Primers and methods for quantitative monitoring of sargassum hemiphyllum biomass based on environmental DNA technology

By designing specific primer and probe sets and using real-time quantitative PCR technology, the problem of monitoring the biomass of Sargassum fusiforme, a large marine alga, has been solved, enabling efficient and accurate quantitative analysis and early warning, which is suitable for marine environmental monitoring.

CN121737340BActive Publication Date: 2026-06-23SOUTH CHINA SEA INST OF OCEANOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA SEA INST OF OCEANOLOGY CHINESE ACAD OF SCI
Filing Date
2026-02-25
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately monitoring and quantifying the biomass of Sargassum hemifolia, a large marine alga. Traditional methods are labor-intensive and environmentally damaging, and the application of eDNA technology in algae is limited.

Method used

We designed a specific primer and probe set to target the COX1 gene of Sargassum hemifolia, and combined it with real-time quantitative PCR technology to monitor algal biomass using environmental DNA technology, including sample collection, eDNA extraction and purification, qPCR detection, and established a standard curve for quantitative analysis.

Benefits of technology

It achieves highly specific and sensitive monitoring of Sargassum hemifolia, provides early warning of algal blooms, reduces labor costs, and is suitable for marine environmental monitoring and management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737340B_ABST
    Figure CN121737340B_ABST
Patent Text Reader

Abstract

The application discloses a primer and a method for quantitatively monitoring Sargassum hemiphyllum biomass based on environmental DNA technology and belongs to the technical field of molecular ecology. COX1 The primer probe set comprises an upstream primer, a downstream primer and a fluorescent probe which are specifically targeted at the mitochondrial DNA of Sargassum hemiphyllum The kit comprises the primer probe set, qPCR premix, nuclease-free water and Sargassum hemiphyllum plasmid positive control. The method comprises the following steps: collecting water samples and enriching eDNA, performing qPCR detection on the purified eDNA by using the primer probe set, and realizing qualitative detection and quantitative evaluation of Sargassum hemiphyllum by using Cq values or a standard curve. The method has the advantages of high sensitivity, strong specificity, no damage to the environment and target organisms, wide range of rapid survey and the like, and is suitable for Sargassum hemiphyllum bloom early warning, population distribution investigation and ecological impact evaluation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular ecology technology, specifically to a primer and probe set, kit, and operating method for specific, highly sensitive, and quantitative monitoring of the biomass of a large marine algae, Sargassum hemifolia, based on environmental DNA (eDNA) technology. It is suitable for marine biological resource surveys and marine environmental monitoring and early warning. Background Technology

[0002] Sargassum is a large algae rich in polysaccharides, polyphenols, and unsaturated fatty acids, widely used in food, medicine, bioenergy, and ecological restoration. Sargassum hemifolia ( Sargassum hemiphyllum Sargassum hemifolia, characterized by its large biomass and rapid growth, is a major component of seaweed farms in southern China. Because tides and ocean currents provide a continuous exchange of nutrients for Sargassum hemifolia, large-scale cultivation of this seaweed can significantly improve the marine environment and reduce inorganic nitrogen and phosphorus levels. However, improper management can lead to overgrowth or even escape of the cultivated algae, forming algal blooms in certain areas, disrupting the original ecological balance, or entanglement of aquaculture facilities and passing vessels, causing significant damage.

[0003] Sargassum in natural marine environments exhibits a clustered distribution characteristic, characterized by not only enormous individual biomass and the mixed growth of multiple species but also a very wide distribution area. Current resource surveys primarily rely on divers setting up transects and quadrats underwater for biomass estimation, which is labor-intensive and lacks precision. Furthermore, multiple species of Sargassum often coexist in the same area, with their phycoles intertwined. Traditional morphological classification in such cases can only employ a "root and branch" approach, causing permanent environmental damage and potentially leading to inaccurate classification due to the loss of crucial components.

[0004] Environmental DNA (eDNA) is a novel biomonitoring method that identifies species presence and assesses biodiversity by analyzing genetic material shed from organisms collected from environmental samples such as water, soil, or air. Its basic operational process includes environmental sample collection, DNA extraction and purification, amplification of specific gene fragments using PCR technology, and then using high-throughput sequencing for macrobarcoding analysis to identify multiple species, or using real-time quantitative PCR technology for sensitive detection of specific target species. Due to its non-invasiveness, high sensitivity, high efficiency, and minimal disturbance to ecosystems, this technology has been widely applied in aquatic biodiversity surveys, endangered species tracking, invasive species monitoring, and aquatic ecological health assessment. However, current research and applications of eDNA technology are mostly concentrated on aquatic animals such as fish, amphibians, and mammals, as well as some microorganisms. For large algae like Sargassum, especially for species-specific detection and quantitative monitoring of their eDNA, relevant patents and technical solutions remain scarce. The release mechanism of large algal eDNA, its degradation rate in water, and the quantitative relationship between eDNA and living biomass all differ significantly from those of animal eDNA, constituting technical challenges. Therefore, developing a time-saving, labor-saving, efficient, and accurate method for quantitative monitoring of single-species Sargassum biomass based on eDNA technology is of great scientific value and application prospects for making up for the shortcomings of traditional monitoring methods and realizing early, rapid, and quantitative early warning of Sargassum fusiforme dynamics. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a highly sensitive, specific, and quantifiable primer and method for monitoring Sargassum hemifolia based on environmental DNA technology. This specific primer utilizes real-time quantitative PCR technology to monitor the distribution of Sargassum hemifolia in different marine areas, providing technical support for Sargassum hemifolia biomass monitoring, resource surveys, and risk management.

