Rice plant height control gene osph4 and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and specifically discloses a rice plant height regulating gene OsPH4 and application thereof, a nucleotide sequence of the gene OsPH4 is shown as SEQ ID NO. 1, an amino acid sequence of a protein encoded by the gene OsPH4 is shown as SEQ ID NO. 2; after a gene OsPH4 of Liao 93B is mutagenized into a mutant gene OsPH4 by using a chemical mutagen, a rice dwarf homozygous mutant osph4 is obtained through self-crossing of multiple generations in a field. Compared with the prior art, the application clones the plant height regulating gene OsPH4, in the rice dwarf mutant by using a map-based cloning technique, and a function complementation experiment proves that the gene OsPH4 is a gene for controlling the plant height of rice. OsPH4 The gene OsPH4 is significantly reduced in the plant height in the whole growth period of rice after gene mutation, and therefore can be used for cultivating a dwarf rice variety.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a gene for regulating rice plant height. OsPH4 And its applications. Background Technology

[0002] As one of the world's most important food crops, the yield stability of rice is directly related to global food security. Among rice and other cereal crops, plant height is a key agronomic trait closely related to lodging resistance and yield performance. Taller crops are generally more susceptible to wind damage, while shorter-stemmed crops typically have enhanced lodging resistance.

[0003] Rice plant height is precisely controlled by a multi-level transcriptional regulatory network, in which transcription factor families such as GRAS, DELLA, TCP, bZIP / HD-Zip, and MADS-box play key roles. Despite extensive research, the molecular mechanisms regulating rice plant height are not yet fully elucidated. Therefore, a deeper understanding of the molecular mechanisms regulating plant height can improve rice productivity and contribute to rice variety improvement. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a rice plant height regulating gene. OsPH4 And its applications.

[0005] To achieve the above objectives, the present invention is implemented according to the following technical solution: One objective of this invention is to provide a gene for regulating rice plant height. OsPH4 The gene OsPH4 The nucleotide sequence of the gene is shown in SEQ ID NO.1. OsPH4 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0006] The second objective of this invention is to provide a gene for regulating rice plant height. OsPH4 Its application in breeding dwarf rice varieties, through gene analysis of Liao 93B. OsPH4 Induced by chemical mutagen OsPH4 After the gene mutation was performed, multiple generations of self-pollination in the field were conducted to obtain homozygous dwarf mutant rice. osph4 The homozygous dwarf mutant of rice osph4 It is by OsPH4 The protein encoded by the mutation of a C to A at position 342 of the coding region, resulting in a stop codon being created at position 114 instead of a tyrosine residue, is obtained. OsPH4 The nucleotide sequence of the mutated gene is shown in SEQ ID NO.3. OsPH4 The amino acid sequence of the protein encoded by the mutant gene is shown in SEQ ID NO.4.

[0007] Preferably, the chemical mutagen is 1% ethyl methanesulfonate.

[0008] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention utilizes map-based cloning technology to clone the gene regulating plant height in a rice dwarf mutant. OsPH4, Functional complementarity experiments prove OsPH4 It is a gene that controls the height of rice plants. OsPH4 Genes influence the variation in rice plant height, resulting in a dwarf phenotype throughout the entire growth period.

[0009] 2. The present invention OsPH4 Gene OsPH4 After the gene mutation, the plant height is significantly reduced throughout the entire rice growing season, thus it can be used to breed dwarf rice varieties. Attached Figure Description

