Streptomyces noursei yc3078 and its application in producing gougerotin

Abstract

The application discloses a Streptomyces noursei YC3078 and application thereof in production of gougerotin, and belongs to the technical field of biotechnology.The application provides the Streptomyces noursei YC3078 with a preservation number of GDMCC No:67402, and the strain is obtained by overexpressing a CMP gene in Streptomyces microflavus, and the nucleotide sequence of the CMP gene is shown as SEQ ID NO:1.It is found through experiments that the strain not only significantly improves the content of gougerotin in a fermentation product, but also improves the utilization efficiency of ammonia nitrogen and glucose in a fermentation liquor, and the inhibition ability of the gougerotin produced by fermentation of the strain on rhodotorula is significantly better than that of a wild type strain.The application provides an efficient strain resource for large-scale production of gougerotin, and also provides a scientific basis and technical support for research and development of agricultural antibiotics and plant disease prevention.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a strain of Streptomyces Norrers YC3078 and its application in the production of oryzanol. Background Technology

[0002] Gougerotin, first isolated from *Streptomyces oryzae*, is a water-soluble, basic nucleoside peptide antibiotic with strong inhibitory effects against both Gram-positive and Gram-negative bacteria. It also possesses antitumor, antifungal, and antiviral activities. The mechanism of action of gougerotin is to inhibit the function of peptidyl transferases in ribosomes, thereby hindering polypeptide chain elongation and inhibiting protein synthesis. Studies have shown that the main active components of many agricultural antibiotics are gougerotin or its analogues. Gougerotin exhibits broad-spectrum antibacterial, antitumor, antiviral, and antifungal activities. Gougerotin demonstrates significant value in the field of agricultural plant protection and has great potential for development as an agricultural antibiotic, with substantial biocontrol potential and market application prospects.

[0003] Currently, the production of oryzanol mainly relies on fermentation with wild-type strains, which suffers from low yields (typically below 1 g / L) and long fermentation cycles. Furthermore, traditional fermentation processes lack efficient gene regulation techniques, making it difficult to significantly increase yields. Although some studies have attempted to improve yields by optimizing culture media or fermentation conditions, the effects have been limited, and no overexpression strategies for key genes have been addressed. Therefore, the large-scale production of oryzanol is limited by the yield capacity of existing strains, making the targeted selection of high-yielding strains a crucial step in achieving large-scale oryzanol production. Summary of the Invention

[0004] The purpose of this invention is to provide a Streptomyces northerly YC3078 strain and its application in the production of oryzanol, thereby solving the problems existing in the prior art. This invention utilizes a mutant strain of Streptomyces northerly YC3078 constructed by overexpressing the CMP gene in Streptomyces CK-15, which can significantly increase the oryzanol content in fermentation products.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a strain of Streptomyces noursei YC3078, which has the accession number GDMCC No:67402.

[0007] The present invention provides a method for constructing the above-mentioned Streptomyces cerevisiae YC3078, including the step of overexpressing the CMP gene in Streptomyces albulus CK-15, wherein the nucleotide sequence of the CMP gene is shown in SEQ ID NO.1; the accession number of Streptomyces albulus CK-15 is CGMCC No.31251.

[0008] This invention provides the use of the aforementioned Streptomyces Norilskii YC3078 in any of the following:

[0009] (1) Production of oryzanol;

[0010] (2) Increase the production of oryzanol.

[0011] The present invention provides a method for producing oryzanol, comprising the steps of fermenting and culturing the above-mentioned Streptomyces Norilskia YC3078, and separating and extracting oryzanol from the obtained Streptomyces Norilskia YC3078 fermentation broth.

[0012] Preferably, the culture medium used for the fermentation culture comprises the following components at the following concentrations:

[0013] Corn flour 30g / L, soybean meal 20g / L, glucose 20g / L, ammonium sulfate 4g / L and calcium carbonate 3g / L.

[0014] Preferably, the fermentation culture temperature is 25-30℃, the rotation speed is 200-300 rpm, and the culture time is 70-80 h.

[0015] This invention provides the use of the aforementioned Streptomyces Norilskii YC3078 in any of the following:

[0016] (1) Inhibits yeast;

[0017] (2) Preparation of yeast antibacterial agent.

[0018] Preferably, the yeast includes red yeast.

