST-CsPHT protein, which can catalyze the reaction of acyl donors (cinnamyl-CoA, feruloyl-CoA, and p-coumaroyl-CoA) with acyl acceptors putrescine to generate cinnamyl putrescine, feruloyl putrescine, and p-coumaroyl putrescine, respectively.
[0021] Figure 2The insect and disease resistance functions of cinnamyl putrescine, feruloyl putrescine, and p-coumaryl putrescine are as follows:
[0022] (a) Effects of adding cinnamyl putrescine, feruloyl putrescine and p-coumaryl putrescine to artificial feed on the growth of tea geometrid moth; (b) Effects of adding cinnamyl putrescine, feruloyl putrescine and p-coumaryl putrescine to potato dextrose agar medium on the growth of tea anthracnose.
[0023] Figure 3 for CsPHT Schematic diagram of gene expression patterns in different tissues of tea plants;
[0024] Figure 4 For overexpression CsPHT Disease and pest resistance phenotypes in tea plants with genetic traits CsPHT The transcriptional level of genes, including:
[0025] (a) is overexpression CsPHT Genes and control tea leaf petals CsPHT (a) relative expression level; (b) overexpression CsPHT Western blot analysis of GFP-CsPHT protein in tea leaf fragments and control tea leaves; (c) shows overexpression. CsPHT The contents of cinnamyl putrescine, feruloyl putrescine, and p-coumaryl putrescine in tea leaves and control leaves; (d) the contents of tea geometrid moths feeding on the overexpressed substances. CsPHT (e) Changes in body weight and phenotypes after exposure to tea leaves and control group (scale bar = 1 cm); (e) shows the results of infection with overexpressing tea leaves. CsPHT Diameter and phenotype of anthracnose lesions on tea leaves compared with control tea leaves (scale bar = 1 cm).
[0026] Figure 5 For silence CsPHT Tea tree disease and pest resistance phenotypes and genes CsPHT The transcriptional level of genes, including:
[0027] (a) for silence CsPHT Genes and control tea leaf petals CsPHT (a) relative expression level; (b) silence CsPHT The content of cinnamyl putrescine, feruloyl putrescine, and p-coumaryl putrescine in the leaves of gene- and control tea plants; (c) for silencing by feeding. CsPHT Weight changes and phenotypes of tea geometrid moths in tea leaves of the gene and control groups (scale bar = 1 cm); (d) shows the silencing of infection. CsPHT Diameter and phenotype of anthracnose lesions on leaves of tea plants from the gene and control groups (scale bar = 1 cm).
[0028] Figure 6 for CsPHTThe contents of cinnamyl putrescine, feruloyl putrescine, and p-coumaryl putrescine in tobacco leaves with transient gene overexpression for 48 h and control tobacco leaves. Detailed Implementation
[0029] The technical features and advantages of the invention will be described in more detail below with reference to the accompanying drawings.
[0030] Based on two tea tree transcriptome databases showing feeding by the tea geometrid moth and infection by tea anthracnose, a candidate gene capable of simultaneously responding to both biotic stresses was identified and designated as follows: CSS0014383 Sequence alignment results indicate that, although CSS0014383 and CsHT9 They belong to the same branch, but their amino acid sequence similarity is only 87.97%; quantitative real-time PCR results show that in tea leaves at different leaf positions, CSS0014383 and CsHT9 The transcriptional expression patterns show diametrically opposed trends. These results suggest... CSS0014383 It may encode a novel acyltransferase with a different function from CsHT9, and we will CSS0014383 Named CsPHT In-depth analysis CsPHT The function of the encoded acyltransferase, clarifying whether it can catalyze the synthesis of phenolamide compounds with disease-resistant, insect-resistant, or even both disease-resistant and insect-resistant activities, and its synergistic regulatory effect on the disease and insect resistance of tea trees, is of great research value for revealing new defense metabolic pathways in tea trees. The research results can also provide new molecular targets and genetic resources for the breeding of multi-resistant and highly resistant tea tree varieties.
[0031] All of the following experiments were performed in at least three independent biological replicates.