[0006] The first objective of this invention is to provide a primer and probe set for quantitative monitoring of Sargassum hemifolia based on environmental DNA technology, the primer and probe set comprising an upstream primer, a downstream primer, and a fluorescent probe.

[0007] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1: 5'-ATCGTCTGGGCTCATCACAT-3'.

[0008] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2: 5'-TAGGGACAGCAATAATCATCGTAG-3'.

[0009] The nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.3: 5'-[FAM]CGCGGTAAAATACGCTCGCGTATCAATATCCA[BHQ1]-3', wherein the 5' end is modified with FAM and the 3' end is modified with BHQ1.

[0010] The primer-probe set targets a Sargassum fusiforme-specific DNA fragment (SEQ ID NO.4) derived from the cytochrome c oxidase coenzyme I encoding gene located in its mitochondrial genome. COX1 The gene combines a relatively conserved region with a highly variable region. The conserved region has sufficient conservation within the Sargassum genus for primer design for detection, while the variable region provides sufficient variability to ensure its specificity among closely related algal genera. The sequence of SEQ ID NO.4 is: ATCGTCTGGGCTCATCACATGTTTACAGTTGGTTTGGATATTGATACGCGAGCGTATTTTACCGCGGCTACGATGATTATTGCTGTCCCTA.

[0011] A second objective of this invention is to provide the application of the aforementioned primer-probe set in the preparation of a kit for quantitative monitoring of Sargassum hemifolia based on environmental DNA technology.

[0012] A third objective of this invention is to provide a kit for quantitatively monitoring the biomass of Sargassum hemifolia, comprising the aforementioned primer and probe set, and 2 × qPCR premix (containing DNA polymerase, dNTPs, and Mg). 2+ Nuclease-free water and known concentrations of Sargassum fusiforme plasmid DNA were used as positive controls.

[0013] The fourth objective of this invention is to provide a method for monitoring Sargassum fusiforme biomass based on environmental DNA technology, using the aforementioned primer and probe set or kit, comprising the following steps:

[0014] (1) Sample collection and eDNA enrichment: 0.5-1 L of water samples were collected from the target water body using a sterile water sampler and transported back to the laboratory under low temperature preservation. The water samples were filtered using a polycarbonate filter membrane with a pore size of 0.22 μm driven by a vacuum pump, so that the eDNA particles and cells in the water were trapped on the filter membrane. The surface sediment (0-5 cm) of each sampling point under natural conditions was collected by a mud hopper. Different sediment samples were collected using sterile bags or sterile centrifuge tubes and sealed and frozen for preservation.

[0015] (2) eDNA extraction and purification: eDNA enriched on the filter membrane was extracted and purified using a commercial polysaccharide and polyphenol plant genomic DNA extraction kit. eDNA in the sediment was extracted and purified using a commercial soil genomic DNA extraction kit. Finally, the eDNA was dissolved in 50-100 μL of elution buffer and stored at -20 ℃ for later use.

[0016] (3) qPCR detection and analysis:

[0017] A. Qualitative detection: Using the extracted eDNA as a template, a negative control (using nuclease-free water instead of template) and a positive control (Sargassum fusiforme plasmid DNA provided in the kit) were set up. qPCR amplification was performed using the primer and probe set described above. If the experimental group showed a typical S-shaped amplification curve, while the negative control showed no amplification (no Cq value), then the sample was determined to contain Sargassum fusiforme eDNA.

[0018] B. Quantitative Detection: First, establish a standard curve. Extract genomic DNA from a single cultured Sargassum fusiforme plant. Using this DNA as a template, perform PCR amplification using the upstream and downstream primers from the primer and probe set described above. Ligate the PCR product with a plasmid vector and amplify the culture. Extract plasmid DNA and accurately quantify it using a fluorescence spectrophotometer. Calculate the plasmid copy number and perform a series of 10-fold serial dilutions of the plasmid to obtain a series of standards with known concentrations. Using each gradient standard as a template, perform qPCR amplification using the primer and probe set described above to obtain the Cq value corresponding to each gradient standard. Calculate the Cq value based on the logarithm of the initial template concentration of the Sargassum fusiforme standard. 10 Using the x-axis as the abscissa and the Cq value as the ordinate, a linear regression was performed to obtain a standard curve (linear equation y = -kx + b, where k is the slope of the amplification efficiency correlation and b is the intercept), and the limit of detection (LoD) and limit of quantification (LoQ) for qPCR were determined. Subsequently, using the eDNA sample to be tested as a template, each sample was repeated 3 times, and qPCR detection was performed using the primer and probe set described above, recording the Cq values; the mean of the Cq values ​​of each sample was calculated, and this mean was substituted into the standard curve equation to calculate the initial copy number or relative content of Sargassum fusiforme eDNA in the sample, thereby retrieving the biomass information of Sargassum fusiforme in the water.

[0019] Preferably, in step B, during the construction of the standard curve, the copy number of the target fragment after a 10-fold serial dilution of the plasmid is 10. 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL.

[0020] Preferably, the PCR reaction system in step B is as follows: 2 μL of Sargassum fusiforme genomic DNA, 25 μL of 2 × plus TaqHiFi PCR mix (with blue dye), 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, and 21 μL of nuclease-free water, for a total of 50 μL; the reaction conditions are: 95 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 25 sec, 60 ℃ annealing for 25 sec, and 72 ℃ extension for 15 sec, for 35 cycles; and 72 ℃ final extension for 5 min.

