Atrazine and chloroacetamide herbicide degrading bacteria, enzyme and application

Abstract

The present application belongs to the field of biotechnology, and particularly relates to a propisochlor and chloroacetamide herbicide degrading bacterium, enzyme and application. Rhodococcus The present application screens and finds that a propisochlor and other chloroacetamide herbicide degrading bacterium, red ball (Rhodococcus sp.) L-9, can efficiently degrade propisochlor and other chloroacetamide herbicides. metABD Further, the present application clones a propisochlor and other chloroacetamide herbicide degrading gene cluster from the strain L-9, which can encode three-component cytochrome P450 oxidase MetABD to catalyze propisochlor and other five kinds of chloroacetamide herbicides (alachlor, acetochlor, isopropylamine, propisochlor and butachlor) degradation, and has enantiomeric selectivity for catalyzing chiral herbicide propisochlor, and has good social and economic benefits.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a herbicide-degrading bacterium, enzyme, and its application, including metolachlor and chloroacetamide. Background Technology

[0002] Pesticides are chemical or biological agents used to control agricultural and forestry pests and regulate plant growth. Scientific application of pesticides can effectively control pests, diseases, weeds, and rodents, increase crop yields, and ensure food security. Among various pesticides, herbicides make a particularly significant contribution to agricultural production. However, with the long-term, large-scale, and widespread use of herbicides, their residues in soil and water bodies are becoming increasingly prominent, posing a serious threat to the ecological environment and human health. Chloroacetamide herbicides are widely used for weed control in farmland due to their low cost and high efficacy, but long-term use leads to their continuous accumulation in the environment, causing pollution and ecological risks. Microorganisms play an irreplaceable role in the degradation of pollutants and ecological restoration. Microorganisms are diverse, have strong metabolic capabilities, and are widely distributed, actively participating in the natural material cycle and promoting the transformation and removal of pollutants. From the ocean to soil pores, from hot springs to extremely cold regions, microorganisms are almost ubiquitous. Through a series of complex biochemical reactions, they transform toxic pollutants into low-toxicity or harmless substances, or even completely decompose them into carbon dioxide and water, thereby maintaining the stability and health of the ecosystem.

[0003] Metolachlor (MET), traded as "Doul," is a widely used selective herbicide. Its pure form is a colorless liquid with a boiling point of approximately 100 °C and a water solubility of 530 mg / kg (25 °C). The chemical name of this compound is 2-methyl-6-ethyl- N -(1-Methyl-2-methoxyethyl)- N -Chloroacetylaniline, molecular formula Its molecular weight is 283.79. Structurally, it possesses two chiral centers: a chiral nitrogen axis and a chiral carbon axis, thus exhibiting α-axis... S , α R , α R , and α S , Four enantiomers. The mechanism of action of metolachlor mainly involves inhibiting long-chain fatty acid elongases, interfering with fatty acid biosynthesis, and disrupting cell membrane formation, thereby inhibiting weed seed germination and seedling growth. With its large-scale and frequent use, this herbicide has become widely residual in environmental media. Metolachlor easily adheres to crop surfaces or enters tissues, leading to agricultural product residues and posing a threat to ecosystems and human health. Studies have shown that metolachlor has potential hazards to crops and other non-target organisms. It and its degradation product, metolachlor oxalic acid, exhibit sublethal toxicity to various aquatic organisms. For example, high-concentration exposure can interfere with crayfish's perception and response to group signals, inhibiting their competitive and aggressive social behaviors. Metolachlor may also weaken the human body's ability to fight infection and clear tumors, cause anemia and convulsions, and irritate the eyes and skin, leading to symptoms such as shortness of breath and weakness. Therefore, a systematic assessment of the environmental residues, degradation pathways, and eco-health risks of metolachlor is of great significance for agricultural product safety and pollution control.

[0004] Chloroacetamide herbicides (CAAHs) are a class of contact herbicides widely used in corn, cotton, and soybean fields to effectively control annual and broadleaf weeds. Their mechanism of action primarily involves inhibiting long-chain fatty acid synthases in plants, interfering with lipid biosynthesis, and thus hindering normal plant growth to achieve weed control. Common CAAHs include metolachlor, acetochlor, propachlor, butachlor, isopropachlor, and isopropachlor-metolachlor. In recent years, with the widespread use of CAAHs, their residue and migration problems in the environment have become increasingly prominent. These agents are used in large quantities and easily enter water bodies through runoff, posing a potential threat to aquatic ecosystems and non-target organisms. Studies have shown that CAAHs have significant developmental toxicity to aquatic organisms. For example, metolachlor can have toxic effects on fish, interfering with their oxidative stress system and inducing abnormal cell apoptosis. Juvenile zebrafish exposed to this type of herbicide often exhibit morphological and behavioral abnormalities such as body curvature, edema, and lethargy. Therefore, conducting research on the efficient removal of metolachlor and other CAAH residues from the environment is of great significance for ensuring ecological security.

[0005] Microorganisms are major contributors to the removal of residual CAAHs such as metolachlor and other CAAHs from the environment. Currently, several strains capable of aerobic degradation of CAAHs have been successfully isolated and screened. Research on the aerobic degradation of metolachlor, acetochlor, and propachlor is relatively mature, and representative degrading bacteria reported include yeast (…). Candida xestobii Acinetobacter ( ) Acinetobacter sp.) GC-A6, Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Sphingosine mononucleosis ( Sphingomonas sp.) DC-6 and Rhodococcus (sp.) DC-6 and Rhodococcus ( Rhodococcussp.) B2, etc. In contrast, there is less research on degrading strains of isopropylate, and the main known strains are Penicillium oxalate (sp.) Penicillium oxalicum MET-F-1 and Paracoccus sp. FLY-8, etc. The ability of microorganisms to degrade pollutants stems from their diverse enzyme systems. These enzymes, acting as biocatalysts, can break the chemical bonds of pollutants through reactions such as oxidation, reduction, hydrolysis, and dehalogenation, achieving specific or non-specific stepwise decomposition of pollutants. Currently reported genes and enzymes related to the degradation of chloroacetamide herbicides mainly include hydrolases Ch1H, three-component oxidases CndABC, and carboxylesterases Dho; those related to the degradation of their metabolites include hydrolases CmeH and bifunctional amide hydrolases DanH. However, the currently reported degrading enzymes can only catalyze the degradation of metolachlor, acetochlor, propachlor, butachlor, isopropachlor, and their metabolites CMEPA and MEA; no enzyme capable of effectively catalyzing the degradation of isopropachlor has yet been discovered. Furthermore, research on the enantioselective degradation of isopropachlor remains lacking, which limits the application scope of related enzymes and their encoding genes in the environmental remediation of chiral pesticides. Summary of the Invention

