Stat1 inhibitors for the treatment of graft remodeling

Abstract

The application discloses application of STAT1 inhibitors and detection preparations and a construction method of a vascular graft remodeling model, and belongs to the technical field of graft vascular remodeling treatment and diagnosis. The application proposes that STAT1 is used as a target point for preventing, treating and / or relieving graft vascular remodeling and related diseases, and STAT1 is used as a biomarker for diagnosing graft vascular remodeling, thereby providing a new idea for preventing, treating and / or relieving graft vascular remodeling and related diseases.

Description

Technical Field

[0001] This invention belongs to the field of transplant vascular remodeling treatment and diagnosis technology, and relates to the application of inhibitors and detection agents of Signal Transducer and Activator of Transcription 1 (STAT1) and its encoding gene in the treatment and diagnosis of transplant vascular remodeling and related diseases, as well as the construction of related models. Background Technology

[0002] Transplant vascular remodeling is the structural remodeling of the graft caused by chronic vascular inflammation after organ transplantation or vascular bypass surgery. Its pathogenesis involves immune cell infiltration, abnormal proliferation of smooth muscle cells, abnormal changes in extracellular matrix components, and intimal neoplasia, leading to long-term luminal stenosis or occlusion, abnormal vascular function, and functional failure of the transplanted organ.

[0003] Currently, the diagnosis and assessment of transplant vascular remodeling are mainly based on imaging techniques. For example, contrast-enhanced ultrasound is the preferred non-invasive tool for assessing blood perfusion after renal artery reconstruction. During the remodeling process, progressive thickening of the vessel wall and progressive narrowing of the lumen can be observed. In addition, color Doppler ultrasound, enhanced CT, and venography can detect stenosis or thrombosis at the hepatic vein anastomosis after liver transplantation, confirming obstruction of the hepatic vein outflow tract. However, these methods can only identify mid-to-late-stage transplant vascular remodeling where the vessel wall has become severely thickened and the lumen has become severely narrowed. They lack early sensitivity, which is not conducive to early identification and early intervention of transplant vascular remodeling. The main treatment strategies for transplant vascular remodeling currently include surgery, immune intervention, and the application of regenerative medicine technologies. However, surgical vascular reconstruction methods have limitations such as limited autologous blood vessel sources and susceptibility to infection and thrombosis in artificial blood vessels. Traditional immune interventions, which use immunosuppressants and cytotoxic drugs to suppress the rejection reaction of transplant recipients to donor organs and their blood vessels, face challenges such as poor targeted specificity, significant toxic side effects, and a persistently high long-term incidence of vascular remodeling. Regenerative medicine uses tissue-engineered blood vessels and other methods to reconstruct artificial blood vessel stents, but this is hampered by high costs, a lack of unified quality control standards, and rapid degradation of biomaterials. Therefore, identifying new targets that specifically target key aspects of transplant immunology, alleviate transplant rejection, construct new early auxiliary diagnostic biomarkers, and develop targeted emerging drugs are beneficial in avoiding the limitations of surgery, the poor specificity and strong toxic side effects of traditional immune interventions, and the high cost and immaturity of regenerative medicine.

[0004] Several genes have been reported as potential targets for vascular remodeling. For example, patent application CN120142655A discloses the use of the ALOX15B gene as a target in screening drugs for treating pulmonary vascular remodeling and pulmonary hypertension; patent application CN119345368A discloses the application of methylenetetrahydrofolate dehydrogenase 2 and its encoding gene in vascular remodeling, and so on. However, these target genes are not specifically targeted at transplant vascular remodeling, and no target molecules specifically for the treatment and diagnosis of transplant vascular remodeling have yet been identified. The pathophysiological changes in conventional vascular remodeling are mainly due to mechanical and metabolic stress, and the lesions are relatively localized, with a progression rate often ranging from several years to decades. In contrast, transplant vascular remodeling is centered on immune microenvironment dysregulation, with the presence of specific immune structures (tertiary lymphoid tissue), resulting in diffuse lesions and a significantly accelerated progression rate; for example, 50% of heart transplant recipients develop the disease within 10 years. Furthermore, while basic treatments controlling vascular disease risk factors, such as antihypertensive, lipid-lowering, and antiplatelet therapies, are significantly effective for general vascular remodeling, their improvement on transplanted vascular remodeling is limited. Therefore, developing novel diagnostic and therapeutic methods specifically targeting transplanted vascular remodeling has become an important topic in basic research and translational invention in this field.