[0010] Figure 1 This refers to the plant phenotype in this invention; where WT represents the wild-type Liao 93B. osph4 It is a dwarf mutant; A represents wild-type Liao93B and mutant. osph4 Plant phenotype; B indicates wild-type Liao93B and mutants. osph4 Spike height phenotype; C represents wild-type Liao93B and mutant. osph4 Stem node phenotype; D indicates wild-type Liao93B and mutant. osph4 Length of stem segment; E represents a cell section from the internode of wild-type Liao 93B spikelet stem; F indicates a mutant. osph4 Cell sections from internodes of spikelets; G indicates wild-type Liao93B and mutants. osph4 Spike internode cell length; Figure 2 The rice dwarf mutant gene in this invention OsPH4 Genetic and physical maps; Where A represents the initial localization interval between markers W3 and W4 on chromosome 4; B indicates that the gene is finely mapped between markers W6 and W7; C indicates that the size of the region is 65.07 kb, containing a total of 13 open reading frames; D represents the structure and mutation location of the candidate gene; Figure 3 This invention relates to the gene that regulates rice plant height. OsPH4The PCR products were identified by agarose gel electrophoresis; where the first lane represents the DL2000 DNA Marker, the second lane represents the PCR product of wild-type Liao93B, and the third lane represents the mutant. osph4 PCR products; Figure 4 Genes related to rice plant height regulation in this invention OsPH4 Amino acid sequence domain analysis; Figure 5 In this invention OsPH4 Functional verification of plant phenotype; among them, WT is wild-type Liao 93B, osph4 It is a dwarf mutant. osph4-c1 and osph4-c2 It is a dwarf mutant transformed into a wild-type Liao93B gene-positive plant. Detailed Implementation

[0011] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0012] Materials used in this invention embodiment: wild-type rice material Liao 93B (WT) and dwarf mutant ( osph4 All reagents were cultured in our laboratory; high-fidelity enzyme KOD FX was purchased from TOYOBO; Taq DNA polymerase, RNA extraction kit, M-MLV reverse transcriptase, DL2000 DNA Marker, restriction endonucleases, plasmid mini-extraction kit, and DNA gel recovery kit were purchased from TAKARA; seamless cloning kit was purchased from Novizan; kanamycin (kan) and ampicillin (amp) were purchased from Zhongke Ruitai; other chemical reagents were purchased from Solarbio; primer synthesis and DNA sequencing were performed by Beijing BGI Genomics Co., Ltd.; Escherichia coli DH5α, Agrobacterium tumefaciens EHA105, and pCAMBIA1300s vectors were all preserved in our laboratory.

[0013] I. Dwarf Rice Mutants osph4 Acquisition and phenotypic observation The plant height regulation-related mutant used in this embodiment osph4The Liao 93B seed was obtained through mutagenesis using the chemical mutagen EMS (ethyl methanesulfonate). The specific steps are as follows: First, clean Liao 93B seeds were soaked in a 1% concentration of EMS for 12 hours. The seeds were then removed and rinsed thoroughly with running water to remove any remaining EMS. Care was taken to preserve the rinsing solution and dispose of it along with any EMS waste liquid. The mutated seeds were then sown in seedling trays and transplanted to the field when they reached the 4.5-leaf stage. After maturity, the seedlings were harvested according to individual plant numbers. The M1 generation was planted according to these numbers to form plant lines. Phenotypic observation revealed one dwarf line in the M1 generation. After four growing seasons, a homozygous mutant related to plant height regulation with a stably heritable dwarf phenotype was obtained. osph4 .like Figure 1 As shown, under normal field conditions, compared with the wild type, the mutant... osph4 From the seedling stage, the entire plant exhibits a dwarf phenotype; mutant osph4 The plant height was significantly lower than that of the wild type Liao 93B ( Figure 1 A in the text). Mutant. osph4 Both the wild-type Liao 93B and the mutant contain 5 stem segments, but the mutant... osph4 The length of each stem segment was significantly shorter than that of the wild type. Figure 1 (BD in the text). Paraffin section observation revealed that the stem node cells of wild-type Liao 93B were significantly longer than those of the mutant. osph4 ( Figure 1 (EG in the middle).

[0014] two, OsPH4 Gene localization Preliminary location: Take samples respectively osph4 DNA was extracted from 15 extreme individuals exhibiting both tall and short phenotypes in the F2 population derived from the Kasalath hybridization. Using 232 marker pairs from our research group, we screened for polymorphism in wild-type and mutant individuals, finding that markers W1 to W4 on chromosome 4 (primer sequences shown in Table 1) were linked to the target gene. We then tested the linkage between these two markers and the target trait using 94 mutant individuals from the F2 population. The number of individuals exchanging for these four markers was found to be 20, 16, 7, and 6, respectively. Therefore, we determined that the gene regulating the plant height phenotype is located between markers W3 and W4 on chromosome 4. Specific PCR reaction systems and procedures are shown in Tables 2 and 3.