[0006] The purpose of this invention is to provide a highly efficient bacterium for degrading isometolachlor and other CAAHs, along with key functional genes and enzymes, to improve the degradation efficiency of isometolachlor and other CAAHs and reduce ecological and environmental risks. Through extensive screening, this invention discovered a highly efficient bacterium for degrading isometolachlor and other CAAHs, and cloned the gene cluster encoding cytochrome P450 in the degradation process using molecular biology techniques, thus completing this invention.

[0007] One technical solution of the present invention provides a bacterium L-9 capable of degrading isopropylate and other CAAHs, wherein the strain taxonomically belongs to the genus Rhodococcus (…). Rhodococcus ), named Rhodococcus sp. L-9, deposited at the China Center for Type Culture Collection, accession number CCTCC M 20231929, address: Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province; deposit date: October 18, 2023.

[0008] One technical solution of the present invention is aimed at degrading strains. Rhodococcus sp. L-9 was successfully cloned using genome sequencing, comparative genomics analysis, and heterologous expression verification to encode a gene cluster encoding a cytochrome P450 oxidoreductase that degrades metolachlor. This gene cluster is... metABC, metABD or metABCD, Among them, the genes that make up the P450 redox gene cluster metA The nucleotide sequence is shown in SEQ ID NO.2, gene. metB The nucleotide sequence is shown in SEQ ID NO.3, gene. metC The nucleotide sequence is shown in SEQ ID NO.4, gene. metD The nucleotide sequence is shown in SEQ ID NO. 5.

[0009] In some embodiments, the present invention discloses a cytochrome P450 oxidoreductase gene cluster. metABCD The full length of this gene cluster (from start codon to stop codon) is 3240 bp, and its nucleotide sequence is shown in SEQ ID NO.1.

[0010] One technical solution of the present invention discloses a cytochrome P450 oxidoreductase system, wherein the P450 oxidoreductase system is MetABC, MetABD, or MetABCD, wherein the amino acid sequence of enzyme MetA constituting the P450 oxidoreductase system is shown in SEQ ID NO.6, the amino acid sequence of enzyme MetB is shown in SEQ ID NO.7, the amino acid sequence of enzyme MetC is shown in SEQ ID NO.8, and the amino acid sequence of enzyme MetD is shown in SEQ ID NO.9.

[0011] In some embodiments, the present invention discloses a cytochrome P450 oxidoreductase system MetABD, wherein the enzyme system MetABD includes enzymes MetA, MetB, and MetD, wherein the amino acid sequence of enzyme MetA is shown in SEQ ID NO.6; the amino acid sequence of enzyme MetB is shown in SEQ ID NO.7; and the amino acid sequence of enzyme MetD is shown in SEQ ID NO.9.

[0012] In one aspect, the present invention provides a vector containing the cytochrome P450 redox gene cluster described above. metABC, metABD or metABCD.

[0013] In one aspect, the present invention provides a recombinant expression vector capable of expressing a cytochrome P450 oxidoreductase system. Preferably, the P450 oxidoreductase system is MetABC, MetABD, or MetABCD.

[0014] In one embodiment of the present invention, the recombinant expression vector is prepared by inserting the cytochrome P450 redox gene clusters into the expression vector. In this context, homologous recombination is used to separately transfer genes... metA , metB and metD Insert expression vector The N-terminal and C-terminal His tags are retained for subsequent protein purification.

[0015] In one aspect, the present invention provides a genetically engineered bacterium containing the aforementioned cytochrome P450 redox enzyme system MetABC / MetABD / MetABCD. The genetically engineered bacterium contains a recombinant expression vector of the cytochrome P450 redox gene cluster; preferably, the expression strain is... E coli BL21(DE3).

[0016] In one aspect, the present invention provides a bacterial strain. Rhodococcus Application of sp. L-9 or cytochrome P450 oxidoreductase system MetABC / MetABD / MetABCD in the degradation of metolachlor and / or CAAHs.

[0017] In one aspect, the present invention provides the aforementioned cytochrome P450 redox gene cluster ( metABC / metABD / metABCD Application of recombinant expression vectors in the degradation of metolachlor and / or various CAAHs.

[0018] In one aspect, the present invention provides a cytochrome P450 redox gene cluster ( metABC / metABD / metABCD Recombinant expression vectors and strains Rhodococcus Application of the sp. L-9 or cytochrome P450 oxidoreductase system MetABC / MetABD / MetABCD in the preparation of formulations that degrade metolachlor and / or various CAAHs.

[0019] In one aspect, the present invention provides a method for preparing plants capable of degrading metolachlor and / or CAAHs, the method comprising using the cytochrome P450 redox gene cluster (CPAHs) of the present invention. metABC / metABD / metABCD Transgenic into the plant.

[0020] In one aspect, the present invention provides a liquid chromatography-mass spectrometry method for the detection of isopropylate and / or CAAH degradation products, the method comprising the following steps: (1) Degrading isopropyl chlorpyrifos and / or CAAHs in the sample by using the aforementioned degrading bacteria, the aforementioned cytochrome P450 oxidoreductase system or the aforementioned preparation; (2) Take a portion of the degraded sample and add an equal volume of acetonitrile to it. After shaking and mixing, centrifuge at 12000 rpm / min for 2 min. Filter the sample with a 0.22 μm nylon filter membrane to obtain the test solution. (3) The test solution was analyzed by high performance liquid chromatography. The detection conditions were as follows: Column: Agilent Eclipse SB-C 18 4.6 mm × 150 mm; 5 μm; mobile phase: acetonitrile: ultrapure water = 80:20 (v / v); detection wavelength: 222 nm; injection volume: 20 μL; column temperature: 30 °C.