[0005] Signal transducer and activator of transcription (STAT) is a family of proteins with dual functions of signal transduction and gene transcription regulation. They transmit extracellular signals to the cell nucleus via the JAK-STAT signaling pathway, activating target gene expression and regulating physiological processes such as cell proliferation, differentiation, and immune responses. STAT1, the first member of the STAT family to be discovered, plays a core role in antiviral immunity by participating in the activation of the interferon (IFN) signaling pathway. IFN binds to cell membrane receptors, activating JAK kinase, which catalyzes STAT1 phosphorylation. Phosphorylated STAT1 molecules bind to each other to form homodimers or to STAT2 and interferon regulatory factor 9 (IRF9) to form heterotrimers. These dimers or trimers are transported to the cell nucleus, where they bind to corresponding regulatory elements to activate the transcription of downstream interferon genes, thus exerting an antiviral effect. In addition, STAT1 also participates in immune polarization and tumor suppression. Existing research has confirmed that sustained activation of STAT1 is involved in the progression of autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus. Some studies have suggested that STAT1 plays a role in angiogenesis, but angiogenesis mainly involves physiological processes such as activation, budding, lumen formation, and initial connection, primarily driven by hypoxia and growth factors, providing the body with an initial, coarse vascular network, which differs significantly from vascular remodeling. Vascular remodeling, without significantly increasing the number of vessels, reshapes the structure, function, and cellular composition of blood vessels, involving stimulation by hemodynamic, mechanical, and inflammatory signals, and its mechanisms are particularly complex under pathological conditions such as vascular diseases. Currently, there are no reports on the role of STAT1 in transplanted vascular remodeling.

[0006] Tertiary lymphoid organs (TLOs), also known as tertiary lymphoid tissues or tertiary lymphoid structures, are extra-lymphoid structures that form within lymphoid organs. Essentially, they are aggregates of immune cells induced by chronic inflammation. As local immune hubs, TLOs can enhance immune responses and exacerbate the progression of inflammatory diseases; for example, TLOs have been reported to accelerate renal fibrosis and renal failure in patients with chronic kidney disease. The structure of TLOs is similar to that of secondary lymphoid organs, consisting of T cells, B cell regions, germinal centers, venules, and lymphatic vessels. Non-immune cells in TLOs, namely stromal cells, play a crucial role in maintaining TLO structure and function. Fibroblastic reticular cells (FRCs) are the main members of TLO stromal cells. They maintain TLO structure and function by secreting chemokines such as CXCL13, CCL19, and CCL21 and by constructing a ductal scaffold to recruit and support immune cells. Therefore, reducing FRC formation or inhibiting their function may limit the progression of chronic inflammatory diseases by reducing TLO formation.

[0007] FRC cells differentiate from embryonic mesenchymal stem cells or adult tissue progenitor cells (such as angiogenic fibroblast progenitor cells), and the signaling pathways mediating their differentiation are diverse. Related studies have shown that lymphotoxin (LT) signaling, receptor activator of nuclear factor kappa B ligand (RANKL) signaling, and interleukin 7 (IL-7) signaling promote embryonic lymph node development by dominating the differentiation and maturation of mesenchymal lymphoid Tisse Organizer Cells (mLTo Cells) into FRC cells. Previous research by the applicant's team found that transplanted vascular remodeling is accompanied by significant TLO formation, and inhibiting TLO formation can improve transplanted vascular remodeling by alleviating post-transplant chronic inflammation. However, the relationship between interferon signaling pathways and STAT1 with TLO formation, transplanted vascular remodeling, and the differentiation and development of FRC cells within TLO remains unclear. Summary of the Invention

[0008] The primary objective of this invention is to provide applications of STAT1 inhibitors, specifically including the use of these STAT1 inhibitors in the preparation of products for the prevention and / or treatment of transplant vascular remodeling and / or transplant vascular remodeling-related diseases. Organ transplantation is an effective treatment for end-stage organ failure, but transplant vascular remodeling caused by chronic immune rejection is a major limiting factor for the long-term survival of organ transplant patients. The recruitment of immune cells and stromal cells to form transplant vascular remodeling loci (TLOs) is a key characteristic of the occurrence and development of transplant vascular remodeling; TLOs release pro-inflammatory and pro-fibrotic factors, activating vascular smooth muscle cell proliferation and promoting collagen deposition, thus accelerating transplant vascular remodeling; FRC cells play an important role in the formation and functional maintenance of TLOs. Therefore, discovering and identifying key targets regulating FRC differentiation and development, and inhibiting TLO formation, is of great significance for improving transplant vascular remodeling and reducing the incidence of post-transplant organ failure and remodeling.

