Primer sets, probes, and detection methods for hepatitis E virus and parainfluenza 5 virus derived from red pandas.

Abstract

This invention relates to primer sets, probes, and detection methods for hepatitis E virus and parainfluenza 5 virus from red pandas. The primer sets and probes can simultaneously and specifically identify hepatitis E virus and parainfluenza 5 virus from red pandas using a single-tube method, without cross-reactivity with other common pathogens, exhibiting high specificity and sensitivity. The detection method based on these primer sets and probes can complete the detection within 20 minutes under constant temperature conditions, providing zoos, wildlife rescue centers, and other conservation institutions with rapid diagnostic methods and instruments for pathogens.

Description

Technical Field

[0001] This invention relates to the field of virus detection technology for endangered wild animals, and to primer sets, probes and detection methods for hepatitis E virus and parainfluenza type 5 virus from red pandas. Background Technology

[0002] As a rare and endangered wild animal, the red panda has extremely high ecological conservation and scientific research value. However, its captive and wild populations are facing serious threats from a variety of infectious diseases, among which diseases caused by red panda hepatitis E virus and parainfluenza virus are particularly prominent.

[0003] Parainfluenza virus belongs to the Paramyxoviridae family and is an enveloped, single-stranded, negative-sense RNA virus with a genome length of approximately 15.2-15.5 kb. This virus exhibits broad host adaptability, can be transmitted through the respiratory tract, and causes severe respiratory symptoms such as pneumonia in red pandas after infection. The high positive detection rate in wild animal populations indicates a risk of widespread transmission.

[0004] Hepatitis E virus is a non-enveloped, single-stranded, positive-sense RNA virus with a genome length of approximately 7.2 kb. Its genome contains three main open reading frames: ORF1 encodes a non-structural protein, ORF2 encodes a capsid protein, and ORF3 encodes a multifunctional small protein. Red pandas face the same threat of infection.

[0005] Currently, the detection of PIV-5 and HEV in red pandas mainly relies on traditional laboratory virus isolation or PCR techniques. While these methods are accurate, they are cumbersome, time-consuming (ranging from hours to days), and require specialized laboratory equipment and personnel, making it difficult to achieve rapid diagnosis and timely intervention in frontline settings such as wildlife breeding sites, zoos, or rescue centers.

[0006] Furthermore, red pandas are at risk of co-infection with two viruses, which could exacerbate the complexity of their condition and place higher demands on diagnostic techniques. Therefore, there is an urgent need for a new technology that can overcome the limitations of existing technologies and enable rapid, sensitive, and specific simultaneous on-site detection of two pathogens. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides a primer set and probe for red panda-derived hepatitis E virus and parainfluenza 5 virus. This primer set and probe can simultaneously and specifically recognize red panda-derived hepatitis E virus and parainfluenza 5 virus in a single tube, without cross-reacting with other common pathogens, exhibiting high specificity and sensitivity.

[0008] This invention provides a primer set and probe for hepatitis E virus and parainfluenza type 5 virus from red pandas. The primer set includes a hepatitis forward primer, a hepatitis reverse primer, a parainfluenza forward primer, and a parainfluenza reverse primer. The sequences of the parainfluenza forward primer and the parainfluenza reverse primer are shown as PIV5-F1 and PIV5-R1, respectively: PIV5-F1: GATCGATGGCTTTGGGGAGGGATCATTCCGCT (SEQ ID NO. 1); PIV5-R1: TTCCCTTTCGGATCAATTCTGGATTATTCTT (SEQ ID NO. 2); The sequences of the hepatitis forward primer and the hepatitis reverse primer are shown in HEV-F1 and HEV-R3, respectively. HEV-F1: TCTGGTGATATTAATACGTCTGTAGTTGCT (SEQ ID NO.8); HEV-R3: TAGGCGAACCAAGGCCGGCGCCGCCGTCAA (SEQ ID NO. 13).

[0009] In one embodiment, the probe includes a hepatitis probe and a parainfluenza probe; The sequence of the parainfluenza probe is shown in PIV5-NP: PIV5-NP: TGCTTCTATTGAGAAACGCCTGCAAAAGTATCGTCAGCAAGGCAGGA (SEQ ID NO.7); The sequence of the hepatitis probe is shown in HEV-P: HEV-P: GGATCCCCCCGTACAAGCTCAGCCCCCAACTTCCAGTCAGGCGGTGCC (SEQ ID NO. 14).