[0032] Example 1: Tea Tree CsPHT Cloning of genes
[0033] (1) Using leaves of the tea tree variety 'Longjing 43' as material, the leaves were quick-frozen in liquid nitrogen and then ground into powder in liquid nitrogen. RNA was extracted using the RNAprep pure plant total RNA extraction kit (purchased from Tiangen Biotech Co., Ltd.) following the instructions.
[0034] (2) Reverse transcription to generate the first strand: Using the PrimerScript® RT Reagent Kit (Takara, China), reverse transcription was performed strictly in accordance with the instructions to synthesize cDNA.
[0035] (3) Design an expandable website using Primer3 Input CsPHTPrimers for the full length of the gene, with upstream primer: 5'-ATGAAGGTGAGAAAAGAGAGC-3' (SEQ ID NO.3) and downstream primer: 5'-TCAGTCTAGGGAGTAGCAAA-3' (SEQ ID NO.4).
[0036] (4) Using the first strand of cDNA as a template, PCR amplification was performed using PrimesSTAR Max Premix enzyme (Takara, China) to obtain... CsPHT Full-length gene. The PCR amplification system was as follows: 1 μL cDNA template, 10 μL 2×PrimesSTAR Max Premix, 1 μL 10 pmol / μL upstream primer, 1 μL 10 pmol / μL downstream primer, and 7 μL ddH2O. The PCR amplification program was: 98 ℃ for 3 min, 98 ℃ for 10 s, 55 ℃ for 15 s, 72 ℃ for 20 s, and 72 ℃ for 5 min, for 35 cycles.
[0037] (5) The purified PCR product obtained from the above amplification was ligated into the pClone 007 vector (purchased from Beijing Qingke Biotechnology Co., Ltd.) to obtain pClone 007-CsPHT, which was then transformed into E. coli competent cells DH5α and sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing to obtain... CsPHT The nucleotide sequence, specifically shown in SEQ ID NO.1, encodes 434 amino acid residues. CsPHT The encoded amino acid sequence is shown in SEQ ID NO.2.
[0038] Example 2: In vitro recombinant GST-CsPHT protein and its functional verification
[0039] (1) Construction of pGEX-4T-2-CsPHT recombinant plasmid: The pGEX-4T-2 vector was double-digested with Sal I and BamHI restriction endonucleases. After reacting at 37 ℃ for 60 min, the samples were subjected to agarose gel electrophoresis and the products were recovered to obtain linearized vectors with restriction sites. CsPHTHomologous primers with Sal I and BamHI restriction sites were designed based on the CDS sequence, with the upstream primer being 5'-GGTTCCGCGTGGATCCATGAAGGTGAGAAAAGAGAGC-3' (SEQ ID NO. 5) and the downstream primer being 5'-GGCCGCTCGAGTCGACTCAGTCTAGGGAGTAGCAAA-3' (SEQ ID NO. 6). The amplified product was inserted between the Sal I and BamHI sites of the pGEX-4T-2 vector via homologous recombination. The PCR reaction system consisted of: 100 ng of linearized vector pGEX-4T-2, 50 ng of gene product with restriction adapters, 2 μL of 5× In-Fusion SnapAssembly Master Mix (Takara, China), and ddH2O to a final volume of 10 μL. The PCR program was: 50 ℃ for 15 min, followed by storage at 4 ℃. The recombinant product was transformed into E. coli competent cells DH5α and sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing to obtain the pGEX-4T-2-CsPHT plasmid.
[0040] (2) The target gene is in Escherichia coli BL21 Chinese fusion expression: reference BL21(DE3) pLysS competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) were transferred to the pGEX-4T-2-CsPHT plasmid via heat shock according to the instructions. BL21(DE3) After sequencing verification by the company, pLysS competent cells were cultured until the OD value of the bacterial culture reached 0.5-0.6. Then, isopropyl β-D-thiogalactopyranoside (IPTG) was added to the bacterial culture to a final concentration of 0.1 mM, and the culture was induced by culturing at 120 r / min and 28 ℃ for 6 h.