[0021] (4) The test solution was analyzed by UPLC-TQ-MS. The detection conditions were as follows: instrument model: ultra-high performance liquid chromatography-tandem quadrupole time-of-flight mass spectrometer; column: ACQUITY UPLC BEH-C18 (2.1 mm × 100 mm, 1.7 μm); injection volume: 5 μL; column temperature: 30 °C; mobile phase A was 1‰ formic acid water, and B was 1‰ formic acid acetonitrile; gradient elution program is shown in Table 2-4; ion source ESI+ / -; scan range 50 - 1200 m / z; ion source temperature 120 °C; capillary voltage 1.0 KV; capillary temperature 275 °C; desolventizing temperature 600 °C; desolventizing gas flow rate: 1000 L / h; cone voltage: 30 V; scan mode: MSE Continuum. The elution program is shown in the table.

[0022]

[0023] In one aspect, the present invention provides a method for enhancing the degradation of isopropyl hydroxylamine by the degrading bacteria or the oxidoreductase system described herein, wherein sodium pyruvate is added to the degradation system; preferably, the amount of sodium pyruvate added is 1%.

[0024] In this invention, the highly efficient CAAH-degrading strains obtained by this invention are metolachlor and other CAAHs. Rhodococcus sp. L-9 and key functional gene clusters metABC / metABD / metABCD The enzyme system MetABC / MetABD / MetABCD has significant application prospects, including: (1) The degradation strains are prepared into microbial agents through modern microbial fermentation technology and applied to the remediation and removal of environments contaminated with metolachlor and / or CAAHs; (2) Using modern enzyme catalysis technology, the cytochrome P450 oxidoreductase system is made into enzyme preparations to achieve in-situ remediation of water bodies and soils contaminated with isopropyl chlorpyrifos and / or CAAHs residues. (3) By introducing degradation genes into crops through modern bioengineering technology, corresponding herbicide-resistant transgenic crops can be constructed to solve the phytotoxicity problem caused by metolachlor and / or CAAHs. Beneficial effects

[0025] (1) The strain of the present invention Rhodococcus sp. L-9 efficiently degrades metolachlor, exhibiting enantiomeric selectivity in its degradation. After 7 days of culture in MSM, strain L-9 was only able to degrade α-metolachlor. S ,1 S -MET; After adding 1% sodium pyruvate as an exogenous carbon source, strain L-9 showed resistance to 100 μM metolachlor for four enantiomers of α-carboxamide. R ,1 R -MET, α S ,1 R -MET, α R ,1 S -MET and α S ,1 S The degradation rates of MET increased to 22.8%, 60.3%, 34.1%, and 100%, respectively.

[0026] (2) The cytochrome P450 oxidoreductase system MetABD provided by the present invention has degradation rates of 69.7%, 68.5%, 82.6%, 90.4%, 71.8% and 35.7% for 100 μM metolachlor, acetochlor, propachlor, butachlor, isopropachlor and isopropachlor within 72 h, respectively. It can be used to remove residual pollution of isopropachlor and / or various CAAHs in the environment, and has very important theoretical value and application prospects.

[0027] (3) The cytochrome P450 oxidoreductase system provided by the present invention can simultaneously catalyze the degradation of metolachlor and a variety of CAAHs, and has great potential for application in the construction of transgenic crops that degrade metolachlor and CAAHs. Attached Figure Description

[0028] Figure 1 Identification of strain L-9. Colony morphology (A) and cell morphology (B) of strain L-9. Phylogenetic tree based on the 16S rRNA gene sequence of strain L-9 (C).

[0029] Figure 2 Strain L-9 exhibits chiral degradation of four enantiomers of metolachlor.

[0030] Figure 3 Degradation of metolachlor by strain L-9 and identification of the products. (A) HPLC chromatogram of metolachlor degradation products; (B) UPLC-Q-TOF-MS chromatogram of metolachlor; (C) UPLC-Q-TOF-MS chromatogram of metolachlor degradation products; (D) Degradation pathway of metolachlor by strain L-9.

[0031] Figure 4(A) Genomic parallelism analysis between wild-type strain L-9 and mutant strain L-9m; (B) Gene clusters metABCD The search.

[0032] Figure 5 Gene clusters metABCD Functional verification. (A) Gene cluster metABCD (B) Verification of recombinant plasmid pET28a- metABCD (C) Electrophoretic pattern; Verification of the degradation effect of recombinant strain on metolachlor.

[0033] Figure 6 Gene met A / B / D Functional verification. (A) Recombinant expression plasmid pET28a- metA / B / C / D (a) Electrophoretic pattern; (b) The effect of the combination of enzymes MetA / B / C / D on the degradation of metolachlor; (c) HPLC liquid chromatogram of the degradation of metolachlor by MetABD.

[0034] Figure 7 SDS-PAGE image of enzymes MetA / B / D.

[0035] Figure 8 Enzymatic properties determination of the MetABD cytochrome P450 oxidoreductase system. (A) Temperature; (B) pH; (C) Metal ions.

[0036] Figure 9 Functional validation of the cytochrome P450 oxidoreductase system MetABD. (A) MetABD catalyzes the degradation of other CAAHs; (B) MetABD catalyzes the degradation of four enantiomers of metolachlor.

[0037] Information on the preservation of biological materials Degrading strain L-9, classified and named Rhodococcus sp. L-9 is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on October 18, 2023, with accession number CCTCC M20231929.

[0038] In this invention, "L-9", "strain L-9", "degrading strain L-9", Rhodococcus In this invention, those skilled in the art will understand that "sp. L-9" refers to the strain with accession number CCTCCM 2024439. Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments. Unless otherwise specified, the technical solutions described in this invention are conventional methods in the art, and the reagents or materials described, unless otherwise specified, are conventional reagents derived from commercial sources.

[0040] The culture medium formulations described in the following examples are as follows: The LB medium (Luria-Bertani Medium) is prepared as follows: 10.0 g tryptone, 10.0 g NaCl, 5.0 g yeast extract, 1 L ultrapure water, pH 7.0. For solid LB medium, add 1.8% agar powder.

[0041] Mineral Salt Medium (MSM): 0.2 g MgSO4・7H2O, 1.5 g K2HPO4, 0.5 g KH2PO4, 1.0 g NH4Cl, 0.02 g GaCl2, 1 L ultrapure water, pH 7.0.