[0009] This invention reveals that the interferon signaling pathway and STAT1 are significantly activated in the FRC cell population of transplanted blood vessels. In vitro studies showed that STAT1 was significantly upregulated during the differentiation of mouse embryonic fibroblast cell line (NIH3T3 cell line) into FRCs; inhibiting STAT1 activation or downregulating STAT1 expression significantly suppressed FRC cell differentiation. In vivo studies showed that STAT1 inhibitors significantly reduced TLO formation in allogeneic transplanted blood vessels, alleviated intimal neoplasia in remodeled vessels, and decreased the intima / media ratio. The study demonstrates that inhibiting STAT1 can effectively improve transplanted vascular remodeling by hindering FRC differentiation and development and TLO formation.

[0010] The STAT1 inhibitor is selected from one or more of the following:

[0011] 1) Antibodies against STAT1 or their antigen-binding fragments;

[0012] 2) Small interfering RNAs, dsRNAs, microRNAs, or antisense nucleic acids that target STAT1 or its transcripts and can inhibit STAT1 expression or gene transcription;

[0013] 3) Small molecule inhibitors based on the STAT1 structure;

[0014] 4) STAT1 gene knockout agents.

[0015] Furthermore,

[0016] The small interfering RNA sequences are shown in SEQ ID NO.15 and NO.16; the small molecule compound inhibitors based on the STAT1 structure include Fludarabine. The STAT1 gene knockout formulations include a CRISPR-Cas9 gene editing vector containing gRNA-A1 and gRNA-A2 as shown in SEQ ID NO.17 and NO.18.

[0017] The active ingredient is a STAT1 inhibitor, and it also contains pharmaceutically acceptable excipients.

[0018] The transplant vascular remodeling includes vascular remodeling related to transplantation and related diseases; specifically, it includes transplant vascular lesions selected from allogeneic transplantation, transplant rejection, or any combination thereof.

[0019] A second object of the present invention is to provide the application of a reagent for detecting STAT1, wherein the reagent for detecting STAT1 is used to prepare diagnostic agents for transplanted vascular remodeling diseases.

[0020] The reagents for detecting STAT1 are reagents for detecting the expression level and / or protein expression level of STAT1 and / or reagents for detecting the mRNA expression level of the STAT1 encoding gene.

[0021] Reagents for detecting STAT1 expression levels include: primers that specifically amplify STAT1 and probes that specifically recognize STAT1; reagents for detecting STAT1 protein expression levels include: STAT1 protein antibodies, aptamers that can bind to STAT1 protein, or STAT1 protein dyes.

[0022] Furthermore,

[0023] The reagents for detecting STAT1 include those that can be detected by PCR, flow cytometry, enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, Western blotting, high performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SPR), immuno-PCR, or biotin-avidin assay.

[0024] The third objective of this invention is to provide a method for constructing a vascular remodeling model, specifically a STAT1 gene knockout mouse vascular remodeling model constructed using a STAT1 gene knockout agent. This model is used to study the pathological mechanisms of vascular remodeling.

[0025] Specific Stat1 CKO The steps and key sequences for constructing knockout mice are as follows:

[0026] 1. gRNA preparation

[0027] Design and synthesize gRNA-A1 and gRNA-A2.

[0028] 2. Preparation of the fertilized egg:

[0029] Fertilized eggs were collected from the oviducts of C57BL / 6 female mice and placed in a 37℃ constant temperature 5% CO2 incubator for later use.

[0030] 3. Pronuclear microinjection:

[0031] gRNA injection solution was injected into the nucleus of the fertilized egg cell via microinjection.

[0032] 4. Preparation of surrogate mice and embryo transfer:

[0033] 4-1. The fertilized eggs that have been injected with the foreign gene were transferred into the oviduct of the surrogate mother mouse;

[0034] 4-2. The female mouse gave birth, and PCR identification was performed at the same time to screen out positive offspring F0.