[0019] The present invention provides a yeast antibacterial agent, wherein the yeast antibacterial agent includes the above-mentioned Streptomyces northerneri YC3078.

[0020] This invention provides the use of the aforementioned Streptomyces Norilskii YC3078 in any of the following:

[0021] (1) Improve the efficiency of ammonia nitrogen metabolism and conversion;

[0022] (2) Preparation of biological agents to improve the efficiency of ammonia nitrogen metabolism and conversion;

[0023] (3) Increase the rate of glucose consumption;

[0024] (4) Preparation of biological agents to increase glucose consumption rate

[0025] As a preferred embodiment, the present invention also provides a method for increasing the yield of oryzanol, comprising the steps of fermenting the aforementioned Streptomyces Norilskia YC3078 and separating and extracting oryzanol from the fermentation broth.

[0026] As a preferred embodiment, the fermentation medium consists of 30g corn flour, 20g soybean meal, 20g glucose, 4g ammonium sulfate, 3g calcium carbonate, and 1L distilled water; the fermentation conditions are a culture temperature of 25-30℃, a rotation speed of 200-300rpm, and a culture time of 70-80h.

[0027] The present invention discloses the following technical effects:

[0028] This invention uses *Streptomyces leucocephala* CK-15 as the original starting strain and overexpresses the CMP gene to obtain a CMP-overexpressing strain—*Streptomyces northerneri* YC3078, with the accession number GDMCC No:67402. This invention, by overexpressing the CMP gene, can enhance the flow rate of metabolites in the nucleotide salvage synthesis pathway and primary metabolic pathway in the starting strain, ensuring the supply of materials and energy for secondary metabolism; it also maintains intracellular CDP homeostasis, optimizes nucleic acid metabolic balance to support the expression of genes related to oryzanol synthesis; simultaneously, it regulates the cascade effect of primary and secondary metabolism, positively activating key enzyme systems and pathways for oryzanol synthesis, thereby promoting its synthesis. Experiments have confirmed that, compared with wild-type *Streptomyces leucocephala* CK-15, *Streptomyces northerneri* YC3078 can significantly accelerate the sporulation rate, increase mycelial production, and promote strain growth; it can also increase the oryzanol content in fermentation products; and accelerate the strain's utilization efficiency of ammonia nitrogen and glucose during fermentation. This invention also found that the ability of *Streptomyces northerneri* YC3078 to inhibit *Rhodotorula rubrum* is significantly higher than that of wild-type strains, indicating that *Streptomyces northerneri* YC3078 can significantly increase the production of *Oryzanol* in fermentation products. In summary, this invention, by constructing a mutant strain through overexpression of the CMP gene in *Streptomyces leucocephala* CK-15, can be used to produce *Oryzanol*, providing a new strain resource and method for large-scale production of bacterial-derived *Oryzanol*, and offering new agricultural antibiotic resources and strategies for the control of various plant diseases. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 Diagram showing the amplification of the target fragment of the CMP gene; M: DL2000 marker; 1-3: CMP amplification products;

[0031] Figure 2 Image showing double enzyme digestion of pSETC plasmid; M: Super DNA marker; 1: pSETC plasmid; 2-6: linearized vector;

[0032] Figure 3 Validation image of Streptomyces northerneri YC3078; M: DL5000 marker; 1-2: Streptomyces northerneri YC3078; 3: Wild-type Streptomyces CK-15;

[0033] Figure 4 The growth phenotype of Streptomyces Norilsk YC3078;

[0034] Figure 5 Curves showing the changes in mycelial dry weight of wild-type Streptomyces CK-15 and Streptomyces Knowles YC3078 at different time points;

[0035] Figure 6 The results show the determination of the content of oryzanol in the fermentation products of wild-type Streptomyces CK-15 and Streptomyces Norilsk YC3078; where A: wild-type Streptomyces CK-15, B: Streptomyces Norilsk YC3078.

[0036] Figure 7 The results show the antibacterial activity of wild-type Streptomyces CK-15 and Streptomyces YC3078 against Rhodotorula rubrum.