[0042] Both of the above culture media need to be sterilized at 121 °C for 20 minutes.

[0043] Example 1: Isolation and Identification of Strain L-9 1.1 Enrichment, domestication, isolation, and purification of metolachlor-degrading bacteria

[0044] 10.0 g of activated sludge from a pesticide factory was added to 100 mL of liquid MSM medium, followed by the addition of metolachlor to achieve a final concentration of 200 μM. The medium was then incubated at 37 ℃ with constant temperature shaking at 150 rpm for 7 days. After incubation, the culture was transferred at a 10% (v / v) inoculum to 100 mL of fresh MSM medium containing a final concentration of 200 μM metolachlor, and incubated again under the same conditions for 7 days. This enrichment culture was repeated three times. The degradation of metolachlor by the enriched medium was then determined by high-performance liquid chromatography (HPLC). The fifth-generation enriched medium was diluted and plated onto solid plates containing 200 μM MSM. Single colonies were picked and purified on LB solid plates, and the degradation effect of the purified single bacteria on metolachlor was determined. Using metolachlor as the selection pressure, a metolachlor-degrading bacterium, designated L-9, was finally isolated and purified.

[0045] 1.2 Morphological and molecular biological identification of degrading strain L-9

[0046] Strain strain L-9 was inoculated onto LB agar plates and incubated at 37 °C for 4 days. Colony morphology was observed. L-9 colonies on LB agar plates appeared as round, red protrusions, 0.5–3.0 mm in diameter, with smooth surfaces and edges, generally moist, and regular in shape. Figure 1 A); the bacteria are short rod-shaped, without flagella, and measure 0.6–1.0 μm × 1.0–2.0 μm ( Figure 1 B). This strain is a Gram-positive bacterium that can grow at temperatures ranging from 25 to 42 °C, with an optimal growth temperature of 30 to 37 °C; it can also grow at pH values ​​ranging from 5.0 to 9.0, with an optimal growth pH of 6.0 to 8.0.

[0047] Total DNA was extracted from strain L-9 using a bacterial genome extraction kit. The 16S rRNA gene sequence of strain L-9 was amplified using the universal primer pair 27F (5′-AGAGTTTGATCCTGGCTCAG-3′, SEQ ID NO.8) and 1492R (5′-TACGGCTACCTTGTTACGACTT-3′, SEQ ID NO.9) as a template. The PCR amplification product was sequenced by a biotechnology company. The obtained 16S rRNA gene sequence of strain L-9 was compared with the 16S rRNA genes of reported type strains in the EzBioCloud database (www.ezbiocloud.net). Sequences with high homology to type strains were selected, and a phylogenetic tree of resistant strains was constructed using MEGA 11.0 software via neighbor-joining. Figure 2 As shown, the 16S rRNA gene sequence of strain L-9 isolated in this invention is similar to that of Rhodococcus spp. ( Rhodococcus ) are on one branch, and Rhodococcus electrodiphilus JC435 T The highest homology was 99.8%.

[0048] Based on the morphological and molecular biological identification results, strain L-9 was identified as Rhodococcus (…). Rhodococcus sp.), named Rhodococcus sp. L-9, deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on October 18, 2023, with accession number CCTCC M 20231929. The strain L-9 isolated in this invention belongs to the genus *Rhodococcus*. Rhodococcus This enriches the seed resource bank of metolachlor-degrading bacteria.

[0049] Example 2: Enantiomer-selective degradation of metolachlor by strain L-9 and identification of its metabolites 2.1 Degradation of four enantiomeric forms of metolachlor by strain L-9

[0050] A single colony of strain L-9 was picked from the surface of LB solid medium using a sterile inoculation loop and transferred to 200 mL of LB liquid medium. The culture was incubated at 37 °C and 150 r / min on a shaker for 48 h until the logarithmic growth phase. The cells were collected by centrifugation at 8000 r / min for 10 min. The cells were washed twice with sterile liquid MSM and resuspended in sterile MSM to achieve OD500. 600 nm It is 0.9 (1.0 × 10) 5 –1.0 × 1.0 7 The seed culture of strain L-9 (cfu / mL) is obtained. A certain amount of strain L-9 seed culture was inoculated into 100 mL MSM and 100 mL MSM + 1% sodium pyruvate (SP) medium, respectively, to achieve the desired final OD value. 600 nm = 0.3, add four enantiomers (α-propargyl) of metolachlor to a final concentration of 100 μM. S ,1 S -MET, α R ,1 S -MET, α R ,1 R -MET, α S ,1 R -MET), cultured in a shaker at 37 ℃ and 150 rpm, with the UV spectrophotometer detection wavelength adjusted to OD. 600 nm Sampling was performed at regular intervals, and the concentrations of the four enantiomers of metolachlor were detected by high performance liquid chromatography to verify whether strain L-9 had a degradation effect on the four enantiomers of metolachlor.

[0051] The results showed that after 7 days of culture in MSM, the strain could only degrade 37.7% of 100 μM α-hydroxylamine. S ,1 R -MET; After the addition of 1% sodium pyruvate, strain L-9 showed resistance to 100 μM of four enantiomers of metolachlor α-propargyl. R ,1 R -MET, α S ,1 R -MET, α R ,1 S -MET and α S ,1 S The degradation rates of MET increased to 22.8%, 60.3%, 34.1%, and 100%, respectively.

[0052] 2.2 Degradation pathway of metolachlor by strain L-9

[0053] The seed culture of strain L-9 was inoculated into 100 mL of MSM liquid medium to allow its OD to develop. 600 nm = 0.3, then add isopropyl alachlor standard working solution to make the final concentration of isopropyl alachlor in the culture medium 100 μM, and incubate at 37 ℃ with shaking at 150 rpm. Samples are taken periodically to determine the concentration of isopropyl alachlor and its metabolites. The liquid chromatography (HPLC) detection method for isopropyl alachlor and its metabolites is as follows: chromatographic column: Agilent Eclipse SB-C18 (4.6 mm × 150 mm; 5 μm); mobile phase: acetonitrile: pure water = 80:20 (v / v); detection wavelength: 222 nm; injection volume: 20 μL; column temperature: 30 °C. The UPLC-QTOF-MS detection conditions for isopropylmetolachlor and its metabolites were as follows: Instrument: Ultra-high performance liquid chromatography-tandem quadrupole time-of-flight mass spectrometer; Column: ACQUITY UPLC BEH-C18 (2.1 mm × 100 mm, 1.7 μm); Injection volume: 5 μL; Column temperature: 30°C; Mobile phase A: 1‰ formic acid in water, Mobile phase B: 1‰ formic acid in acetonitrile; Gradient elution program as shown in Table 2-4; Ion source: ESI+ / -; Scan range: 50-1200 m / z; Ion source temperature: 120 °C; Capillary voltage: 1.0 KV; Capillary temperature: 275 °C; Desolventizing temperature: 600 °C; Desolventizing gas flow rate: 1000 L / h; Cone voltage: 30 V; Scan mode: MSE Continuum.