[0021] Preferably, the qPCR reaction system in step B is as follows: 2 μL plasmid DNA or eDNA to be tested, 10 μL 2 × Pro Taq HSProbe Premix, 0.6 μL 10 μM upstream primer, 0.6 μL 10 μM downstream primer, 0.6 μL 10 μM probe, and 6.2 μL nuclease-free water, for a total of 20 μL; the reaction conditions are: 95 ℃ pre-denaturation for 30 sec; 95 ℃ denaturation for 15 sec, 60 ℃ annealing for 30 sec, for 40 cycles.

[0022] A fifth objective of this invention is to provide the application of the above-described primer-probe sets, kits, or methods in the qualitative detection of Sargassum hemifolia and / or the quantitative monitoring of Sargassum hemifolia biomass.

[0023] Compared with the prior art, the present invention has the following advantages and positive effects:

[0024] (1) High specificity and accuracy: This invention targets Sargassum hemifolia. COX1 The genetically designed primers and probes have undergone rigorous bioinformatics screening and experimental verification, and show no cross-reactivity with common proto-brown algae and other phytoplankton, ensuring species specificity of the test results and avoiding misjudgment.

[0025] (2) High sensitivity and early warning capability: qPCR technology itself has extremely high detection sensitivity. Relying on this technology, this invention can detect as low as 8 copies in a single run, and all operations are performed in closed test tubes, eliminating the need for subsequent PCR operations such as gel electrophoresis, greatly reducing the risk of cross-contamination. The advantage of high sensitivity enables this method to detect the presence or proliferation of Sargassum hemifolia earlier than satellite remote sensing and naked-eye observation, gaining valuable time for early warning of algal blooms.

[0026] (3) Quantification and traceability: By establishing a standard curve, this method can be upgraded from qualitative detection to precise quantitative analysis. The obtained eDNA concentration data can be combined with hydrological, meteorological and carbon sink data to establish a dynamic model of Sargassum biomass and scientifically assess its ecological impact.

[0027] (4) High efficiency, convenience and eco-friendliness: The sampling process only requires the collection of a small amount of water sample, without the need for manual diving or damage to algae, which is convenient, quick and has no impact on the ecosystem. The experimental procedure is standardized, and hundreds of samples can be processed at the same time in one qPCR run, which greatly improves the monitoring efficiency and reduces manpower and time costs.

[0028] (5) Wide range of applications: The technical solution of this invention is not only applicable to the monitoring of Sargassum bloom in open sea areas, but also to routine monitoring in nearshore ports, aquaculture areas and other waters, providing strong technical support for marine management, disaster prevention and control and scientific research. Attached Figure Description

[0029] Figure 1 This is an electrophoresis diagram validating the specificity of the cDNA detection of Sargassum hemifolia. In the diagram, M represents the molecular weight standard DL2000, Lanes 1-4 are Sargassum hemifolia, Lane 5 is Sargassum var. vannamei, Lane 6 is Sargassum henryi, Lane 7 is Isochrysis glomeratus, and Lane 8 is Chaetoceros muelleri.

[0030] Figure 2 The peak diagram of qPCR amplification was used to verify the specificity of Sargassum fusiforme eDNA detection.

[0031] Figure 3 This is a standard curve for the quantitative detection of Sargassum fusiforme biomass, constructed using genomic DNA from a single Sargassum fusiforme plant grown in a natural marine area as a template. The equation of the standard curve in this figure is: y = -3.43817x + 43.82703; R 2 =0.99758, slope -3.43817, intercept 43.82703, amplification efficiency of 0.95368; qualitative detection limit (LoD) of 8.69108812 copies / μL (2.65 × 10⁻⁶). -5The limit of detection (LoQ) was 12.5 copies / μL (3.81 × 10⁻⁶ pg / μL). -5 pg / μL). Detailed Implementation

[0032] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments, and the techniques used are generally conventional methods well known to those skilled in the art.

[0033] The manufacturers of the instruments, reagents, and materials used in the examples are as follows: PCR instrument (Bio-Rad, USA), real-time fluorescence PCR instrument (TaKaRa, Japan), NanoDrop 2000 fluorescence spectrophotometer (Thermo), gel imaging system (Bio-Rad, USA), polysaccharide and polyphenol plant genomic DNA extraction kit (Tiangen, China), universal DNA purification and recovery kit (Tiangen, China), pMD TM 19-T VeCqor Cloning Kit (TaKaRa, Japan), DH5α competent cells (Tiangen, China), endotoxin-free plasmid small-volume preparation kit (Tiangen, China), AP-9950 vacuum pump (Automatic Science, China), filter membrane (0.22 μm) were purchased from Sangon Biotech (Shanghai) Co., Ltd., 2 × plus Taq HiFi PCR mix (with blue dye) were purchased from Shenzhen Maikes Biotechnology Co., Ltd., and 2 × ProTaq HS Probe Premix were purchased from Hunan Aikerui Biotechnology Co., Ltd.