[0041] (3) Protein purification: The target protein GST-CsPHT was purified using a GST-tagged protein purification kit (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) according to the instructions. The purified protein solution was detected by SDS-PAGE electrophoresis. The protein concentration was determined using the Bradford method. 3 μL of the purified protein solution was mixed with 297 μL of Coomassie brilliant blue solution, and the absorbance was measured at 595 nm using a microplate reader (Molecular Devices, San Jose, CA, USA). At the same time, a standard curve was plotted using bovine albumin (BSA) standard solution to accurately quantify the concentration of purified GST-CsPHT protein.
[0042] (4) In vitro catalytic function of CsPHT: In a reaction buffer containing 100 mM Tris / HCl buffer (pH 7.5), three acyl donors (feruloyl-coenzyme A (Fer-CoA), cinnamoyl-coenzyme A (Cin-CoA), and p-coumaroyl-coenzyme A (Cin-CoA)) were used respectively. p -Coumaroyl-coenzyme A, p Enzymatic activity of GST-CsPHT recombinant protein was detected using putrescine (Put) and its acyl receptor, Cou-CoA. The treatment group (1 μL GST-CsPHT, 500 μM putrescine, 200 μM feruloyl-CoA / cinnamoyl-CoA / p-coumaroyl-CoA, adjusted to 100 μL with 100 mM Tris / HCl buffer) and the control group (1 μL pGEX-4T-2 empty vector protein, 500 μM putrescine, 200 μM feruloyl-CoA / cinnamoyl-CoA / p-coumaroyl-CoA, adjusted to 100 μL with 100 mM Tris / HCl buffer) were both reacted at 30 °C for 30 min, and the reaction was terminated by adding 200 µL methanol. The reaction solution was then filtered through a 0.22 μm organic filter membrane, and the target products, including feruloyl putrescine, cinnamyl putrescine, and p-coumaryl putrescine, in the supernatant were detected using high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS, Thermo Fisher Scientific, Bremen, Germany).
[0043] like Figure 1 As shown, the GST-CsPHT fusion protein was highly expressed in *E. coli* after IPTG induction. According to protein electrophoresis results, its apparent molecular weight was approximately 74.7 kDa, consistent with the theoretical prediction. Furthermore, UPLC-MS / MS analysis showed that the recombinant GST-CsPHT protein could catalyze the synthesis of feruloyl-CoA, cinnamoyl-CoA, and p-coumaroyl-CoA from the acceptor putrescine in vitro. In conclusion, the CsPHT protein exhibits catalytic activity in the in vitro synthesis of feruloyl-CoA, cinnamoyl-CoA, and p-coumaroyl-CoA.
[0044] Example 3: In vitro verification of the disease and insect resistance function of ferulic acid putrescine
[0045] (1) Based on the physiological concentrations of ferulic acid, cinnamyl putrescine, and p-coumaryl putrescine in tea leaves induced by tea geometrid moth feeding, the standards of the three compounds were prepared into different concentrations using 80% methanol solution: ferulic acid (0 μg / g, 0.3 μg / g, 0.6 μg / g, 1.2 μg / g, 2.4 μg / g), p-coumaryl putrescine (0 μg / g, 0.06 μg / g, 0.09 μg / g, 0.12 μg / g), and cinnamyl putrescine (0 μg / g, 250 μg / g, 500 μg / g, 750 μg / g, 1000 μg / g), and added to artificial feed. The main components of the artificial feed were: tea tree 'LJ43' leaf powder, soybean powder, agar powder, sucrose, ascorbic acid, yeast powder, sorbitol, parabens, etc. Three-day-old tea geometrid moth larvae with uniform growth and 4 hours of starvation were randomly grouped into groups of 10 larvae each, placed in a square petri dish (10 cm × 10 cm). They were fed artificial feed supplemented with different concentrations of phenolic amide compounds. The artificial feed was added as needed to ensure no competition for food and to prevent starvation. The larvae were weighed at 6, 9, and 12 days (or 8, 11, and 13 days) after feeding.