[0037] Figure 8 The results of glucose content determination in fermentation products of wild-type Streptomyces CK-15 and Streptomyces Knowles YC3078 at different time points;

[0038] Figure 9 The results show the ammonia nitrogen content of fermentation products of wild-type Streptomyces CK-15 and Streptomyces Norilsk YC3078 at different time points. Detailed Implementation

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] The *Streptomyces albulus* CK-15 involved in this invention embodiment was deposited on July 10, 2024, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31251. It has also been disclosed in several patents, such as: CN118995513B, "A *Streptomyces albulus* mutant strain and its application in the production of oryzanol"; and CN118995552A, "A *Streptomyces albulus* mutant strain, its construction method, and its application." In addition, after the whole genome of the bacterium was sequenced, the strain was renamed and classified by NCBI in 2024, and Streptomyces albulus CK-15 was classified as Streptomyces noursei strain CK-15 (Genebank accession number NZ_CP026094.1).

[0045] Some of the reagents used in this invention embodiment: Phanta Max Super-Fidelity DNAPolymerase P505-d2 was purchased from Nanjing Novizan Biotechnology Co., Ltd., and DNA Maker DL2000 and DNA Maker DL5000 were purchased from TaKaRa Corporation of Japan.

[0046] In the early stages of this invention, a key target for oryzanol synthesis—cytidylate kinase (CMP)—was predicted using metabolic models. The CMP gene participates in the primary metabolism of the strain, catalyzing the transfer of phosphate groups from ATP to CMP and dCMP to form nucleoside diphosphates, maintaining intracellular CDP levels. This enzyme also participates in nucleotide salvage synthesis. Therefore, this invention predicts that the CMP gene can positively promote oryzanol synthesis by regulating metabolite supply, homeostasis, and gene expression cascade effects. Given the key regulatory potential of the CMP gene in oryzanol synthesis and the core requirement for breeding high-yielding strains, using this gene to modify Streptomyces CK-15 to increase oryzanol production has significant research value.

[0047] Example 1 Construction of recombinant plasmid pSETC-CMP

[0048] The CMP gene fragment was cloned using the designed primers. The pSETC plasmid was linearized by double digestion with BamHI and SpeI restriction enzymes. The CMP fragment amplification product and the double-digested pSETC plasmid were assembled together using the Gibson Assembly one-step isothermal method. After the fragment was sequenced and found to be correct, the overexpression recombinant plasmid was obtained and named recombinant plasmid pSETC-CMP.

[0049] The recombinant plasmid pSETC-CMP was transformed into E. coli DH5α competent cells using the heat shock method. After single colonies were verified as positive by colony PCR, they were sent to the company for sequencing. The sequencing results reported by the company were compared with the target gene sequence, and the results were consistent, indicating that the CMP gene overexpression recombinant plasmid was successfully constructed.

[0050] Primers used for fragment cloning:

[0051] CMP-L: 5'-GTGGAAACCGCCGACCG-3', SEQ ID NO.2;

[0052] CMP-R: 5'-TCACCGGATGTCCCGCCCCGCCTTC-3', SEQ ID NO. 3.

[0053] PCR amplification reaction system: ddH2O 13µL, 2×Phanta MAX Buffer 25µL, dNTP mix 1µL, upstream primer CMP-L 2µL, downstream primer CMP-R 2µL, Phanta Max Super-Fidelity DNA Polymerase P505-d2 1µL, DNA 1µL and 50% DMSO 5µL.

[0054] PCR reaction conditions: Pre-denaturation: 95℃ for 10 min; Denaturation: 95℃ for 30 sec, 25 cycles; Annealing: 65℃ for 30 sec, 25 cycles; Extension: 72℃ for 30-60 sec / kb, 25 cycles; Complete extension: 72℃ for 10 min.

[0055] The results of electrophoresis detection of the amplification products are as follows: Figure 1 As shown, the results indicate that a 732bp CMP gene fragment (SEQ ID NO.1) can be amplified, consistent with the expected result. The pSETC plasmid digestion electrophoresis results are shown below. Figure 2 The results showed that the enzyme digestion was successful.

[0056] The CMP gene sequence (SEQ ID NO.1) is as follows:

[0057] .

[0058] Example 2: Conjugation transfer of strain YC3078 with wild-type Streptomyces CK-15

[0059] (1) Culture of Escherichia coli ET12567 cells: On the afternoon before the conjugation transfer, Escherichia coli ET12567 cells carrying the target plasmid were inoculated into LB medium and cultured at 37°C until the OD value was reached. 600 Binding transfer experiments can be performed when the value is 0.4-0.6.