[0054] The specific gradient elution procedure is shown in Table 1: Table 1. HPLC Detection and Elution Procedures for Metoclopramide and its Metabolites

[0055] HPLC detection results of metolachlor and its metabolites are as follows: Figure 2 As shown in Figure A. In the control group without strain L-9, a chromatographic peak appeared only at 6.07 min, which is metolachlor. In the treatment group with strain L-9, after 24 h of culture, the chromatographic peak at 6.07 min partially decreased, and a new chromatographic peak appeared at 3.78 min, presumably the product peak. UPLC-QTOF-MS analysis results are shown below. Figure 2 As shown in Figures B / C, the molecular ion peak [M+H] of the parent compound metolachlor was detected in positive ion mode. + (m / z 284.1422) and sodium addition peak [M+Na] +(m / z 306.1237), its characteristic fragment peak at m / z 176.1422 originates from the depropoxylation cleavage of the chloroaromatic ring structure. The molecular ion peak [M+H] of metabolite M1. + The molecular weight was 270.1252, a decrease of 14.0170 Da from the parent molecular weight, while retaining the characteristic fragment peak at 176.1422, indicating that the aromatic ring structure remained unchanged. Based on the mass spectrometry data, the initial pathway of isopropylate degradation by strain L-9 can be inferred (…). Figure 2 D) is O -Demethylation produces 2-chloro- N -(2-ethyl-6-methylphenyl)- N -(1-hydroxypropan-2-yl)-acetamide (CEMPHPA).

[0056] Example 3 Cloning and functional verification of the isopropylate degradation gene cluster 3.1 Genomic comparison analysis between strain L-9 and mutant strain L-9m

[0057] Total DNA was extracted from strain L-9 and the mutant strain L-9m, which lost its ability to degrade metolachlor, using a high-salt method. The total genomic DNA was dissolved in sterile water and sent to a biological sequencing company for bacterial genome sequencing. The sequencing results showed that the genome sizes of strains L-9 and L-9m were 5,917,873 bp and 5,850,721 bp, respectively, with G+C contents of 70.2% and 70.3%, and CDS values ​​of 5805 and 5823, respectively (Table 2).

[0058] Table 2. Comparison of genomic characteristics between strain L-9 and strain L-9m

[0059] 3.2 Identification and Validation of Metolachlor Degradation Gene Clusters Comparative genomic analysis was performed between the wild-type strain L-9 and the mutant strain L-9m. Collinearity results showed that the mutant strain L-9m lost approximately 55.9 kb of bases in Plasmid4. Figure 3 Annotation analysis of the functions of all ORFs in the missing fragment revealed three missing values ​​in Plasmid4, as shown in the following results. Figure 4 As shown, after multiple searches and comparative analyses, a 3240 bp base sequence was found in the missing fragment. metABCD It is related to the previously reported acetochlor degradation gene cluster. ethABCD The homology is high (over 90%), and it is preliminarily speculated that it may be a gene cluster responsible for the degradation of isopropyl acetochlor by strain L-9.

[0060] To further verify the gene clusters in mutant strain L-9m metABCD Whether it was truly lost, or an omission during the genome sequencing process, in the gene cluster metABCD Primers metA-F2 (TCAGCGTCCTCCGCTGTCGA, SEQ ID NO.10) and metD-R2 (TCATCCCCGATGTAGAGGGC, SEQ ID NO.11) were designed at both ends. Using total DNA from wild-type L-9 and mutant L-9m as templates, respectively, PCR amplification was performed, and the PCR products were subjected to agarose gel electrophoresis.

[0061] The results are as follows Figure 5 As shown in Figure A, the system using total DNA from wild-type strain L-9 as a template amplified a complete gene fragment of approximately 3.2 Kb, while the system using total DNA from mutant strain L-9m as a template did not amplify the gene fragment. Therefore, the gene cluster in the L-9 genome... metABCD It is indeed lost, it is speculated. metABCD It is highly likely to be the degradation gene cluster of isopropyl chlorpyrifos.

[0062] 3.3 Gene Clusters metABCD Functional verification 3.3.1 PCR amplification of gene clusters metABCD Using total genomic DNA from strain L-9 as a template, primers metA-F2 (TCAGCGTCCTCCGCTGTCGA, SEQ ID NO.10) and metD-R2 (TCATCCCCGATGTAGAGGGC, SEQ ID NO.11) were designed for PCR amplification. The PCR amplification reaction system (50 μL) is shown in Table 3, and the PCR reaction procedure is shown in Table 4.

[0063] Table 3 PCR reaction system

[0064]

[0065] 3.3.2 Construction of plasmids Using the principle of homologous recombination, and employing the homologous recombination kit (ClonExpress® II One Step Cloning Kit, Nanjing Novizan), the recombinant plasmid pET28a- was constructed. metABCD The specific operating steps are as follows: (1) Using snapgene software, primers (pET28a-F / pET28a-R) were designed at both ends of the expression vector plasmid pET28a. The primer sequences are shown in Table 10. The vector was linearized by PCR reaction. The PCR amplification reaction system (50 μL) is shown in Table 5. The PCR reaction program is shown in Table 6.

[0066]

[0067]

[0068] (2) The PCR products were purified using a gel extraction kit. For specific methods, please refer to the instructions of the kit (FastPure Gel DNAExtraction Mini Kit). The recombination reaction system (20 μL) is shown in Table 7. The recombination conditions were incubation at 37°C for 30 min in the PCR instrument.