[0046] (2) Based on the physiological concentrations of ferulic acid putrescine, coumarin putrescine, and cinnamyl putrescine in tea leaves, these three substances were added to potato dextrose agar (PDA) medium at concentrations of 0.15 μg / g, 0.32 μg / g, and 300 μg / g, respectively, with PDA medium containing an equal amount of 80% methanol serving as a control. A 5 mm diameter anthracnose mycelium was inoculated at the center of each PDA medium and cultured in the dark at 26 ℃. The diameter of the lesions was measured using the cross-crossing method at 3, 4, 5, 6, and 7 days after inoculation.
[0047] like Figure 2 As shown, the exogenous addition of three phenolic amide compounds—feruloyl putrescine, p-coumaroyl putrescine, and cinnamyl putrescine—significantly inhibited the growth of tea geometrid moth larvae and significantly suppressed the spread of anthracnose lesions. This result indicates that the above-mentioned compounds... CsPHT The phenolic amide compounds produced by the catalysis have dual resistance: on the one hand, they reduce the growth and development rate of tea geometrid moth larvae, and on the other hand, they inhibit the infection of tea anthracnose.
[0048] Example 4: CsPHT Expression patterns in different tissues of the tea plant
[0049] Tissue samples from the buds, the first to fifth leaves below the buds, and the first to fourth stem segments of the 'Longjing 43' tea variety were ground into powder under liquid nitrogen for later use. Transcriptome sequencing was performed by Beijing Novogene Technology Co., Ltd. Figure 3 show,CsPHT The gene was expressed in all tissues tested (buds, leaves, and stems), and its expression level showed tissue specificity: the expression level was relatively high in the stem, while the expression level was relatively low in the buds and the first leaf.
[0050] Example 5: Transient overexpression CsPHT To enhance the resistance of tea plants to tea geometrid moth and tea anthracnose fungus.
[0051] (1) Construction of transient overexpression vectors
[0052] The pCAMBIA2300-35S-N-eGFP vector was double-digested with Sal I and BamHI restriction endonucleases. After reacting at 37 ℃ and 30 ℃ for 30 min respectively, agarose gel electrophoresis was performed, and the products were recovered to obtain linearized vectors with restriction sites. CsPHT Homologous primers with Sal I and BamHI restriction sites were designed based on the CDS sequence. The upstream primer was 5'-CGAGCTGTACAAGGGATCCATGAAGGTGAGAAAAGAGAGC-3' (SEQ ID NO.7), and the downstream primer was 5'-GGCATGCCTGCAGGTCGACTCAGTCTAGGGAGTAGCAAA-3' (SEQ ID NO.8). The amplified product was inserted between Sal I and BamHI in the pCAMBIA2300-35S-N-eGFP vector via homologous recombination. The PCR reaction system consisted of: 100 ng of linearized vector pCAMBIA2300-35S-N-eGFP, 50 ng of gene product with restriction linker, 2 μL of 5× In-Fusion Snap Assembly Master Mix, and ddH2O to a final volume of 10 μL. The PCR program was: 50℃ for 15 min, followed by storage at 4℃. The recombinant product was transformed into E. coli competent cells DH5α and sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing to obtain the pCAMBIA2300-35S-N-eGFP-CsPHT plasmid.
[0053] (2) Transient overexpression of CsPHT in tea plants
[0054] The recombinant plasmid pCAMBIA2300-35S-N-eGFP-CsPHT and the empty vector plasmid pCAMBIA2300-35S-N-eGFP were transformed into GV3101 (pSoup-p19) Agrobacterium using a freeze-thaw method. Tea leaves of uniform maturity were selected, and 1 mL of Agrobacterium solution was injected into the entire leaf from the underside using a syringe. Samples were taken at 72 h and 96 h post-injection. Leaves injected with Agrobacterium containing the empty vector plasmid were designated as controls, and leaves injected with Agrobacterium containing the recombinant plasmid were designated as CsPHT overexpression. CsPHT The effectiveness of overexpression was demonstrated by the determination of gene expression levels, protein levels, and the content of three phenolic amide compounds. Specifically, Western blot was used to detect the expression level of the GFP fusion protein; quantitative real-time PCR was used to detect the expression level of the target gene, with the upstream primer being 5'-CACTCTCGATGAAGCCATGC-3' (SEQ ID NO. 9) and the downstream primer being 5'-GTGAGCCTACCGCCAATGA-3' (SEQ ID NO. 10); and UPLC-MS / MS was used to detect the content of the three phenolic amide compounds.