[0010] The inventors isolated and identified hepatitis E virus from diseased and deceased red pandas, indicating that red pandas face the same infection threat. Unlike human or other animal-derived hepatitis E viruses, the genome of red panda-derived hepatitis E virus is unique, sharing only 85.35%-91.34% similarity with known hepatitis E viruses (such as porcine and human HEV). Furthermore, this virus has the potential for cross-species transmission. Therefore, the primer sequences previously used for identifying hepatitis E viruses from other animal sources are not highly relevant to red panda-derived hepatitis E virus and cannot be easily reused. Simultaneous detection of red panda-derived hepatitis E virus and red panda-derived parainfluenza 5 virus not only reduces the risk of co-infection with two viruses in red pandas but also allows for pathogen identification and source tracing, which is of great significance for disease control. Based on this, the inventors proposed the aforementioned primer set and probe, which can simultaneously and specifically recognize hepatitis E virus and parainfluenza type 5 virus from red pandas. The amplification primer pairs in the primer set are non-complementary and lack hairpin structures, thus preventing primer dimers during the amplification reaction and avoiding false positives. Furthermore, the primer set and probe do not cross-react with other common pathogens, exhibiting high specificity and sensitivity. Recombinase-assisted amplification (RAA) technology is an emerging isothermal nucleic acid amplification technique. Compared to traditional PCR, it does not require a complex thermal cycler and can rapidly amplify the target nucleic acid within 20-30 minutes at a constant temperature of 37-42°C. Therefore, the RAA detection method based on this primer set and probe can complete detection within 20 minutes under isothermal conditions, providing zoos, wildlife rescue centers, and other conservation institutions with a rapid diagnostic method and equipment for pathogens.

[0011] In one embodiment, the 29th base of the parainfluenza probe is labeled with a fluorescent group, the 31st base is labeled with tetrahydrofuran, and the 34th base is labeled with a fluorescence quencher group.

[0012] In one embodiment, the hepatitis probe has a fluorescent group labeled at position 31, a tetrahydrofuran labeled at position 33, and a fluorescence quencher labeled at position 34.

[0013] In one embodiment, the hepatitis forward primer and the hepatitis reverse primer are used to amplify the target sequence of red panda-derived hepatitis E virus, and the parainfluenza forward primer and the parainfluenza reverse primer are used to amplify the target sequence of red panda-derived hepatitis E virus type 5. The target sequence of the red panda-derived parainfluenza type 5 virus is shown in SEQ ID NO. 15, and the target sequence of the red panda-derived hepatitis E virus is shown in SEQ ID NO. 16.

[0014] The present invention also provides the application of the primer set and probe in the preparation of kits for red panda-derived hepatitis E virus and parainfluenza type 5 virus.

[0015] The present invention also provides a kit for hepatitis E virus and parainfluenza 5 virus from red pandas, the kit comprising the primer set and probes described above.

[0016] In one embodiment, the kit further includes: RAA reaction powder, A Buffer, B Buffer, positive control sample, and negative control sample.

[0017] In one embodiment, the kit comprises the following components: Table 1. Components of the kit

[0018] The judgment rules of the kit are as follows: (1) The isothermal amplification result of the positive control sample: a typical amplification curve appears and Ct≤30; (2) The isothermal amplification result of the negative control: no amplification curve appears or Ct>40; the above positive control and negative control are both valid results and are used as a reference to determine whether the sample to be tested contains panda parainfluenza virus type 5 and panda hepatitis E virus; (3) The sample to be tested: the positive sample has a typical amplification curve and the sample to be tested has Ct<35, and is judged as a positive sample; if the FAM channel or ROX channel shows a typical amplification curve Ct≤35, the sample to be tested contains panda parainfluenza virus type 5 or panda hepatitis E virus; negative sample: if Ct>35, or no amplification curve appears, it is judged as a negative sample, that is, the sample to be tested does not contain panda parainfluenza virus type 5 and panda hepatitis E virus or has not reached the detection threshold.

[0019] In one embodiment, the negative control sample is enzyme-free water, and the positive control samples are a standard of parainfluenza type 5 virus plasmid and a standard of hepatitis E virus plasmid from red pandas.

[0020] The present invention also provides a method for detecting hepatitis E virus and parainfluenza type 5 virus from red pandas, comprising the following steps: extracting DNA from the sample to be tested, performing a fluorescent RAA reaction using the kit described above, and obtaining an amplification curve.