[0069]

[0070] 3.3.3 Construction of recombinant strains Take a tube from the -80°C ultra-low temperature freezer E. coli 100 μL of BL21(DE3) competent cells were thawed on ice. 10 μL of the enzyme-linked product (volume not exceeding 10% of the competent cells) was gently added, and the mixture was carefully incubated on ice for 30 min. The centrifuge tube was then gently placed in a 42 °C water bath (preheated beforehand) for 45 s heat shock, and then returned to ice for 2-3 min. 900 μL of sterile, room-temperature LB liquid medium was added, and the centrifuge tube was placed in a 37 °C shaker to regenerate the cells at 150 rpm for 1.5 h. After regeneration, the cells were collected by centrifugation at 5,000 rpm for 5 min. 900 μL of supernatant was discarded, and the remaining liquid was pipetted to mix the cells. 100 μL of the bacterial culture was evenly spread onto a plate containing Km (50 mg·L⁻¹). -1 Incubate the bacteria on LB agarose gel at 37 °C for 12–16 h. Select healthy single colonies and inoculate them into test tubes. Amplify the target gene fragment using universal primers T7 / T7-T. Send the bacterial culture with correctly identified bands from agarose gel electrophoresis, along with the unpurified PCR product, to a biotechnology company for sequencing. Store a portion of the correctly sequenced bacterial culture in glycerol tubes at -80 °C, and store the remaining portion at 4 °C for later use. The successfully transformed strain is named... E. coli BL21(DE3) (pET28a- metABCD ).

[0071] See Figure 5As shown in A and B: PCR amplification yielded a fragment size of approximately 3200 bp, consistent with the theoretical value of 3240 bp, indicating that the recombinant plasmid pET28a- metABCD Successfully imported E. coli In BL21 (DE3).

[0072] 3.3.4 Verification of the degradation effect of recombinant strains on metolachlor strain E. coli BL21 (DE3) (pET28a- metABCD ),and E. coli Single colonies of BL21(DE3)(pET28a) were picked from LB agar plates and inoculated into 100 mL of LB liquid medium supplemented with 50 mg / L Km antibiotics. After incubation to the logarithmic growth phase, the bacterial cells were collected by low-speed centrifugation at 5000 rpm, washed twice with sterile inorganic salt liquid medium, and then resuspended in inorganic salts to OD. 600 nm It is version 1.0, and will be used for subsequent experiments.

[0073] The prepared bacterial suspensions were inoculated into LB liquid medium containing 100 μM metolachlor for degradation. E. coli BL21(DE3) (pET28a- metABCD )and E. coli BL21(DE3) (pET28a) required the addition of 0.5 mM IPTG and incubation at 37 ℃ with shaking at 150 rpm. Samples were taken periodically, and the degradation effect of metolachlor was detected by high-performance liquid chromatography (HPLC) after pretreatment.

[0074] See Figure 5 As shown in C: 7 days, control group strain E. coli BL21 (DE3) (pET28a) showed a degradation rate of 3.9% for 100 μM metolachlor, and the recombinant strain... E. coli BL21 (DE3) (pET28a- metABCD The degradation rate of 100 μM isopropylate was 16.5%. These results indicate that the gene cluster... metABCD It is the gene cluster in strain L-9 responsible for degrading metolachlor.

[0075] Example 4: Cloning and Functional Verification of the Metolachlor Degradation Gene 4.1 metA / B / C / D Gene cloning Single colonies were selected from solid plates containing wild-type L-9 and placed in 10 μL of sterile water. After resuspending the colonies by pipetting, they were heated in boiling water at 100 °C for 10 min (L-9 is a Gram-positive bacterium; boiling water will disrupt the cell wall and release L-9 DNA). Colony PCR was then performed using this as a template. The target gene was amplified using designed primers (metA-F / metA-R, metB-F / metB-R, metC-F / metC-R, metD-F / metD-R). metA , metB , metC , metD The PCR amplification system is shown in Table 8, and the reaction procedure is shown in Table 9. metA and metB The 72°C extension time was 90 seconds. metC and metD The extension time is 20 seconds.

[0076]

[0077]

[0078]

[0079] Agarose gel electrophoresis was used to verify the band size and specificity of the target gene. The correct bands were recovered using a gel recovery kit, following the gel recovery method described in the kit. The recovered fragments were stored at -20 °C for subsequent experiments.

[0080] 4.2 Construction of expression vector pET28a and vectors with different gene combinations of metA / B / C / D pET28a and different gene combination vectors of metA / B / C / D (pET28a- metB pET28a- metAB pET28a- metBC pET28a- metBD pET28a- metABC pET28a- metABD pET28a- metABCD The vector was constructed using homologous recombination, and the construction method is described in section 2.3.2. Successfully transformed transformants were selected, and the target gene sequence was amplified using T7-F / T7-T primers. The results were then detected by agarose gel electrophoresis.

[0081] See Figure 6 A in the diagram represents a gene. metA , metB , metC and metDThe fragment sizes were 1300 bp (theoretical size 1269 bp), 1300 bp (theoretical size 1203 bp), 400 bp (theoretical size 327 bp), and 300 bp (theoretical size 228 bp), respectively, indicating that the gene... metA , metB , metC and metD Successfully constructed onto expression plasmid pET28a.

[0082] 4.3 Induction of MetA / B / D enzyme expression and extraction of crude enzyme solution Single colonies were picked from LB plates ( E coli BL21 (DE3)(pET28a- metA / B / D The sample was cultured in 300 mL of LB medium containing 50 mg / L kanamycin (Km) at 37 °C with shaking until OD reached. 600 nm The concentration of the protein was increased to 0.4-0.6. Subsequently, strains expressing MetA and MetB were induced to express protein by adding 0.5 mM IPTG, while strains expressing MetC and MetD were not given IPTG. All strains were cultured at 16 ℃ with shaking for 12 h. After induction, the bacterial cells were collected by centrifugation at 4 ℃ and 10000 rpm for 5 min. The bacterial pellet was washed twice with pre-chilled Tris-HCl buffer (washing conditions: 4 ℃, 5000 rpm, 10 min), and then resuspended in 15 mL of Tris-HCl buffer containing 2 mM β-mercaptoethanol (as a protectant). The resuspended bacterial solution was sonicated on ice with parameters set as follows: 3 s on, 5 s off. E. coli BL21 (DE3) (pET28a- metC / D It usually takes one round (5 minutes) to completely break down; while for E. coli BL21 (DE3) (pET28a- metA / B If the protein is not completely broken down, it will require 3-4 rounds (15-20 min), and some proteins may not be completely broken down due to inclusion bodies. After the protein is broken down, centrifuge at 12000 rpm for 20 min at 4 ℃, collect the supernatant after centrifugation, which is the crude enzyme solution. Place it on ice or store it in a 4 ℃ refrigerator for later use.