[0060] (2) Culture of Streptomyces chrysogenum CK-15 spores: Streptomyces chrysogenum CK-15 spores were spread on SFM solid medium and cultured at 30℃ for 3-5 days. At this time, the SFM solid medium was covered with gray-black spores. The spores were collected with cotton swabs in TES buffer solution for direct conjugation transfer; or the spores were collected with cotton swabs in 20% glycerol and stored in a -80℃ refrigerator for long-term storage.

[0061] (3) Washing of Escherichia coli ET12567 cells: Add 1 mL of LB medium to each EP tube, mix well by pipetting, centrifuge at 12000 rpm for 1 min, and collect the cells; repeat this operation 3 times, then add 100 µL of LB medium to reflux in a 10-fold concentration manner, and mix well by pipetting.

[0062] (4) Washing of Streptomyces CK-15 spores: Take an appropriate amount of Streptomyces CK-15 spores and wash with 1 mL of TES buffer solution. After mixing, centrifuge at 12000 rpm for 1 min. Repeat this operation twice, wash with 1 mL of TES buffer solution, mix, and centrifuge at 12000 rpm for 1 min. After washing the Streptomyces CK-15 spores twice, thaw them with 500 µL of TES and mix.

[0063] (5) Heat shock of Streptomyces CK-15 spores: After heat shock in a water bath at 50℃ for 10 min, add 2× spore pre-germination solution (10 g / L yeast extract; 10 g / L casein hydrolysate; H2O to 1 L) and 20 µL of 0.5 M calcium chloride and mix well.

[0064] (6) Mixed culture of Escherichia coli ET12567 cells and heat-shocked spores: Escherichia coli ET12567 cells and heat-shocked spores were mixed evenly at a volume ratio of 10:1 and then spread on a substrate supplemented with 10 mM Mg 2+ After drying the plates on SFM solid medium in a clean bench, they were incubated in a 30°C incubator for 16 hours.

[0065] (7) Antibiotic culture: After culturing for 16 hours, cover with antibiotics. Each plate should be evenly covered with 1.5 mL ddH2O + 40 µL 50 mg / mL Apramycin (sulfate) + 40 µL 50 mg / mL Nalidixic acid. Dry in a clean bench and incubate at 30°C for 3-5 days. Gonids will generally grow.

[0066] Example 3 Screening and Validation of YC3078 strain

[0067] pSETC is a single-copy integrative plasmid containing an apramycin resistance gene. Therefore, strains containing the recombinant plasmid pSETC-CMP can grow on SFM plates containing a final concentration of 50 μg / mL apramycin. Strains that can grow on SFM plates containing apramycin resistance were purified and cultured. Single colonies were picked and cultured in liquid form, and the genome was extracted for PCR verification. The verification primers were Apr-F (GAGTGCAATGTCGTGCAATACGA, SEQ ID NO.4) and Apr-R (GCATTCTTCGCATCCCGCCT, SEQ ID NO.5). If the selected strain amplified the Apra gene fragment, it was confirmed that the strain was a CMP gene overexpression mutant, named YC3078.

[0068] DNA was extracted from the CMP gene overexpression mutant strain, and PCR amplification and agarose gel electrophoresis were performed using primers Apra-F / R. The results are as follows: Figure 3 As shown, the CMP gene overexpression mutant strain can amplify the AMP resistance gene fragment (777bp), while *Streptomyces leucocephala* CK-15 cannot amplify a fragment of the corresponding length. Therefore, the CMP gene overexpression mutant strain YC3078 was successfully constructed.

[0069] The CMP gene overexpression mutant strain of this invention is named Streptomyces noursei YC3078, and was deposited on December 3, 2025 at the Guangdong Provincial Microbial Culture Collection Center, with accession number GDMCC No: 67402, located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0070] Example 4: Analysis of the culture characteristics of Streptomyces northerly YC3078

[0071] Wild-type *Streptomyces chrysogenum* CK-15 and *Streptomyces northerneri* YC3078 were respectively plated on SFM plates and cultured for 166 h. The growth of the strains was then observed. The results are as follows: Figure 4 As shown, the results indicate that *Streptomyces northerneri* YC3078 exhibits a significantly faster sporulation rate compared to the wild-type *Streptomyces leucocephala* CK-15. Therefore, *Streptomyces northerneri* YC3078 can accelerate the sporulation rate of the strain.