[0021] In one embodiment, the temperature of the fluorescent RAA reaction is 35-40°C.

[0022] Compared with the prior art, the present invention has the following beneficial effects: The primer set, probe, and detection method for hepatitis E virus and parainfluenza 5 virus from red pandas of the present invention can simultaneously and specifically identify hepatitis E virus and parainfluenza 5 virus from red pandas, and do not cross-react with other common pathogens. It has high specificity and sensitivity. The detection method based on the primer set and probe has the following advantages: (1) Fast and efficient: It can simultaneously detect both PIV and HEV viruses within 20 minutes, greatly shortening the waiting time and providing zoos, wildlife rescue centers, and other conservation institutions with rapid diagnostic methods and instruments for pathogens. (2) Sensitivity and specificity: It can accurately identify specific pathogens. The detection limit for both viruses is 10 copies / μL, which is far superior to RT-PCR and quantitative real-time PCR. (3) Simple operation and field applicability: Isothermal amplification reduces the requirements for equipment and supports use in grassroots and field environments. (4) Multiple detection: Two pathogens can be identified in a single reaction, improving monitoring efficiency and reducing detection costs. (5) Virus tracing: This invention specifically amplifies HEV from red pandas, which can distinguish between human and swine HEVs, and can effectively obtain information on the source of the pathogen. In summary, the development of a dual RAA fluorescent rapid detection kit for red panda parainfluenza virus type 5 and hepatitis E virus will effectively solve the current bottleneck in pathogen detection technology, provide strong technical support for early diagnosis of diseases in red pandas, population health monitoring, and effective handling of sudden outbreaks, and has important practical value for the protection of rare wild animals. The detection method based on this primer set and probe is simple and easy to operate, and can be carried out on-site without the need for specialized testing personnel; the detection is rapid and accurate, and has achieved good application results in preliminary applications, which is of great significance for the prevention and control of red panda parainfluenza virus type 5 and red panda hepatitis E virus. Attached Figure Description

[0023] Figure 1 Figure showing the results of the PIV5 primer combination specificity assay; Figure 2 Figure showing the results of the HEV primer combination specificity assay; Figure 3 The graph shows the results of the PIV5 sensitivity test. Figure 4 The graph shows the results of the HEV sensitivity test. Figure 5 This is a graph showing the results of a specificity test. Figure 6 This is a graph showing the results of a repeatability test. Detailed Implementation

[0024] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0026] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all test methods are conventional test methods in this field.

[0027] Source: A Buffer, B Buffer, and reaction powder in the RAA reaction system were all purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0028] Example 1 Design of specific primers and probes A recombinant plasmid DNA containing the PIV5-N gene fragment was constructed based on the NCBI red panda parainfluenza virus (GenBank: KX100034.1). The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid concentration was determined using the Plasmid Mini Kit I and stored at -20℃. The partial genomic sequence of the target gene PIV5-N is shown below.

[0029] Target fragment of parainfluenza virus type 5 N gene: (SEQ ID NO.15).

[0030] After comparing the complete N gene sequences of all parainfluenza virus type 5 strains published in the NCBI GenBank database, specific primers and probes were designed for conserved regions, as shown in Table 2. The primers and probes were all sent to Wuhan Tianyi Huiyuan for synthesis and modification.

[0031] RNA was extracted from red panda tissues using the RNA fast 200 Total RNA Extraction Kit and PrimeScript. ™ Prepare cDNA using the RTreagent Kit and store at -20℃.

[0032] A positive plasmid was constructed, and a recombinant plasmid DNA containing the red panda hepatitis E virus ORF1 gene was constructed. The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid concentration was determined by extracting the plasmid using the Plasmid Mini Kit I kit and stored at -20℃ for later use. The partial sequence of the target gene, red panda hepatitis E virus, is shown below.

[0033] Partial target fragment of the red panda hepatitis E virus ORF1 gene: TCTGGTGATATTAATACGTCTGTAGTTGCTGATGTTCCACCGTTGGATCCCCCCGTACAAGCTCAGCCCCCAACTTCCAGTCAGGCGGTGCCCCCACCAGACTTAGTTGACGGCGGCGCCGGCCTTGGTTCGCCTA (SEQ ID NO. 16).