[0083] 4.4 Verification of the effect of enzyme combination on the degradation effect of metolachlor See Figure 6As shown in B: neither a single enzyme (MetB) nor a combination of two enzymes (MetAB, MetBC, MetBD) could degrade metolachlor. The combination of three enzymes (MetABC and MetABD) and MetABCD all showed metolachlor degradation effects. The degradation rates of 100 μM metolachlor after 3 days were 21.2%, 25.7%, and 31.4%, respectively.

[0084] See Figure 6 As shown in C: The enzyme MetABD showed efficacy against 100 μM over 72 h. Rac The degradation rate of metolachlor was 15.2%, producing a distinct product peak with an elution time of 3.317 min. The liquid phase retention time of this product peak was consistent with that of CEMPHPA, the product produced by strain L-9 from the degradation of metolachlor. Therefore, MetABD can catalyze the demethylation of metolachlor to produce CEMPHPA.

[0085] Cytochrome P450 oxidoreductase-catalyzed reactions typically require multiple components to complete the substrate degradation process. Cytochrome P450 monooxygenase (MetB) plays a key role, with two redox partners (MetA and MetD) gaining electrons from the cofactor NAD(P)H to catalyze the hydroxylation of the substrate, leading to the demethylation of metolachlor to CEMPHPA. However, the multi-component enzyme reaction process is complex. Since the combinations of MetABC, MetABD, and MetABCD all demonstrate effectiveness in degrading metolachlor, MetABD is chosen for further testing due to its superior performance and relatively simpler combination process. The selection of MetABD does not imply that MetABCD cannot perform the corresponding function.

[0086] 4.5 Purification of enzymes MetA / B / D

[0087] The three enzymes MetA / B / D were expressed using the pET-28a (+) vector fusion. Both ends of the successfully constructed vector contained 6 × His tags, thus affinity purification was performed using Ni-NTA resin. The purification process was carried out at 4 °C. The purification steps are as follows: (1) Allow the preservation solution in the Ni-NTA gravity column to flow out completely naturally, then add 5 mL of Tris-HCl buffer and allow it to flow out naturally. Repeat this operation 3 times. (2) Add 10 mL of crude enzyme solution to the gravity column each time and allow it to drip out naturally until all the crude enzyme solution has passed through the column. Collect the breakthrough solution. (3) Add 10 mL of imidazole elution buffer with different concentration gradients (10 mM, 50 mM, 100 mM, 200 mM, 300 mM) to the gravity column in sequence, allow it to flow out naturally, and collect the elution solution. (4) Add 10 mL of 500 mM imidazole elution buffer to the gravity column and allow it to flow out naturally. Repeat this operation 3 times to completely remove other proteins remaining in the column. (5) Add 10 mL of Tris-HCl buffer to the gravity column and repeat 3 times. After it has flowed out naturally, add 10 mL of 20% (v / v) ethanol and store the gravity column in a -4 ℃ freezer.

[0088] Results: SDS-PAGE results of the fusion proteins 6 × His-MetA-6 × His and 6 × His-MetB-6 × His are as follows. Figure 7 As shown, the size of a single band is approximately 45 kDa, which is basically consistent with the theoretical values ​​of 46.1 kDa (MetA + 12 × His) and 46.4 kDa (MetB + 12 × His). The SDS-PAGE results of the fusion protein 6 × His-MetD-6 × His are shown below. Figure 7 As shown, when the concentration of imidazole is 200 mM, MetD can be completely washed away and the size of a single band is about 10.0 kDa, which is basically consistent with the theoretical value of 9.58 kDa (MetD + 12 × His).

[0089] Example 5: Enzymatic Properties Study of the Three-Component Enzyme MetABD Standard enzymatic reaction system: In a total volume of 1 mL of 20 mM Tris-HCl (pH = 7.4) buffer solution B (20 mM Tris-HCl (pH = 7.4), 2 mM β-mercaptoethanol), add 100 μM metolachlor and an appropriate amount of purified enzyme. Simultaneously, add cofactors (100 mM NaCl2 + 10 mM MgCl2 + 2 mM NADH + 2 mM Fe). 2+ The reaction was carried out at 30 °C for 3 days. Specific enzyme activity is defined as the amount of enzyme required to catalyze the degradation of 1 μmol of substrate per 1 min.

[0090] 5.1 Effect of pH on MetABD enzyme activity Prepare enzyme reaction buffer systems (500 mL) with different pH values: 50 mM acetate-sodium acetate buffer (pH 3.5–6.5), 50 mM Tris-HCl buffer (pH 7.0–9.0), and 50 mM glycine-NaOH buffer (pH 9.0–11.0). Add a certain amount of purified MetABD enzyme and 100 μM isopropyl chlorpyrifos and cofactors (100 mM NaCl₂ + 10 mM MgCl₂ + 2 mM NADH + 2 mM Fe²⁺) to each buffer. 2+ The enzyme reaction was carried out at 30 °C for 3 days, followed by the addition of an equal volume of acetonitrile to terminate the reaction. The concentration of isopropylmetribonucleic acid was determined by HPLC. The enzyme activity of the buffer system with the highest degradation rate was counted as 100%, and the relative enzyme activities of the other reaction systems were calculated. The control group did not contain enzyme, and all treatment groups and controls were performed in triplicate.

[0091] See Figure 8 As shown in Figure B, MetABD exhibits strong catalytic activity within a pH range of 5.5–7.5, with relative enzyme activity exceeding 60%. However, at pH < 5.5, the MetABD enzyme is almost completely inactivated. These results indicate that the optimal pH for the MetABD enzyme to catalyze the reaction of metolachlor is 7.0.