[0034] Example 1: Primer and probe set design and specificity verification for quantitative monitoring of Sargassum hemifolia based on eDNA technology

[0035] Download Sargassum hemifolia and its closely related species from GenBank. COX1 The gene sequence was sequenced and subjected to multiple alignments. It was found that the gene combines relatively conserved and highly variable regions. The conserved regions showed sufficient conservation within the Sargassum genus, making them suitable for primer design for detection; the variable regions provided sufficient variability to ensure specificity among closely related algal genera, making them suitable for species-specific primer design. Primer Premier 5.0 and other software were used to further refine the sequence. COX1Candidate primers were designed within the differentially expressed regions of the gene. To effectively address the decreased amplification efficiency or even failure of long fragments due to sample degradation, while ensuring higher specificity of the amplified products and maintaining a more stable signal detection basis, a combination of short-fragment target design and short primers with long probes was adopted in primer design. The design parameters were: upstream and downstream primer length 18-25 bp, probe primer length 25-35 bp, GC content 40%-60%, annealing temperature 55-65 ℃, and amplicon length 80-200 bp. Specificity was then validated using Primer-BLAST to ensure that the designed primers perfectly matched only the target sequence of *Sargassum fusiforme*, and showed no significant similarity to other biological sequences in the database. After screening, the specific primer-probe set for *Sargassum fusiforme* eDNA detection was finally determined as follows:

[0036] Upstream primer SEQ ID NO.1: 5'-ATCGTCTGGGCTCATCACAT-3';

[0037] Downstream primer SEQ ID NO.2: 5'-TAGGGACAGCAATAATCATCGTAG-3';

[0038] Fluorescent probe primer SEQ ID NO.3: 5'-[FAM]CGCGGTAAAATACGCTCGCGTATCAATATCCA[BHQ1]-3';

[0039] To further verify the effectiveness and specificity of the primer and probe set, pure cultured Sargassum hemifolia and its related Sargassum var. ... Sargassum vachellianum ) and Sargassum henleyi ( Sargassum henslowianum ), and other common planktonic microalgae in the sea area, such as *Isophyta glomeratus* ( ), Isochrysis galbana ) and Chaetoceros muelleri ( Chaetoceros muelleri Using genomic DNA as a template, conventional PCR and qPCR amplification were performed using this primer and probe set. The results showed that only the Sargassum hemifolia DNA template exhibited specific amplification bands and significant fluorescence signal growth; DNA templates from other species yielded negative results. Figure 1 and Figure 2 Furthermore, first-generation sequencing of the positive PCR products showed that the positive sequence had 100% similarity to the target species, confirming that the primer set had high specificity for Sargassum hemifolia.

[0040] Example 2: Preparation of Sargassum hemifolia plasmid standards, construction of standard curves, and validation of sensitivity and quantitative linearity of eDNA detection method.

[0041] Tissue samples of single Sargassum hemifolia plants growing in natural marine areas were collected. After removing impurities from the algal surface, genomic DNA was extracted from Sargassum hemifolia according to the instructions of the polysaccharide-polyphenol plant genomic DNA extraction kit. Second, using the Sargassum hemifolia genomic DNA as a template, PCR amplification was performed using upstream and downstream primers. The PCR reaction system was as follows: 2 μL Sargassum hemifolia genomic DNA, 25 μL 2 × plus Taq HiFi PCR mix (with blue dye), 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, and 21 μL nuclease-free water, totaling 50 μL. The reaction conditions were: 95 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 25 sec, 60 ℃ annealing for 25 sec, and 72 ℃ extension for 15 sec, for 35 cycles; and a final extension at 72 ℃ for 5 min. Agarose gel electrophoresis was then performed to obtain a single target fragment. Third, the target fragment from Sargassum hemifolia was recovered according to the instructions of the universal DNA purification and recovery kit. Fourth, following the instructions of the pMD™ 19-T Vector Cloning Kit, the target fragment was ligated to the vector. Then, following the instructions for DH5α competent cells, the plasmid was transduced into DH5α competent cells for expansion culture. Fifth, plasmid extraction was performed according to the instructions of the endotoxin-free plasmid mini-prep kit. The concentration of the extracted plasmid was measured to be 66.9 ng / μL using a NanoDrop 2000 fluorescence spectrophotometer. Sixth, the copy number of the plasmid was calculated to be 2.19 × 10⁻⁶. 10 copies / μL; the plasmid was serially diluted 10-fold to the following copy numbers: 2.19 × 10⁻⁶ copies / μL. 9 copies / μL, 2.19 × 10 8 copies / μL, 2.19 × 10 7 copies / μL, 2.19 × 10 6 copies / μL, 2.19 × 10 5 copies / μL, 2.19 × 10 4 copies / μL, 2.19 × 10 3 copies / μL, 2.19 × 10 2 copies / μL, 2.19 × 10 1Seventh, using the diluted plasmid as the template for qPCR, three replicates were set for each gradient. The primer set provided in this invention was used for qPCR experiments. The reaction system was: 2 μL plasmid DNA, 10 μL 2× Pro Taq HS Probe Premix, 0.6 μL 10 μM upstream primer, 0.6 μL 10 μM downstream primer, 0.6 μL 10 μM fluorescent probe primer, and 6.2 μL nuclease-free water, totaling 20 μL. The reaction conditions were: 95 ℃ pre-denaturation for 30 sec; 95 ℃ denaturation for 15 sec, 60 ℃ annealing for 30 sec, for 40 cycles. After the qPCR reaction, the experimental data were processed. A standard curve was obtained by fitting the logarithm of the initial template concentration (Log10) as the x-axis and the Cq value as the y-axis, and the lower limit of detection (LoD) and lower limit of detection (LoQ) for qualitative and quantitative qPCR were determined. The results show that the equation of the curve is: y = -3.43817x + 43.82703; R 2 =0.99758, slope -3.43817, intercept 43.82703, amplification efficiency of 0.95368; the limit of detection (LoD) is 8.69108812 copies / μL, the limit of quantitative detection (LoQ) is 12.5 copies / μL, and the limit of qualitative detection (LoD) calculated by regression analysis of plasmid concentration in the standard curve is 2.65 × 10⁻⁶. -5 pg / μL, the limit of detection (LoQ) is 3.81 × 10 pg / μL. -5 pg / μL. See details. Figure 3 As shown.