[0072] Example 5: Growth analysis of Streptomyces northerly YC3078 cells

[0073] Wild-type *Streptomyces chrysogenum* CK-15 and *Streptomyces northernii* YC3078 mycelial blocks were inoculated into 100 mL of seed culture medium (20.0 g / L glucose, 6.0 g / L yeast extract, 10.0 g / L NaCl). The shaker parameters were set to 28℃ and 220 rpm. After 1 day of incubation, the OD value of the seed culture was measured. 2 mL of wild-type *Streptomyces chrysogenum* CK-15 seed culture was added to 100 mL of M3G medium, and *Streptomyces northernii* YC3078 seed culture was added in the corresponding proportion. Each treatment was repeated three times. Samples were taken every 6 hours for a total of 16 samplings (90 hours). First, filter paper dried to a constant weight was used for filtration. Then, the filter paper containing mycelia was dried in an oven at 54℃ until its weight was constant; this weight was the dry weight of the mycelia.

[0074] The results are as follows Figure 5 As shown, the dry weight of *Streptomyces northerneri* YC3078 hyphae was not significantly different from that of wild-type *Streptomyces leucocephala* CK-15 between 6 and 24 hours. However, starting from 24 hours, the dry weight of *Streptomyces northerneri* YC3078 hyphae was almost always higher than that of wild-type *Streptomyces leucocephala* CK-15, with the maximum dry weight of *Streptomyces northerneri* YC3078 hyphae reaching 0.69 g. These results indicate that overexpression of the CMP gene can increase hyphal production and promote the growth of the strain.

[0075] Example 6. Oxygenin production capacity of Streptomyces Norrse YC3078

[0076] Preparation of Soybean Meal Foam Medium (SFM): Weigh 20g of soybean meal, add to 800-900mL of distilled water and mix well. Sterilize at 121℃ for 20min. Take the supernatant and filter it through gauze. Add 20g of mannitol to the supernatant, and then add distilled water to make up to 1L. Mix well and dispense into four 500mL Erlenmeyer flasks. Add 4-4.5g of agar powder to each flask and sterilize at 121℃ for 20min.

[0077] Prepare seed culture medium: Weigh 20g glucose, 6g peptone, 6g yeast powder and 10g sodium chloride, dissolve in 1L distilled water and adjust the pH to 7.2-7.4.

[0078] Prepare the fermentation medium for oryzanol: Weigh 30g of corn flour, 20g of soybean meal, 20g of glucose, 4g of ammonium sulfate and 3g of calcium carbonate, and dissolve them in 1L of distilled water.

[0079] Wild-type Streptomyces CK-15 and Streptomyces Norr's YC3078 were inoculated into 100 mL of the above seed culture medium and cultured at 220 rpm and 28 °C for 24 h. OD was measured after the seed culture became turbid. 600 Value, to OD 600The values ​​ranged from 0.4 to 0.6. In the control group (wild-type *Streptomyces chinensis* CK-15), 10% of the wild-type *Streptomyces chinensis* CK-15 seed culture was inoculated into 100 mL of oryzanol fermentation medium. In the experimental group (*Streptomyces northernii* YC3078), the same proportion of *Streptomyces northernii* YC3078 seed culture was inoculated into the fermentation medium. The cultures were incubated at 220 rpm and 28℃ for 72 h. The fermentation products were processed using a 0.22 μm bacterial filter, and the oryzanol content in the fermentation products was determined by HPLC under the following conditions (Table 1).

[0080] Table 1 HPLC detection conditions

[0081]

[0082] The results of the determination of oryzanol content in fermentation products of *Streptomyces chrysogenum* CK-15 and *Streptomyces northerneri* YC3078 are as follows: Figure 6 As shown, the peak elution time of the oryzanol standard was approximately 3.30 min. Both *Streptomyces leucovorum* CK-15 and *Streptomyces northernii* YC3078 showed significant peak elution at approximately 3.30 min. The oryzanol content in the fermentation product of *Streptomyces leucovorum* CK-15 was 951 mg / L, while the oryzanol content in the fermentation product of *Streptomyces northernii* YC3078 was 1735.58 mg / L. Compared to *Streptomyces leucovorum* CK-15, the oryzanol content in the fermentation product of *Streptomyces northernii* YC3078 was increased by approximately 27%.