[0034] Table 2 Primer and probe sequences for red panda parainfluenza type 5 virus and hepatitis E virus

[0035] The PIV5-NP probe in Table 2 is T-labeled with FAM fluorescent group at position 29 of the 5' end, T-labeled with THF tetrahydrofuran at position 31, and T-labeled with BHQ1 fluorescence quencher group at position 34. Modified PIV5-NP probe: TGCTTCTATTGAGAAACGCCTGCAAAAGT[FAM-dT]AT [THF]CGT [BHQ1-dT]CAGCAAGGCAGGA The red panda HEV-P probe in Table 2 is labeled with a ROX fluorescent group at position 31 of the 5' end, a THF tetrahydrofuran group at position 33, and a BHQ2 fluorescence quencher group at position 34. Modified HEV-P probe: GGATCCCCCCGTACAAGCTCAGCCCCCAACT[ROX-dT]TC[THF]C[BHQ2-dT]AGTCAGGCGGTGCC Example 2 Primer pair screening and optimization Three pairs of upstream and downstream amplification primers for red panda parainfluenza virus type 5 and hepatitis E virus were combined in pairs to obtain nine primer-probe combinations, as shown in the table below. Table 3 Primer and probe combinations for red panda parainfluenza virus type 5 and hepatitis E virus.

[0036] Based on the reaction quantity, prepare a mixture containing water, A Bufer, upstream primer (10 μM), downstream primer (10 μM), and probe (10 μM) according to the reaction system. After mixing thoroughly, add it to the detection unit tube containing the reaction dry powder; then add 10 μM of water to the detection unit tube. 5Using copies / μL of plasmid standard as a positive control template, add 2.5 μL of BBuffer to the cap of the detection unit tube, cap the tube, invert and shake gently to mix thoroughly 5-6 times, centrifuge at low speed for 10 seconds, place the detection unit tube in a Genchek fluorescence detector, and react at 39℃ for 20 min to obtain the amplification curve.

[0037] The screening results for the optimal primer and probe combinations for red panda PIV5 are as follows: Figure 1 As shown, the horizontal axis represents the number of reaction cycles, and the vertical axis represents the fluorescence signal value. Figure 1 The results showed that the PIV5-F1R1 primer-probe combination exhibited the earliest peak and the highest amplification efficiency, making it more suitable for rapid and efficient amplification of PIV5 in red pandas. Therefore, the following are the selected good RAA primer sets and probe sequences: Nucleotide sequence of upstream primer PIV5-N-F1: GATCGATGGCTTTGGGGAGGGATCATTCCGCT (SEQ ID NO.1) The nucleotide sequence of the downstream primer PIV5-N-R1: TTCCCTTTCGGATCAATTCTGGATTATTCTT (SEQ ID NO.2) Probe nucleotide sequence: TGCTTCTATTGAGAAACGCCTGCAAAAGTATCGTCAGCAAGGCAGGA (SEQ ID NO.7) The modified probe sequence is as follows: TGCTTCTATTGAGAAACGCCTGCAAAAGT[FAM-dT]AT[THF]CGT[BHQ1-dT]CAGCAAGGCAGGA The screening results for the optimal primer and probe combinations for red panda hepatitis E virus are as follows: Figure 2 As shown, the horizontal axis represents the number of reaction cycles, and the vertical axis represents the fluorescence signal value. Figure 2 The results showed that the HEV-F1R3 primer-probe combination exhibited the earliest peak and the highest amplification efficiency, making it more suitable for rapid and efficient amplification of hepatitis E virus in red pandas. Therefore, the following are the selected good RAA primer sets and probe sequences: Nucleotide sequence of upstream primer HEV-F1: TCTGGTGATATTAATACGTCTGTAGTTGCT (SEQ ID NO.8) The nucleotide sequence of the downstream primer HEV-R3: TAGGCGAACCAAAGGCCGGCGCCGCCGTCAA (SEQ ID NO.13) Probe nucleotide sequence: GGATCCCCCCGTACAAGCTCAGCCCCCAACT TCCAGTCAGGCGGTGCC (SEQ ID NO.14) The modified probe sequence is as follows: GGATCCCCCCGTACAAGCTCAGCCCCCAACT[ROX-dT]TC[THF]C[BHQ2-dT]AGTCAGGCGGTGCC.