[0035] 5. Succession and Lineage Establishment

[0036] 5-1. Positive mice F0 were mated with non-transgenic mice, passaged, and identified to obtain the F1 generation Stat1. flox Heterozygous mice,

[0037] 5-2. The above Stat1 flox Heterozygous mice were raised to sexual maturity and then mated with their siblings. The resulting F2 mice had a 25% chance of being homozygous, i.e., Stat1. flox / flox Homozygous mice were used to further construct Stat1. CKO Mice;

[0038] 5-3. Stat1 flox / flox Homozygous mice were raised to sexual maturity and then bred with Col1a2-CreER tool mice (i.e., fibroblast-specific tamoxifen-induced Cre recombinase tool mice) to obtain Stat1. CKO Heterozygous mice;

[0039] 5-4. The above Stat1 CKO Heterozygous mice were raised to sexual maturity and then subjected to the above-mentioned Stat1. flox / flox homozygous mice and Stat1 CKO Heterozygous mice were crossbred in an in vitro fertilization (IVF) facility to propagate the Stat1 strain. CKO Homozygous mice.

[0040] 6. Tamoxifen-induced

[0041] Stat1 induction was initiated with intraperitoneal injection of tamoxifen approximately two weeks prior to transplantation. CKO Stat1-specific knockout in fibroblast progenitor cells of homozygous mice.

[0042] The signal transduction and transcription activator 1 (STAT1) described in this invention is human STAT1, whose amino acid sequence has the NCBI accession number NP_001371809.1, or an amino acid sequence that has at least 80% sequence identity with it and has signal transduction and transcription activator 1 activity, or an amino acid sequence that has one or more amino acid substitutions (e.g., conserved substitutions), deletions or insertions, or any combination thereof and has signal transduction and transcription activator 1 activity.

[0043] In some implementations, STAT1 is mouse STAT1, whose amino acid sequence has the NCBI accession number NP_001192242.1, or an amino acid sequence that has at least 80% sequence identity with it and has signal transduction and transcription activator 1 activity, or an amino acid sequence that has one or more amino acid substitutions (e.g., conserved substitutions), deletions or insertions, or any combination thereof and has signal transduction and transcription activator 1 activity.

[0044] In some embodiments, in any of the above-described applications, the STAT1 protein-encoding gene includes a DNA sequence encoding the STAT1 protein, a pre-mRNA sequence transcribed from the DNA encoding the STAT1 protein (including genomic DNA with introns and exons), and an mRNA sequence encoding the STAT1 protein.

[0045] In some embodiments, the STAT1 mRNA is human STAT1 mRNA with the NCBI accession number NM_001384880.1, or a nucleic acid molecule that has at least 80% sequence identity with it and encodes any of the STAT1 proteins described above.

[0046] In some embodiments, the STAT1 mRNA is mouse STAT1 mRNA with NCBI accession number NM_001205313.1, or a nucleic acid molecule that has at least 80% sequence identity with it and encodes any of the STAT1 proteins described above.

[0047] In some embodiments, in any of the above-described applications, the STAT1 inhibitor is selected from one or more of the following: antibodies against STAT1 or their antigen-binding fragments, nucleic acids (e.g., SEQ NO.15 & NO.16: STAT1 siRNA), and small molecule compounds (e.g., the STAT1 inhibitor fludarabine); wherein the nucleic acid is a small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or gene editing vector (e.g., CRISPR-Cas9 gene editing vector or TALEN gene editing vector) that targets STAT1 or its transcript and is capable of inhibiting STAT1 expression or gene transcription; the small molecule compound can be a small molecule inhibitor based on the STAT1 structure or similar to the structure of existing STAT1 inhibitors.

[0048] In some implementations, in any of the above-described applications, the transplant vascular remodeling is vascular remodeling related to the transplant and its associated diseases or conditions;

[0049] The disease or condition is selected from transplant vascular lesions, transplant rejection, and any combination thereof after allogeneic transplantation.