[0055] (3) Transient overexpression CsPHT The impact of tea trees on the growth of tea geometrid moths
[0056] Compare the control leaves and CsPHT Leaves overexpressing the gene were fed to 3-day-old tea geometrid moth larvae (starved for 4 hours before feeding). Weights were taken at 6, 9, and 11 days post-feeding to determine the presence of the overexpressing gene in the tea plant. CsPHT The effects on the growth and development of the tea geometrid moth.
[0057] (4) Transient overexpression CsPHT The effect of tea trees on the growth of anthracnose fungus in tea
[0058] Control leaves and tea anthracnose spore suspension were respectively infected. CsPHT Overexpressing leaves were examined, and the diameter of lesions was measured using the cross-multiplication method at 2, 3, and 4 days post-infection to determine the presence of overexpression in tea plants. CsPHT Effects on the growth of *Anthracis chinensis*.
[0059] The results are as follows Figure 4 As shown. (1) Expression verification: Compared with the control leaves injected with empty pCAMBIA2300-35S-N-eGFP, CsPHTGene expression was significantly upregulated in leaves treated with pCAMBIA2300-35S-N-eGFP-CsPHT, with relative expression levels 5.87-fold (72 h) and 6.50-fold (96 h) higher than the control, respectively; (2) Protein and metabolite accumulation: Western blot results showed that the expression of GFP-CsPHT fusion protein could be detected in the transformed leaves, proving the effectiveness of overexpression. Metabolite analysis further showed that overexpression CsPHT It significantly promoted the accumulation of defense-related metabolites feruloyl putrescine and p-coumaryl putrescine, but had no effect on the content of cinnamyl putrescine; (3) Insect-resistant function: feeding overexpression CsPHT The weight of the larvae of the tea geometrid moth on the leaves was significantly inhibited on day 9. (4) Disease resistance: Compared with the anthracnose lesions on the control leaves, the larvae of the tea geometrid moth overexpressing the disease showed significantly reduced weight gain. CsPHT Anthracnose lesions on tea leaves were significantly inhibited from day 2 to 4 post-inoculation. In summary, overexpression of... CsPHT The gene can effectively and significantly improve the tea plant’s resistance to tea geometrid moth and tea anthracnose.
[0060] Example 6: Suppression CsPHT The expression level of this substance can reduce the resistance of tea plants to tea geometrid moth and tea anthracnose fungus.
[0061] (1) Design antisense repression primers
[0062] according to CsPHT Five antisense oligonucleotide sequences (AsODN) and a control sense oligonucleotide sequence (sODN) were designed for the gene sequence. The specific names and sequences are as follows:
[0063] AsODN1: 5'-GGTCATGCAAGGGAAGAGAA-3' (SEQ ID NO.11)
[0064] AsODN2: 5'-GGTGCGGTCATGCAAGGGAA-3' (SEQ ID NO.12)
[0065] AsODN3: 5'- TGGTGCGGTCATGCAAGGGA -3' (SEQ ID NO.13)
[0066] AsODN4: 5'-ATGGTGCGGTCATGCAAGGG-3' (SEQ ID NO.14)
[0067] AsODN5: 5'- GGGGAGAAAATGGTGCGGTC -3' (SEQ ID NO.15)
[0068] sODN: 5'-TCCCTTGCATGACCGCACCA-3' (SEQ ID NO.16)
[0069] Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the concentration was diluted to 20 μM with ddH2O before use.
[0070] (2) Antisense inhibition CsPHT Transcriptional expression in tea plants
[0071] Three-year-old 'Longjing 43' tea trees with uniform growth and no pests or diseases were selected. Diluted antisense primers were injected into the second leaf below the bud using a 1 mL syringe. Leaves injected with the positive strand served as a control. RNA was extracted from both treated and control leaves 24 hours after injection, and cDNA was obtained through reverse transcription. The cDNA was then detected by quantitative real-time PCR. CsPHT Gene expression levels. The upstream primer was 5'- CACTCTCGATGAAGCCATGC-3' (SEQ ID NO.9), and the downstream primer was 5'- GTGAAGCCTACCGCCAATGA-3' (SEQ ID NO.10).