[0042] The standard curve constructed using a single Sargassum fusiforme obtained from a natural sea area as a template showed an amplification efficiency of approximately 100% corresponding to its slope, indicating that the qPCR reaction was efficient and suitable for precise quantification; both the qualitative detection limit (LoD) and the quantitative detection limit (LoQ) reached 10. -5 The pg / μL concentration indicates that the method has high sensitivity; perfect S-shaped curve amplification was obtained in the qPCR amplification of all plasmids, and the positive detection rate reached 100%, indicating that the primer set and supporting method provided by this invention have good reproducibility.

[0043] Example 3: Resistance to Environmental Interference and Inhibitor Tolerance Test

[0044] To verify the tolerance of the primer-probe set and method provided by this invention to exogenous environmental interference, a concentration of 2.19 × 10⁻⁶ was obtained in Example 2. 3The plasmid was a copy / μL sample. Equal volumes of humic acid stock solution at different concentrations were added to the plasmid to achieve humic acid concentrations of 0.1 mg / mL, 1 mg / mL, 5 mg / mL, and 10 mg / mL, respectively. An equal volume of nuclease-free water was used as a negative control. Each concentration was replicated in triplicate. Equal volumes of CaCl2 solution at different concentrations were also added to the plasmid to achieve CaCl2 concentrations of 1 mmol / L, 10 mmol / L, 20 mmol / L, and 50 mmol / L, respectively. An equal volume of nuclease-free water was used as a negative control. Each concentration was replicated in triplicate.

[0045] Since Sargassum itself contains high concentrations of polysaccharides, polyphenols, and pigments, to verify the tolerance of the primer-probe set and method provided in this invention to these endogenous inhibitors, 1 g of Sargassum hemifolia was selected as the research object. Nucleic acid was extracted using a polysaccharide-polyphenol plant genomic DNA extraction kit (removing polysaccharides, polyphenols, and pigments from the sample) and a general plant genomic DNA extraction kit (without any treatment of polysaccharides, polyphenols, and pigments in the sample), with three replicates for each method. After extraction, the extracted eDNA was dissolved in 100 μL of nuclease-free water, and the sample was then stored at -20℃ for subsequent use.

[0046] Using the primer and probe set and usage method provided in this invention, qPCR amplification was performed using the humic acid digested samples, control group samples, polysaccharide and polyphenol treated group samples, and untreated group samples as templates. Each sample and plasmid standard was subjected to three replicate qPCR amplifications, using 2 μL of template per reaction. The Cq values ​​generated from the three technical replicates of each sample and plasmid standard were averaged to obtain the Cq value for each sample and plasmid standard. Simultaneously, the effect of the inhibitor on qPCR was evaluated according to the following formula: Inhibition rate (%) = (1 - experimental group copy number / negative control group average copy number) × 100%; the specific results are shown in Table 1.

[0047] Existing studies have shown that when the inhibition rate exceeds 50%, the detection is generally considered to be significantly inhibited, and the results are unreliable. If the inhibition rate is ≤20%, the method is considered to have good tolerance at this inhibitor concentration. In this embodiment, the inhibition rate gradually increases with the increase of humic acid and CaCl2 concentrations in the sample, but when the concentrations of humic acid and CaCl2 in the sample reach 10 mg / mL and 50 mmol / L, respectively, the inhibition rate is below 20%. The inhibition rate of polysaccharides, polyphenols, and pigments on the detection method is 16.96%, which is also below 20%. That is, the primer-probe set and detection method provided by this invention have good tolerance at common inhibitor concentrations in the marine environment, and have the characteristics of strong resistance to exogenous environmental interference and good tolerance to endogenous inhibitors such as polysaccharides, polyphenols, and pigments.

[0048] Table 1 Results of resistance to environmental interference and inhibitor tolerance tests

[0049] .

[0050] Example 4: eDNA Degradation and Time and Temperature Stability Test

[0051] To quantify the degradation kinetics of Sargassum hemifolia eDNA under different temperature conditions and to clarify the effects of temperature and time on eDNA stability, artificially cultured Sargassum hemifolia algae were used as experimental material. 30 g of algae were evenly added to three glass tanks containing 10 L of filtered artificial seawater (salinity 30‰) each, with 10 g of algae in each tank. The tanks were incubated at room temperature for 48 hours to allow the eDNA to fully release into the water. The algae were then removed, and the water samples from the three parallel samples were thoroughly mixed and aliquoted into three 5 L Erlenmeyer flasks, with 4 L of water sample in each flask. The flasks were then placed in a constant-temperature incubation system. To simulate the natural growth temperatures of Sargassum hemifolia in the South China coastal area—normal temperatures in winter and spring and high temperatures in summer—two experimental temperatures of 18 ℃ and 28 ℃ were set, with three parallel samples for each temperature gradient. Water samples of 200 mL were collected at 0 h, 1 h, 3 h, 6 h, 12 h, 24 h, 48 h, 72 h, 96 h, 120 h, and 144 h. After enriching eDNA through a 0.22 μm filter membrane, eDNA was extracted from the water according to the instructions of the polysaccharide-polyphenol plant genomic DNA extraction kit. After extraction, the extracted eDNA was dissolved in 100 μL of nuclease-free water, and the samples were then stored at -20 ℃ for subsequent use.