[0038] Example 3 Establishment and optimization of the reaction system The total reaction system of 50 μL contained 5 μL of sterile water, 12.5 μL of A Buffer, 2.5 μL of B Buffer, 2.5 μL each of red panda parainfluenza type 5 virus and hepatitis E virus gene templates, totaling 5 μL. The probe concentration was set at 0.2 μM, and the upstream and downstream primer concentration gradients for red panda parainfluenza type 5 virus and hepatitis E virus were 0.4 μM, 0.5 μM, and 0.6 μM, respectively. Nine combinations of the two primer concentrations were formed by cross-reaction. The reaction was carried out at 39℃ for 20 min to obtain the amplification curve.

[0039] Table 4 Optimization of RAA Reaction System

[0040] Table 5 Results of RAA primer-probe concentration combinations

[0041] Analysis of the detection results showed that the optimal primer-to-probe concentration ratio identified in this invention is 5:2, with the upper and lower primer concentrations for parainfluenza virus type 5 at 0.5 μM and the probe at 0.2 μM. The upper and lower primer concentrations for red panda hepatitis E virus were also 0.5 μM and the probe at 0.2 μM.

[0042] Example 4 Dual-fluorescent RAA reaction system, reagent kit, and detection method for red panda parainfluenza type 5 virus and hepatitis E virus. Based on the optimized primer and probe ratios above, the dual-fluorescent RAA reaction system for red panda parainfluenza type 5 virus and hepatitis E virus is shown in Table 6: Table 6 RAA Dual Fluorescence Detection Reaction System

[0043] The kit includes: reaction powder, buffer A, buffer B, upstream PIV5-F1, downstream PIV5-R1, PIV5-NP probes, upstream HEV-F1, downstream HEV-R3, HEV-P probes, and water. The primer and probe concentrations are all 10 μM. The reaction powder tubes, buffer A, and buffer B were purchased from Hangzhou Zhongce Biotechnology Co., Ltd., and are fluorescent amplification kits.

[0044] The specific operating steps are as follows: cDNA was prepared using total RNA from the sample as a template and reverse transcription reagent. The prepared cDNA was subjected to a RAA reaction using the kit described above at 39°C for 20 min to obtain an isothermal amplification curve. The FAM channel represents parainfluenza virus type 5 and the ROX channel represents red panda hepatitis E virus. Structural determination: Isothermal amplification results of positive control: a typical amplification curve appears and Ct≤30; isothermal amplification results of negative control: no amplification curve appears, or Ct>40; both positive and negative controls are valid results and are used as a reference to determine whether the sample to be tested contains parainfluenza virus type 5 and red panda hepatitis E virus. Test sample: A positive sample is judged to be positive if a typical amplification curve appears and the sample Ct < 35. If a typical amplification curve Ct ≤ 35 appears in the FAM channel or ROX channel, the sample contains parainfluenza virus type 5 or red panda hepatitis E virus. Negative: If Ct>35, or no amplification curve appears, the sample is judged as negative, that is, the sample to be tested does not contain parainfluenza virus type 5 or red panda hepatitis E virus or has not reached the detection threshold.

[0045] Example 5 Sensitivity, repeatability, and specificity validation of the dual-fluorescent RAA detection method for red panda parainfluenza virus type 5 and hepatitis E virus. 1. Method sensitivity verification: To investigate the sensitivity of the fluorescent RAA detection method, the concentration of the constructed positive plasmid was determined using a full-wavelength microplate reader (Thermo Fisher Scientific). The copy number was calculated according to the formula: Copy number (copies / μL) = [DNA concentration (ng / μL) / fragment size (bp)] × 9.12 × 10¹¹.

[0046] The positive plasmid was then serially diluted 10-fold to 10. 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 101 copies / μL, 10 0 The sensitivity of the fluorescent RAA detection method was determined by using positive plasmids of different dilutions as templates, with primers, probe concentrations and reaction conditions optimized in Example 4, and a negative control (sterile water) set up.

[0047] Depend on Figure 3 and Figure 4 As can be seen, both the FAM and ROX channels exhibit obvious amplification curves at a concentration as low as 10 copies / μL. Therefore, the detection method provided by this invention has a limit of detection of 10 copies / μL for both red panda parainfluenza virus type 5 and hepatitis E virus.

[0048] 2. Method specificity verification: To investigate whether the fluorescent RAA detection method would cross-react with other pathogens, human hepatitis E ORF1 gene, porcine hepatitis E ORF1 gene, pangolin parainfluenza virus type 3 cDNA, human parainfluenza virus type 5 cDNA, and tiger parainfluenza virus type 5 cDNA were used as templates. H2O was used as a template as a negative control, and cDNA containing nucleic acid from clinical samples of red panda parainfluenza virus and red panda hepatitis E virus was used as a template as a positive control. The specificity of the fluorescent RAA detection method was evaluated.