[0083] Example 7: Antibacterial activity of Streptomyces Norrers YC3078 against Rhodotorula rubrum

[0084] The antibacterial activity of fermentation broths of wild-type *Streptomyces chrysogenum* strains CK-15 and YC3078 was determined using the tube disc method with *Rhodotorula rubrum* as an indicator. 50 μL of each of the two *Streptomyces* strains, preserved in 20% glycerol tubes, were spread onto SFM plates and incubated at 30°C for 2 days. A 1 cm section was then cut from each plate. 2Small square pieces were placed in 30 mL of seed culture medium and incubated at 30 °C and 220 rpm for 24 h to obtain the seed culture. The seed culture was then inoculated into 50 mL of freshly prepared fermentation medium at a 10% inoculation rate and incubated at 30 °C and 220 rpm for 72 h. After incubation, 1 mL of fermentation broth was centrifuged at 12000 rpm for 1 min, and the supernatant was aspirated with a 1 mL syringe and filtered through a 0.22 μm aqueous filter membrane into a sterile 1.5 mL EP tube. 1 mL of red yeast culture with an OD value of 1.2 was added to PDA medium, and after mixing, 20 mL of PDA medium containing red yeast was added to each plate. Sterile Oxford cups were placed on the plates using sterile forceps, and 200 μL of the filtered fermentation broth was aspirated into each Oxford cup. Each treatment was repeated in four replicates. After incubation at 30 °C for 48 h, the diameter of the inhibition zone was observed and measured.

[0085] The inhibition zone of oryzanol was measured using red yeast as an indicator. The antibacterial activity of strain YC3078 against red yeast was determined, with four replicates for each treatment. The inhibition zone of strain YC3078 against the red yeast indicator was significantly larger than that of wild-type Streptomyces CK-15. Therefore, as... Figure 7 As shown, strain YC3078 significantly increased the production of the antibacterial active substance oryzin compared to wild-type Streptomyces CK-15.

[0086] Example 8 Determination of glucose content in fermentation products of Streptomyces northerly YC3078

[0087] Take wild-type Streptomyces CK-15 seed liquid (OD) 600 With a concentration of 0.4-0.6 g / mL, 1 mL was inoculated into the oryzanol fermentation medium at a 10% inoculum concentration. *Streptomyces northerly* YC3078 (OD200) 600 (Value 0.4-0.6) The seed culture was inoculated into the ornidazole fermentation medium at an equal volume ratio, just like the wild-type strain, and cultured at 28℃ and 220rpm for 5 days. Samples were taken every 12 hours for a total of 10 times, with 3 replicates for each treatment. The glucose content in the fermentation products at different time points was detected using a glucose content detection kit (Beijing Box Biotechnology). The detection method is as follows:

[0088] 1. Dilute the standard according to Table 2 and plot the standard curve.

[0089] Table 2 Preparation of glucose standard curve solution

[0090]

[0091] 2. Preparation of the working solution: Mix reagent 1 and reagent 2 in the kit at a volume ratio of 1:1 until homogeneous. The solution should be prepared fresh for each use.

[0092] 3. Take 20 μL of fermentation product from each strain at different time points and add it to a 96-well microplate. Then add 180 μL of detection working solution. For the blank group, replace the fermentation product with distilled water. After thorough mixing, incubate at 37℃ for 15 min.

[0093] 4. Measure the absorbance at 505 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0094] 5. Calculate the x-value of the sample based on the standard curve and the measured absorbance.

[0095] 6. Substitute x into the formula: Glucose content (μg / mL) = 100 × x × dilution factor, and you can get the glucose content of each sample.

[0096] The results are as follows Figure 8 As shown, compared with wild-type Streptomyces CK-15, the glucose content in the fermentation broth of Streptomyces davidii YC3078 decreased at a faster rate, rapidly decreasing before 50 hours, and eventually maintaining a low glucose content level consistent with wild-type Streptomyces CK-15. This indicates that Streptomyces davidii YC3078 significantly accelerates the glucose consumption rate in the fermentation broth, and its overexpression enhances the strain's ability to utilize glucose, causing glucose to be consumed more quickly during fermentation.