[0050] This invention provides the following applications of signal transduction and transcription activating factor 1 and its encoding gene as biomarkers or targets, and / or reagents for detecting said signal transduction and transcription activating factor 1 and its encoding gene:

[0051] i. Application in screening for transplant vascular remodeling and / or diseases related to transplant vascular remodeling or in the preparation of products for screening for transplant vascular remodeling and / or diseases related to transplant vascular remodeling;

[0052] ii. Use in assessing transplant vascular remodeling and / or diseases associated with transplant vascular remodeling, or in the preparation of products for assessing transplant vascular remodeling and / or diseases associated with transplant vascular remodeling;

[0053] iii. Application in the preparation of products for diagnosing transplant vascular remodeling and / or diseases related to transplant vascular remodeling;

[0054] iv. Use in screening and / or preparing products for the prevention, treatment and / or relief of transplant vascular remodeling and / or diseases related to transplant vascular remodeling;

[0055] v. Use in monitoring the course of transplant vascular remodeling and / or diseases associated with transplant vascular remodeling, or in the preparation of products for monitoring the course of transplant vascular remodeling and / or diseases associated with transplant vascular remodeling;

[0056] vi. Application in analyzing the prognosis of transplant vascular remodeling and / or diseases related to transplant vascular remodeling, or in preparing products for analyzing the prognosis of transplant vascular remodeling and / or diseases related to transplant vascular remodeling;

[0057] vii. Application in inhibiting the differentiation of angiogenic fibroblast progenitor cells into FRC cells and / or the formation of tertiary vascular lymphoid tissue, or in the preparation of products that inhibit the differentiation of angiogenic fibroblast progenitor cells into FRC cells and / or the formation of tertiary vascular lymphoid tissue.

[0058] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0059] This invention identifies STAT1 (signal transduction and transcription activator 1), a potential therapeutic target for transplant vascular remodeling and various cardiovascular diseases. The inventors found that STAT1 is significantly activated during the differentiation of fibroblasts (FRC cells) in remodeled vessels, which is associated with the formation of tertiary lymphoid tissue (TLO) aggregates in the perivascular region and its inflammatory activation. In vivo studies have shown that STAT1 inhibitors can significantly reduce TLO formation in remodeled vessels and effectively alleviate transplant vascular lesions. This invention proposes using STAT1 as a biomarker to assess the progression of transplant vascular remodeling and related diseases (especially organ transplant rejection), or as a target for the prevention, treatment, and / or alleviation of transplant vascular remodeling and related diseases (especially organ transplant rejection). A STAT1 gene knockout mouse model of vascular remodeling was also constructed using a STAT1 gene knockout agent to study the pathological mechanisms of vascular remodeling. This invention provides a new approach for the prevention, treatment, and / or alleviation of transplant vascular remodeling and / or related diseases. Attached Figure Description

[0060] Figure 1 Results of FRC differentiation and development in transplanted blood vessels accompanied by STAT1 activation

[0061] Figure 1 Figure A shows the statistical analysis of the activation levels of signaling pathways in various fibroblast subsets [Fibrinoblast progenitor, Fibroblast, and Fibroblast reticulum (FRC)] obtained from single-cell sequencing in allogeneic transplanted blood vessels; Figure B shows the statistical analysis of the mRNA levels of key regulatory elements of the interferon signaling pathway in various fibroblast subsets, namely Stat1, Stat2, Irf1, and Irf9; Figure C shows the statistical analysis of the relative mRNA expression levels of Stat1, Stat2, Irf1, and Irf9 in the NIH3T3 cell line under in vitro IFNβ intervention; Figure D shows the Western blot and relative protein expression levels of phosphorylated Stat1 (p-Stat1) and Stat1 protein at different time points in the NIH3T3 cell line under in vitro IFNβ intervention.

[0062] Figure 2Inhibiting STAT1 activity or downregulating STAT1 expression inhibits FRC differentiation results.

[0063] Figure 2 In the diagram, Figures A, B, and C show the following data: Western blot images of p-Stat1 and Stat1 protein expression levels in the NIH3T3 cell line under combined intervention with IFNβ and the Stat1 inhibitor Fludarabine (Flu), respectively; statistical analysis of the relative mRNA expression levels of Cxcl13 and Stat1 in the NIH3T3 cell line (Figure B); immunofluorescence representation of Pdpn and Cxcl13 protein expression levels; and statistical analysis of the proportion of Pdpn+Cxcl13+ FRC in the NIH3T3 cell line (Figure C). Figures D, E, and F show the following data: Western blot images of p-Stat1 and Stat1 protein expression levels in the NIH3T3 cell line under combined intervention with IFNβ and siRNA (negative controls NC and SiStat1), respectively; statistical analysis of the relative mRNA expression levels of Cxcl13 and Stat1 in the NIH3T3 cell line (Figure E); immunofluorescence representation of Pdpn and Cxcl13 protein expression levels; and statistical analysis of the proportion of Pdpn+Cxcl13+ FRC in the NIH3T3 cell line (Figure F).