[0072] For analysis CsPHT The effect of gene silencing on the accumulation of ferulic acid putrescine, coumaric acid putrescine and cinnamyl putrescine was investigated. Leaf samples treated with the same method were extracted with 1 mL of 80% (v / v) methanol solution and analyzed by UPLC-MS / MS.
[0073] (3) Antisense inhibition CsPHT and its impact on the growth of the tea geometrid moth
[0074] Comparison and CsPHT Extracted leaves treated with gene silencing for 24 hours were fed to 3-day-old tea geometrid moth larvae (starved for 4 hours before feeding). The leaves were replaced daily, or new leaves were added when 50% of the leaves had been consumed to ensure a sufficient food source. The leaves were weighed on days 5 and 7 after feeding to determine the silencing effect. CsPHT The impact of tea trees on the growth and development of the tea geometrid moth.
[0075] (4) Antisense inhibition CsPHT and its impact on anthrax infection in tea.
[0076] Take control and CsPHT Ex vivo leaves treated with gene silencing for 24 h were infected with tea anthracnose spore suspension. The diameter of the lesions was measured using the cross-multiplication method at 3, 5 and 6 days after infection.
[0077] like Figure 5 As shown, compared with the control, CsPHTGene silencing significantly downregulated the treatment of leaves CsPHT The expression level of the gene significantly inhibited the accumulation of ferulic acid putrescine and p-coumaric acid putrescine. Furthermore, the content of cinnamyl putrescine also showed a significant decreasing trend. P = 0.064). Bioassay results show that... CsPHT Decreased gene expression levels significantly reduced tea plant resistance to the tea geometrid moth and tea anthracnose. Specifically, compared to the weight of the tea geometrid moth that fed on the control leaves, the weight of the moth that fed on the control leaves decreased significantly. CsPHT The weight of tea geometrid moths significantly increased after 7 days of gene silencing treatment, reaching 1.16 times that of the control; compared with tea anthracnose infecting control leaves, the weight of infected leaves increased significantly. CsPHT The diameter of anthracnose lesions in tea leaves treated with gene silencing was significantly increased. The lesion areas on days 3, 5, and 6 after inoculation were 1.11 times, 1.16 times, and 1.44 times that of the control, respectively.
[0078] Example 7: Verifying the conservation of CsPHT catalytic function using a natural substrate library
[0079] (1) Tobacco varieties and cultivation conditions: Tobacco Benedict ( Nicotiana benthamiana The seedlings were planted in seedling blocks and cultured in an incubator. Culture conditions were set as follows: 16 h: 8 h photoperiod, daytime temperature 25℃, nighttime temperature 22℃, humidity 70%.
[0080] (2) Constructing the target gene expression vector
[0081] The 35S-GFP vector was double-digested with Sac I and BamHI restriction endonucleases. After reacting at 37 °C and 30 °C for 30 min respectively, the products were recovered by agarose gel electrophoresis to obtain linearized vectors with restriction sites. CsPHTHomologous primers with Sac I and BamHI restriction sites were designed based on the CDS sequence, with the upstream primer being 5'-AGGGGGACGAGCTCATGAAGGTGAGAAAAGAGAGCT-3' (SEQ ID NO.17) and the downstream primer being 5'-TCGACTCTAGAGGATCCGTCTAGGGAGTAGCAAATTTGT-3' (SEQ ID NO.18). The amplified product was inserted between the Sac I and BamHI sites of the 35S-GFP vector via homologous recombination. The PCR reaction mixture consisted of 100 ng of linearized 35S-GFP vector, 50 ng of the gene product with the restriction linker, 2 μL of 5× In-Fusion Snap Assembly Master Mix, and ddH2O to a final volume of 10 μL. The PCR program was 50 °C for 15 min, followed by storage at 4 °C. The recombinant product was transformed into E. coli competent cells DH5α and sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing to obtain the 35S-GFP-CsPHT plasmid.