[0049] The above-mentioned different templates were detected according to the fluorescent RAA detection method of the present invention.

[0050] The results are as follows Figure 5 As shown, from Figure 5 As can be seen, the cDNA of clinical samples containing the N gene of red panda parainfluenza virus type 5 and the ORF1 fragment of red panda hepatitis E virus both showed obvious amplification curves. The negative control and samples using human hepatitis E, swine hepatitis E, pangolin parainfluenza virus type 3, human parainfluenza virus type 5, and tiger parainfluenza virus type 5 as templates did not show curve characteristics.

[0051] The above results indicate that this detection method does not cross-react with other common pathogens, does not react nonspecifically with host RNA, and has high specificity.

[0052] 3. Method repetition and new verification: To investigate the repeatability of the fluorescent RAA detection method, the template concentration was set to 10. 4 copies / μL, three replicates were performed in parallel, and the results are as follows: Figure 6 As shown, in 10 4 Typical amplification curves were observed at all copies / μL concentrations, demonstrating good reproducibility.

[0053] In summary, the dual-fluorescent RAA detection method for red panda parainfluenza virus type 5 and hepatitis E virus provided by this invention can specifically detect red panda parainfluenza virus type 5 and hepatitis E virus from a variety of pathogens. The detection limit for both viruses is 10 copies / μL, with good repeatability and detection can be completed in 20 minutes. It has good promotional value and application prospects, and can also provide effective technical support for the rapid detection and screening of red panda parainfluenza virus type 5 and hepatitis E virus, as well as the early warning and comprehensive prevention and control of diseases caused by these two viruses.

[0054] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0055] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A primer set, probe for small panda-derived hepatitis E virus and parainfluenza type 5 virus, characterized in that, The primer set includes hepatitis forward primers, hepatitis reverse primers, parainfluenza forward primers, and parainfluenza reverse primers; The sequences of the parainfluenza forward primer and the parainfluenza reverse primer are shown as PIV5-F1 and PIV5-R1, respectively: PIV5-F1: GATCGATGGCTTTGGGGAGGGATCATTCCGCT (SEQ ID NO. 1); PIV5-R1: TTCCCTTTCGGATCAATTCTGGATTATTCTT (SEQ ID NO. 2); The sequence of the parainfluenza probe is shown in PIV5-NP: PIV5-NP: TGCTTCTATTGAGAAACGCCTGCAAAAGTATCGTCAGCAAGGCAGGA (SEQ ID NO.7); The sequences of the hepatitis forward primer and the hepatitis reverse primer are shown in HEV-F1 and HEV-R3, respectively. HEV-F1: TCTGGTGATATTAATACGTCTGTAGTTGCT (SEQ ID NO.8); HEV-R3: TAGGCGAACCAAGGCCCGGCGCCGCCGTCAA (SEQ ID NO. 13); The sequence of the hepatitis probe is shown in HEV-P: HEV-P: GGATCCCCCCGTACAAGCTCAGCCCCCAACTTCCAGTCAGGCGGTGCC (SEQ ID NO. 14).

2. The primer set and probe according to claim 1, characterized in that, The parainfluenza probe has a fluorescent group labeled at position 29, a tetrahydrofuran labeled at position 31, and a fluorescence quencher labeled at position 34.

3. The primer set and probe according to claim 1, characterized in that, The hepatitis probe has a fluorescent group labeled at position 31, a tetrahydrofuran labeled at position 33, and a fluorescence quencher labeled at position 34.

4. The primer set or probe according to any one of claims 1-3, characterized in that, The hepatitis forward primer and hepatitis reverse primer are used to amplify the target sequence of hepatitis E virus from red pandas, and the parainfluenza forward primer and parainfluenza reverse primer are used to amplify the target sequence of hepatitis E virus from red pandas. The target sequence of the red panda-derived parainfluenza type 4 virus is shown in SEQ ID NO. 15, and the target sequence of the red panda-derived hepatitis E virus is shown in SEQ ID NO.

16.

5. The use of the primer set or probe according to any one of claims 1-4 in the preparation of a kit for red panda-derived hepatitis E virus and parainfluenza type 5 virus.

6. A kit for hepatitis E virus and parainfluenza type 5 virus derived from red pandas, characterized in that... The kit includes the primer set and probe as described in any one of claims 1-4.

Images