[0052] Using the primer and probe set and method provided in this invention, eDNA treated at different times and temperatures, and four standard plasmids with different copy numbers (plasmid copy number concentration: 2.19 × 10⁻⁶) were tested. 6 copies / μL, 2.19 × 10 5 copies / μL, 2.19 × 10 4 copies / μL and 2.19 × 10 3qPCR amplification was performed using copies / μL as template. Each sample and plasmid standard was subjected to three replicates of qPCR amplification, using 2 μL of template per reaction. The Cq values ​​from the three technical replicates of each sample and plasmid standard were averaged to obtain the Cq value for each sample and plasmid standard. The Cq values ​​of the four plasmid standards with different copy concentrations were compared with the corresponding copy concentration Cq values ​​of the plasmid in the standard curve constructed in Example 2. If the difference between the two values ​​was ≤1, the qPCR amplification results could be further analyzed. The Cq value of each sample was substituted into the standard curve (y=-3.43817x+43.82703) to calculate the corresponding x value; then the x value was substituted into 10... x In this study, the copy number of the target fragment (i.e., the relative amount of the initial template) for each qPCR reaction was obtained; the specific results are shown in Table 2. These results show that although the concentration of Sargassum fusiforme eDNA in the water decreases over time, and the degradation rate is significantly affected by temperature (higher temperatures result in faster degradation), the primer-probe set and method provided by this invention can still stably detect low concentrations and fragmented Sargassum fusiforme.

[0053] Table 2 Results of eDNA degradation and time / temperature stability tests

[0054] .

[0055] Example 5: Biomass assessment of Sargassum hemifolia in the Wanshan sea area of ​​Guangdong

[0056] On December 3, 2025, surface seawater samples were collected from seven locations in the Wanshan sea area using a water sampler and stored in 500 mL sterile disposable plastic bottles. Each location was sampled three times. Sediment from the surface layer (0–5 cm) under natural conditions was also collected from each sampling location using a mud trap and stored in 50 mL sterile centrifuge tubes. Each location was sampled three times. All collected samples were immediately placed on dry ice for preservation and quickly transported back to the laboratory for further processing. The collected seawater was filtered using a filtration device and a vacuum pump. The filter membrane had a pore size of 0.22 μm. After filtration, the filter membrane was picked up from the edge using sterile tweezers and sprayed with 95% alcohol. It was then stored in sterile centrifuge tubes and subsequently frozen.

[0057] The frozen filter membrane was removed using sterile forceps and cut into small pieces using sterile scissors. The membrane, along with the shredded filter, was then used to extract cDNA from the surface seawater of the Wanshan sea area in Guangdong Province using a polysaccharide-polyphenol plant genomic DNA extraction kit. The procedure was strictly followed according to the kit instructions. After extraction, the extracted cDNA was dissolved in 100 μL of nuclease-free water, and the sample was stored at -20 ℃ for subsequent use. DNA extraction from sediment samples was performed using a commercially available soil genomic DNA extraction kit. 500 mg of sediment was used for each sample. After extraction, the extracted cDNA was dissolved in 100 μL of nuclease-free water, and the sample was stored at -20 ℃ for subsequent use.

[0058] Using the primer set and method provided in this invention, eDNA samples from surface seawater and sediments in the Wanshan sea area and four standard plasmids with different copy numbers (plasmid copy number concentration: 2.19 × 10⁻⁶) were analyzed. 6 copies / μL, 2.19 × 10 5 copies / μL, 2.19 × 10 4 copies / μL and 2.19 × 10 3 qPCR amplification was performed using copies / μL as template. Each sample and plasmid standard was subjected to three replicates of qPCR amplification, using 2 μL of template per reaction. The Cq values ​​from the three technical replicates of each sample and plasmid standard were averaged to obtain the Cq value for each sample and plasmid standard. The Cq values ​​of the four plasmid standards with different copy concentrations were compared with the corresponding copy concentration Cq values ​​of the plasmid in the standard curve constructed in Example 2. If the difference between the two values ​​was ≤1, the qPCR amplification results could be further analyzed. The Cq value of each sample was substituted into the standard curve (y=-3.43817x+43.82703) to calculate the corresponding x value; then the x value was substituted into 10... xIn this study, the copy number of the *Sargassum hemifolia* target fragment was obtained for each qPCR reaction. Since 2 μL of the total eDNA extracted from 500 mL of water sample was used in the qPCR reaction (100 μL), the copy number of the *Sargassum hemifolia* target fragment in each qPCR reaction needed to be multiplied by 50 (100 / 2) and then by 2 (1 L / 500 mL) to obtain the copy number of the *Sargassum hemifolia* target fragment in 1 L of surface seawater collected from the Wanshan sea area of ​​Guangdong. For sediment samples, since 2 μL of the total eDNA extracted from 250 mg of sediment was used in the qPCR reaction (100 μL), the copy number of the *Sargassum hemifolia* target fragment in each qPCR reaction needed to be multiplied by 50 (100 / 2) and then by 2 (1 g / 500 mg) to obtain the copy number of the *Sargassum hemifolia* target fragment in 1 g of surface sediment collected from the Wanshan sea area of ​​Guangdong, as shown in Table 3. The results show that although seawater and sediments contain a large number of exogenous environmental interference factors such as calcium ions and humic acid, the primer and probe set and method provided by this invention can still be stably used for the accurate calculation of Sargassum fusiforme biomass in different stations and environmental samples in the Wanshan sea area of ​​Guangdong. It has the characteristics of strong environmental adaptability, good resistance to environmental interference and high repeatability.