[0082] (3) Agrobacterium transformation and tobacco infection
[0083] The constructed plasmid and empty vector were transformed into Agrobacterium GV3101 using the freeze-thaw method; single clones in LB medium were inoculated into 1 mL of LB liquid medium (containing 50 μg / mL). -1 Rifampicin 50 μg·mL -1 Kanamycin was cultured at 28°C with shaking at 200 r / min, followed by bacterial testing. The bacterial cultures that had been successfully validated by colony PCR (empty vector and recombinant vector containing the target gene) were added to LB liquid medium (containing 50 μg / mL) respectively. -1 Rifampicin 50 μg·mL -1 The bacteria were cultured in kanamycin until the OD value of the bacterial solution was 0.8-1.0; the cells were collected by centrifugation at 6000 r / min for 10 min, and resuspended in Agrobacterium infection solution until the OD value of the bacterial solution was between 0.8-1.0. The cells were then incubated in the dark for 2-3 h; tobacco plants with good growth and uniform growth at 4-6 weeks were selected for injection, and the samples were collected after 48 h of culture for determination of the content of phenolic amide compounds in tobacco.
[0084] like Figure 6 As shown, compared with the unloaded control tobacco leaves, transient overexpression CsPHT The contents of ferulic acid, p-coumaryl putrescine, and cinnamyl putrescine in tobacco leaves were significantly increased, being 2.35 times, 22.18 times, and 7.54 times that of the control leaves, respectively. This result indicates that... CsPHTThe gene also exhibits catalytic activity in the synthesis of phenolamide compounds in the heterologous plant system, proving that... CsPHT Gene function is conserved.
[0085] In summary, based on the established in vitro anti-tea geometrid moth and anti-anthrax bacteria effects of ferulic acid putrescine, p-coumaryl putrescine, and cinnamyl putrescine, this invention further identifies and functionally characterizes the key tea plant enzyme CsPHT that catalyzes their synthesis. This enzyme is composed of... CsPHT Gene encoding. Subsequently, through overexpression in tobacco, a natural substrate library... CsPHT The gene demonstrates the conservation of CsPHT catalytic function. Furthermore, we investigated the effects of transient overexpression and transient inhibition of CsPHT in tea plants. CsPHT Gene analysis confirmed that CsPHT can regulate the accumulation levels of ferulic acid putrescine, coumaric acid putrescine, and cinnamyl putrescine in leaves; simultaneously, combining transient overexpression and transient inhibition... CsPHT The effects of genetically modified tea plant materials on the growth of tea geometrid moth and tea anthracnose fungus were systematically elucidated. CsPHT The gene positively regulates the tea plant’s resistance to tea geometrid moth and tea anthracnose by catalyzing the synthesis of the three putrescine derivatives mentioned above.
Claims
1. Camellia sinensis CsPHT application of a gene in regulating the resistance of Camellia sinensis to Ectropis oblique CsPHT The CDS sequence of the gene is shown as SEQ ID NO. 1, and the regulation is overexpression CsPHT of the gene to improve the resistance of Camellia sinensis to Ectropis oblique.
2. Camellia sinensis CsPHT application of the gene in regulating the resistance of Camellia sinensis to tea anthracnose CsPHT The CDS sequence of the gene is shown as SEQ ID NO. 1, and the regulation is overexpression CsPHT application of the gene to improve the resistance of Camellia sinensis to tea anthracnose.
3. Camellia sinensis CsPHT application of the gene in simultaneously regulating the resistance of Camellia sinensis to Ectropis oblique and the resistance of Camellia sinensis to anthracnose CsPHT The CDS sequence of the gene is shown as SEQ ID NO. 1, and the regulation is overexpression CsPHT application of the gene to improve the resistance of Camellia sinensis to Ectropis oblique and improve the resistance of Camellia sinensis to anthracnose.
4. A method for cultivating a plant variety resistant to tea geometrid moth and tea anthracnose, characterized in that, tea trees CsPHT Genes were introduced into target plants to obtain transgenic plants with enhanced resistance to tea geometrid moth and tea anthracnose. CsPHT The gene CDS sequence is shown in SEQ ID NO.1; The plant in question is either the tea tree or Arabidopsis thaliana.