[0015] Fine mapping: Markers were developed based on the reference sequences of Nipponbare and Kasalath, and the population was expanded to 825 individual plants for fine mapping. Finally, the gene was mapped. OsPH4 It is located between W6 and W7 (primer sequences are shown in Table 1), with a physical distance of approximately 65.07 kb.

[0016] The primers for the above markers are as follows: Table 1 Primer information for A1-A6

[0017] Table 2 PCR reaction system

[0018] Table 3 PCR reaction procedure

[0019] By sequencing 13 open reading frames (ORFs) within a 65.07 kb region, mutants were discovered. osph4 of OsPH4 The mutated gene's coding region has a base position 342 changed from "C" to "A", which causes the amino acid position 114 of the encoded protein to change from tyrosine to a stop codon.

[0020] three, OsPH4 Cloning of genes Take 2g of wild-type Liao93B and mutant respectively osph4 Seedling leaves were rapidly frozen in liquid nitrogen, and total RNA was extracted according to the instructions of the RNA extraction kit. Then, cDNA was synthesized by reverse transcription according to the instructions of the M-MLV reverse transcription kit. Using the cDNA as a template, PCR amplification was performed using complementary primer pairs (BF, BR) and KOD FX high-fidelity DNA polymerase. The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 30 s, 57℃ annealing for 30 s, 68℃ extension for 1 min, for a total of 35 cycles; and a final extension at 68℃ for 10 min.

[0021] BF, SEQ ID NO.21: TCCTCTAGAGTCGACCTGCAGATGGCAATAGACGATGAATCGC; BR, SEQ ID NO.22: CTCGAGCTTGCATGCCTGCAGTTAGAACTCCACCATGAGGCTG; The PCR products were detected by electrophoresis on a 1.0% (g / mL) agarose gel, and the results are as follows. Figure 3 As shown, wild-type Liao 93B and mutant osph4 The PCR products all showed a single bright band at approximately 750 bp, consistent with the gene size annotated in GenBank. Therefore, the PCR products of wild-type Liao 93B were named... OsPH4 Genes, mutants osph4 PCR product naming OsPH4 Mutant genes ( osph4 ).

[0022] The PCR products of wild-type and mutant strains were excised and recovered using a DNA gel extraction kit, and the purified products were then extracted using a seamless cloning kit. OsPH4 Genes and OsPH4 The mutated gene was ligated into pCAMBIA1300s. The recombinant plasmid was transformed into E. coli DH5α, and the bacterial culture was sent to a sequencing company for sequencing. OsPH4 Genes and OsPH4 The coding regions of the mutant genes are all 750 bp, which is the same as that of the wild type. OsPH4 compared to, OsPH4 The mutated gene's cDNA has a base position 342 changed from "C" to "A", resulting in the 114th amino acid in its encoded protein changing from a tyrosine residue to a stop codon. OsPH4 The nucleotide sequence is shown in SEQ ID NO. 1, gene. OsPH4 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2. OsPH4 The nucleotide sequence of the mutated gene is shown in SEQ ID NO.3. OsPH4 The amino acid sequence of the protein encoded by the mutant gene is shown in SEQ ID NO.4, and the specific sequence is shown in Table 4.

[0023] Table 4

[0024]

[0025] five, OsPH4 Functional verification of genes To verify the mutant osph4 The phenotype is due to OsPH4 Caused by gene mutation, we will amplify OsPH4 The coding region sequence (as shown in SEQ ID NO.1) was inserted between the PstⅠ and SalⅠ restriction sites of the vector pCAMBIA1300s to obtain the recombinant expression vector pCAMBIA1300s- OsPH4 The recombinant vector was introduced into the callus tissue of the mutant via Agrobacterium EHA105-mediated genetic transformation. Transgenic plants were obtained, and continuous observation of the plant phenotype revealed that compared with the wild-type Liao 93B, plant height was restored (e.g., ...). Figure 5 (As shown). Therefore, it can be proven that... OsPH4 The gene is a dwarf mutant. osph4 Regulatory genes.

[0026] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A gene regulating rice plant height OsPH4 Its application in the breeding of dwarf rice varieties is characterized by: Genes that regulate plant height in rice OsPH4 Loss-of-function mutations occur, resulting in dwarf rice varieties with reduced plant height; wherein, the plant height regulating gene... OsPH4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. OsPH4 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

Images