[0059] Table 3. Biomass assessment of Sargassum hemifolia in the Wanshan sea area of ​​Guangdong

[0060] .

[0061] Example 6: Biomass assessment of Sargassum hemifolia in the waters off Weizhou Island, Guangxi

[0062] On April 15, 2024, surface seawater samples were collected from four locations in the waters off Weizhou Island, Guangxi Province, using a water sampler. The samples were stored in 1 L sterile disposable plastic bottles, with each location sampled three times. The collected seawater was then filtered using a 0.22 μm filtration membrane. After filtration, the membrane was carefully lifted from the edge with sterile forceps and sprayed with 95% alcohol, then placed in a sterile centrifuge tube and frozen. The frozen membrane was then removed with sterile forceps, cut into small pieces with sterile scissors, and used along with the membrane to extract eDNA from the surface seawater of Weizhou Island, Guangxi Province, using a polysaccharide-polyphenol plant genomic DNA extraction kit. The procedure was strictly performed according to the kit instructions. After extraction, the extracted eDNA was dissolved in 100 μL of nuclease-free water, and the sample was stored at -20 ℃ for later use.

[0063] Using the primer and probe set and method provided in this invention, eDNA samples from surface seawater in the waters off Weizhou Island, Guangxi, and four standard plasmids with different copy numbers (plasmid copy number concentration: 2.19 × 10⁻⁶) were analyzed. 6 copies / μL, 2.19 × 105 copies / μL, 2.19 × 10 4 copies / μL and 2.19 × 10 3 qPCR amplification was performed using copies / μL) as templates. Each sample and plasmid standard was amplified three times in qPCR. The Cq values ​​from the three technical replicates of each sample and plasmid standard were averaged to obtain the Cq value for each sample and plasmid standard. The Cq values ​​of the four plasmid standards with different copy concentrations were compared with the corresponding copy concentration Cq values ​​in the standard curve constructed in Example 2. If the difference between the two values ​​was ≤1, the qPCR amplification results could be further analyzed. The Cq value of each sample was substituted into the standard curve (y=-3.43817x+43.82703) to calculate the corresponding x value; then the x value was substituted into 10... x In this study, the copy number of the *Sargassum hemifolia* target fragment was obtained for each qPCR reaction. Since 2 μL of the total eDNA extracted from 1 L of water sample was used in the qPCR reaction (100 μL), the copy number of the *Sargassum hemifolia* target fragment from each qPCR reaction needed to be multiplied by 50 (100 / 2) to obtain the copy number of the *Sargassum hemifolia* target fragment in 1 L of surface seawater collected from the Weizhou Island sea area in Guangxi. The specific details are shown in Table 4. These results demonstrate that the primer-probe set and method provided by this invention can be used for the accurate calculation and comparison of *Sargassum hemifolia* biomass in surface seawater at different stations in the Weizhou Island sea area of ​​Guangxi.

[0064] Table 4. Copy number of Sargassum order fragments in surface water samples from Weizhou Island, Guangxi

[0065] .

[0066] Example 7: Biomass assessment in 7 Sargassum fusiforme culture ponds

[0067] In September 2025, surface seawater was collected from seven Sargassum fusiforme culture ponds using a water sampler and stored in 1 L sterile disposable plastic bottles. Each sampling point was sampled three times. The collected seawater was filtered using a filtration device and a vacuum pump. The filter membrane had a pore size of 0.22 μm. After the seawater was filtered, the filter membrane was picked up from the edge with sterile tweezers and sprayed with 95% alcohol. It was then stored in a sterile centrifuge tube and subsequently frozen for preservation.

[0068] Remove the frozen filter membrane with sterile forceps, cut it into small pieces with sterile scissors, and use the membrane along with the filter membrane to extract eDNA from the surface seawater of the Sargassum fusiforme culture pond using a polysaccharide and polyphenol plant genomic DNA extraction kit. The operation steps were strictly performed according to the kit instructions. After extraction, the extracted eDNA was dissolved in 100 μL of nuclease-free water, and then the sample was stored at -20 ℃ for subsequent use.