[0092] 5.2 Effect of temperature on MetABD enzyme activity

[0093] A certain amount of purified MetABD enzyme was added to the enzyme reaction buffer system at the optimal pH, along with a final concentration of 100 μM metolachlor and cofactors (100 mM NaCl2 + 10 mM MgCl2 + 2 mM NADH + 2 mM Fe). 2+ The enzyme was reacted at different temperatures (4 ℃, 16 ℃, 25 ℃, 30 ℃, 37 ℃, 42 ℃, 50 ℃, 60 ℃) for 3 days, and then the reaction was terminated by adding an equal volume of acetonitrile. The concentration of metolachlor was determined by HPLC, and the enzyme activity at the temperature with the highest degradation rate was taken as 100%, and the relative enzyme activity at other temperature conditions was calculated. The control group did not receive any enzyme, and all treatment groups and controls were performed in triplicate.

[0094] See Figure 8As shown in Figure A: at temperatures of 4 ℃ or 60 ℃, the relative activity of MetABD enzyme in catalyzing the degradation of metolachlor is 7.1%–11.8%; at temperatures of 25–42 ℃, the relative activity of MetABD enzyme in catalyzing the degradation of metolachlor can still reach about 80%; and at temperatures of 25–37 ℃, the relative activity of MetABD enzyme in catalyzing the degradation of metolachlor is the highest, reaching 100%. Therefore, the optimal temperature for MetABD enzyme to catalyze the degradation of metolachlor is 37 ℃.

[0095] 5.3 Effects of metal ions on MetABD enzyme activity

[0096] A certain amount of purified MetABD enzyme and a final concentration of 100 μM metolachlor and cofactors (100 mM NaCl2 + 10 mM MgCl2 + 2 mM NADH + 2 mM Fe) were added to the optimal pH enzyme reaction buffer system. 2+ ), and added various metal ions (K ions) to a final concentration of 1.0 mM respectively. + Ca 2+ Cr 3+ Cu 2+ Fe 2+ Fe 3+ Ni 2+ Zn 2+ Mg 2+ and Mn 2+ The enzyme reaction was carried out at the optimal reaction temperature for 3 days, followed by the addition of an equal volume of acetonitrile to terminate the reaction. The concentration of metolachlor was determined by HPLC. The enzyme activity of the control group (without metal ions) was set at 100%, and the relative enzyme activity under different metal ion addition conditions was calculated. The control group did not contain enzyme, and all treatment groups and controls were performed in triplicate.

[0097] See Figure 8 As shown in C: 1 mM K + Ca 2+ It can significantly improve MetABD enzyme activity, increasing enzyme activity by approximately 16%, with 1 mM Mg 2+ Ag + It also improved the catalytic activity of MetABD; in contrast, 1 mM Fe 3+ It has a strong inhibitory effect on MetABD enzyme activity, with an inhibition rate of 47%.

[0098] Example 6: Study on the catalytic activity of the three-component enzyme MetABD 6.1 Degradation of CAAHs by MetABD

[0099] A certain amount of pure enzyme MetABD was added to a 600 μL enzymatic reaction system. Then, six CAAHs (metolachlor, acetochlor, propachlor, butachlor, isopropachlor, and isopropachlor) and cofactors (100 mM NaCl2 + 10 mM MgCl2 + 2 mM NADH + 2 mM Fe) were added to a final concentration of 100 μM. 2+ The enzyme reaction was terminated by adding an equal volume of acetonitrile after reacting in a water bath at 30 °C for 3 days. The concentration of the substrate was determined by HPLC. The control group did not receive enzyme, and all treatment groups and controls were tested in triplicate.

[0100] See Figure 9 As shown in Figure A: Under 30 ℃ water bath conditions, in a standard enzyme reaction system, after 24 h of reaction, the degradation rates of 100 μM metolachlor, acetochlor, propachlor, butachlor, and isopropylmetolachlor by the enzyme MetABD were 21.7%, 20.6%, 38.2%, 60.9%, 28.7%, and 10.8%, respectively. As the reaction continued, after 72 h, the degradation rates of 100 μM metolachlor, acetochlor, propachlor, butachlor, and isopropylmetolachlor by the three-component enzyme MetABD were 69.7%, 68.5%, 82.6%, 90.4%, 71.8%, and 35.7%, respectively.

[0101]

[0102] 6.2 Degradation of four enantiomeric forms of metolachlor by MetABD A certain amount of enzyme MetABD (MetB concentration of 50 ng / μL) and four enantiomers of metolachlor at a final concentration of 100 μM were added to the enzyme reaction buffer system at the optimal pH. Cofactors (100 mM NaCl2 + 10 mM MgCl2 + 2 mM NADH + 2 mM Fe) were also added. 2+ The enzyme reaction was carried out at 30 °C for 3 days, followed by the addition of an equal volume of acetonitrile to terminate the reaction. The concentrations of the four enantiomers were determined by HPLC. The control group received no enzyme, and all treatment groups and controls were performed in triplicate.

[0103] See Figure 9 As shown in Figure B: Under 30 ℃ water bath conditions, in a standard enzyme reaction system, after 72 h of reaction, the enzyme MetABD reacts with 100 μM α-coagulant. R ,1 R -MET, α S ,1 R -MET, α R ,1 S -MET and α S ,1 SThe specific activities of -MET were 0.08, 0.11, 0.11, and 0.16 μmol / (min·mg), respectively. The catalytic rates of MetABD for the four enantiomers of metolachlor were: α S ,1 S -MET> α R ,1 S -MET = α S ,1 R -MET > α R ,1 R -MET.

Claims

1. A chloroacetamide-based herbicide-degrading bacterium, characterized in that, The strain is Rhodococcus ( Rhodococcus sp.) L-9, deposited at the China Center for Type Culture Collection, accession number CCTCC M 20231929, address: Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, on October 18, 2023.

2. The application of the degrading bacteria according to claim 1 in the preparation of formulations that degrade chloroacetamide herbicides, characterized in that, The chloroacetamide herbicides are metolachlor, acetochlor, propachlor, metolachlor, propachlor, and butachlor.

3. A method for improving the degradation ability of the degrading bacteria according to claim 1, characterized in that, Add 1% sodium pyruvate to the degradation system; the degradation capacity refers to the ability to degrade isopropyl chlorpyrifos.

Images