[0097] Example 9: Determination of ammonia nitrogen content in fermentation products of Streptomyces northerly YC3078

[0098] One mL of wild-type *Streptomyces chrysogenum* CK-15 seed culture was inoculated into oryzanol fermentation medium at a 10% inoculum concentration. *Streptomyces northerneri* YC3078 seed culture was inoculated into oryzanol fermentation medium at the same volume ratio as the wild-type strain. The cultures were incubated at 28℃ and 220 rpm for 5 days, with samples taken every 12 hours for a total of 10 times. Each treatment was replicated in triplicate. The ammonia nitrogen content in the fermentation products at different time points was detected using an ammonia nitrogen content detection kit (Beijing Box Biotechnology). The detection method is shown below:

[0099] 1. Dilute the standard according to Table 3 and plot the standard curve.

[0100] Table 3 Preparation of ammonia nitrogen standard curve solutions

[0101]

[0102] 2. Preparation of the working solution: Mix solution A and solution B of reagent 1 in the kit at a volume ratio of 1:1. Dissolve reagent 2 in 8 mL of distilled water. The principle of preparing the solution immediately before use should be followed.

[0103] 3. Take 60 μL of fermentation product from each strain at different time points and add it to a 96-well microplate. Then add 90 μL of reagent 1 and 15 μL of reagent 2, incubate in a boiling water bath for 15 min, and then add reagent 3. For the control group, replace the fermentation product with distilled water and mix thoroughly.

[0104] 4. Measure the absorbance at 570 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0105] 5. Calculate the ammonia nitrogen concentration of the sample based on the standard curve and the measured absorbance value.

[0106] The ammonia nitrogen content in the fermentation products of various strains at different time periods was determined, and the results are as follows: Figure 9 As shown, the ammonia nitrogen content of *Streptomyces northernii* YC3078 increased rapidly within 0-20 h, similar to that of wild-type *Streptomyces simonii* CK-15, but its peak value was slightly higher than that of wild-type *Streptomyces simonii* CK-15. Subsequently, the overall ammonia nitrogen content showed a fluctuating downward trend, even lower than that of wild-type *Streptomyces simonii* CK-15 at certain culture time points, but its overall ammonia nitrogen content was still higher than that of wild-type *Streptomyces simonii* CK-15. This indicates that *Streptomyces northernii* YC3078 has a bidirectional regulatory effect on the absorption and utilization of ammonia nitrogen. In the early stage (0-20 h), it promotes ammonia nitrogen absorption and accumulation, resulting in a higher peak ammonia nitrogen content than wild-type *Streptomyces simonii* CK-15. Furthermore, *Streptomyces northernii* YC3078 increases the efficiency of ammonia nitrogen metabolism and transformation at 20 h, leading to a fluctuating decrease in ammonia nitrogen content that is lower than that of wild-type *Streptomyces simonii* CK-15 at the same time.

[0107] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A strain of Streptomyces norkelstein ( Streptomyces noursei YC3078, characterized in that, The accession number of the Streptomyces Norilskia YC3078 is GDMCC No:67402.

2. The use of Streptomyces Norilskia YC3078 as described in claim 1 in any of the following: (1) Production of oryzanol; (2) Increase the production of oryzanol.

3. A method for producing oryzanol, characterized in that, The method includes the step of fermenting and culturing Streptomyces Norilskia YC3078 as described in claim 1, and separating and extracting oryzin from the obtained Streptomyces Norilskia YC3078 fermentation broth.

4. The method according to claim 3, characterized in that, The culture medium used in the fermentation culture includes the following components at the following concentrations: Corn flour 30g / L, soybean meal 20g / L, glucose 20g / L, ammonium sulfate 4g / L and calcium carbonate 3g / L.

5. The method according to claim 3, characterized in that, The fermentation culture was carried out at a temperature of 25-30℃, a rotation speed of 200-300 rpm, and a culture time of 70-80 h.

6. A yeast antibacterial agent, characterized in that, The yeast antibacterial agent includes Streptomyces Norilsk YC3078 as described in claim 1.

Images