[0069] Using the primer and probe set and method provided in this invention, eDNA samples from surface seawater in a Sargassum fusiforme culture pond and four standard plasmids with different copy numbers (plasmid copy number concentration: 2.19 × 10⁻⁶) were analyzed. 6 copies / μL, 2.19 × 10 5 copies / μL, 2.19 × 10 4 copies / μL and 2.19 × 10 3 qPCR amplification was performed using copies / μL) as templates. Each sample and plasmid standard was amplified three times in qPCR. The Cq values ​​from the three technical replicates of each sample and plasmid standard were averaged to obtain the Cq value for each sample and plasmid standard. The Cq values ​​of the four plasmid standards with different copy concentrations were compared with the corresponding copy concentration Cq values ​​in the standard curve constructed in Example 2. If the difference between the two values ​​was ≤1, the qPCR amplification results could be further analyzed. The Cq value of each sample was substituted into the standard curve (y=-3.43817x+43.82703) to calculate the corresponding x value; then the x value was substituted into 10... x In this study, the copy number of the *Sargassum hemifolia* target fragment was obtained for each qPCR reaction. Since 1 μL of the total eDNA extracted from 1 L of water sample was used in the qPCR reaction, the copy number of the *Sargassum hemifolia* target fragment in each qPCR reaction needed to be multiplied by 100 (100 / 1) to obtain the copy number of the *Sargassum hemifolia* target fragment in 1 L of surface seawater collected from the seven *Sargassum hemifolia* culture ponds. The details are shown in Table 5. These results demonstrate that the primer set and method provided by this invention can be used for the quantitative calculation of *Sargassum hemifolia* biomass in artificial culture ponds.

[0070] Table 5. Copy number of the target fragment of Sargassum hemifolia in the surface water of seven Sargassum hemifolia culture ponds

[0071] .

[0072] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of reagents for detecting target fragments in the preparation of kits for quantitative monitoring of Sargassum hemifolia based on environmental DNA technology, characterized in that, The nucleotide sequence of the target fragment is shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The reagent is a primer-probe set.

3. The application according to claim 2, characterized in that, The primer-probe set includes an upstream primer, a downstream primer, and a fluorescent probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.

3.

4. The application according to claim 1, characterized in that, The kit also includes qPCR premix, nuclease-free water, and a positive control of Sargassum fusiforme plasmid.

5. A method for quantitative detection of Sargassum hemifolia biomass based on environmental DNA, characterized in that, Includes the following steps: (1) Sample collection and eDNA enrichment: Collect water bodies in different aquatic environments, filter them using a vacuum filtration pump and polycarbonate filter membrane, and enrich environmental DNA on the filter membrane; or collect different sediment samples, seal and freeze them. (2) eDNA extraction and purification: Use a commercial polysaccharide and polyphenol plant genomic DNA extraction kit to extract environmental DNA enriched on the filter membrane, or use a commercially available soil genomic DNA extraction kit to extract eDNA from sediments to obtain template DNA solution. (3) qPCR detection and analysis: Real-time quantitative PCR reaction was performed using the template DNA solution obtained in step (2). The reaction system contained the upstream primer with the sequence shown in SEQ ID NO.1, the downstream primer with the sequence shown in SEQ ID NO.2, and the fluorescent probe with the sequence shown in SEQ ID NO.

3. The Cq value of the experimental group was compared with the Cq value of the negative control group to make a qualitative judgment; or the Cq value was substituted into the pre-established standard curve to calculate the absolute copy number or relative content of Sargassum eDNA in the sample.

6. The method according to claim 5, characterized in that, The standard curve described in step (3) is established in the following way: a. Genomic DNA was extracted from a single cultured Sargassum fusiforme plant. Using this DNA as a template, PCR amplification was performed using the upstream primer with the sequence shown in SEQ ID NO.1 and the downstream primer with the sequence shown in SEQ ID NO.

2. b. Ligate the PCR product with the plasmid vector and amplify the culture; extract the plasmid DNA and accurately quantify it using a fluorescence spectrophotometer; c. Calculate the plasmid copy number and perform a series of 10-fold serial dilutions of the plasmid to obtain a series of standards with known concentrations; d. Using the standards of each gradient as templates, qPCR amplification was performed using the upstream primer with the sequence shown in SEQ ID NO.1, the downstream primer with the sequence shown in SEQ ID NO.2, and the fluorescent probe with the sequence shown in SEQ ID NO.3 to obtain the Cq values ​​corresponding to each standard gradient. e. Using the logarithm of the initial template concentration of Sargassum fusiforme standard as the x-axis and the Cq value as the y-axis, linear regression was performed. After fitting, a standard curve was established to obtain the linear equation and goodness of fit, and the lower limits of qualitative and quantitative detection of qPCR were determined.

7. The method according to claim 6, characterized in that, The PCR reaction system in step a was as follows: 2 μL of Sargassum fusiforme genomic DNA, 25 μL of 2 × plus Taq HiFi PCR mix with blue dye, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, and 21 μL of nuclease-free water, for a total of 50 μL. The reaction conditions were as follows: 95 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 25 sec, 60 ℃ annealing for 25 sec, and 72 ℃ extension for 15 sec, for 35 cycles; and 72 ℃ final extension for 5 min.

8. The method according to claim 6, characterized in that, In step c, the copy number of the target fragment after serial dilution of the plasmid is 10. 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL.

9. The method according to claim 6, characterized in that, The qPCR reaction system in step d was as follows: 2 μL plasmid DNA, 10 μL 2 × Pro Taq HS Probe Premix, 0.6 μL 10 μM upstream primer, 0.6 μL 10 μM downstream primer, 0.6 μL 10 μM probe, and 6.2 μL nuclease-free water, for a total of 20 μL. The reaction conditions were: 95 ℃ pre-denaturation for 30 sec; 95 ℃ denaturation for 15 sec, 60 ℃ annealing for 30 sec, for 40 cycles.

10. The application of the method of claim 5 in the qualitative detection of Sargassum hemifolia and / or the quantitative monitoring of Sargassum hemifolia biomass.