[0064] Figure 3 Inhibiting STAT1 reduces TLO formation in transplanted vessels.

[0065] Figure 3 In the image, Figures A and B show the immunofluorescence representations of transplanted blood vessels at week 4 after allogeneic vascular transplantation in the control group (Vehicle) and the inhibitor group (Flu), respectively (Figure A) and the number of TLO cells ( / vessel) and the number of FRC cells per unit area [Pdpn+Cxcl13+ FRC cells ( / mm²)]. 2 )]Statistical analysis chart (Chart B); Charts C and D are the control group mice (Stat1) flox / flox Stat1-specific knockout mice (mice) and Fibroblast progenitor cells (Stat1) CKO (Mouse) Immunofluorescence representation of transplanted blood vessels at week 4 after allogeneic vascular transplantation (Figure C), and the number of TLO cells ( / vessel) and the number of FRC cells per unit area [Pdpn+Cxcl13+ FRC cells ( / mm²)]. 2 Statistical analysis chart (D chart).

[0066] Figure 4 Inhibiting STAT1 improves transplant vascular remodeling outcomes

[0067] Figure 4 In the image, Figure A and Figure B show representative H&E staining of transplanted blood vessels at week 4 after allogeneic vascular transplantation in mice of the control group (Vehicle) and the inhibitor group (Flu), respectively (Figure A) and the neointimal area (102). 4 um2 Figure B shows the statistical analysis of the intima / media thickness ratio; Figures C and D show the control group mice (Stat1) respectively. flox / flox Stat1-specific knockout mice (mice) and Fibroblast progenitor cells (Stat1) CKO Mouse) Allogeneic blood vessel transplantation, week 4: Representative H&E staining of transplanted blood vessels (Figure C) and neointimal area (10) 4 um 2 ), Statistical analysis chart of intima / media thickness ratio (Chart D). Detailed Implementation

[0068] The present disclosure will be further described below with reference to specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the present disclosure. However, the present disclosure can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present disclosure. Therefore, the present disclosure is not limited to the specific embodiments disclosed below.

[0069] By establishing a mouse allogeneic vascular transplantation model and performing single-cell transcriptome sequencing and analysis, it was found that key signal transduction and transcription activating factor 1 was significantly upregulated during the differentiation of angiogenic fibroblast progenitor cells into FRC cells, with STAT1 being the most significant.

[0070] Furthermore, in vitro studies have found that inhibiting STAT1 activity or downregulating STAT1 expression can suppress the differentiation of fibroblast progenitor cells into FRC cells.

[0071] Further in vivo studies revealed that by injecting the STAT1 inhibitor fludarabine into a mouse allogeneic vascular transplantation model and detecting tertiary lymph node formation, the STAT1 inhibitor significantly inhibited the formation of tertiary lymphoid tissue in the blood vessels. Subsequently, staining of vascular samples showed that STAT1 inhibition slowed allogeneic transplantation-induced vascular remodeling, reduced intimal neoplasia, and decreased the intima-to-media ratio, thus alleviating transplanted vascular lesions. Furthermore, allogeneic transplantation in Fibroblast-progenitor Stat1-specific knockout mice significantly reduced tertiary lymphoid tissue formation and vascular remodeling.

[0072] Experimental materials:

[0073] 1. Laboratory animals, reagents, and their catalog numbers:

[0074] C57BL / 6J (wild type, WT) strain male mice were purchased from Hunan Slack Jingda Company;

[0075] BALB / c (wild type, WT) mice were purchased from Hunan Slack Jingda Company.

[0076] Fibroblast progenitor cells Stat1-flox / flox (Stat1 flox / flox Mice were purchased from Cyagen (Suzhou) Co., Ltd.

[0077] Stat1-Conditional Knockout in Fibroblast Progenitor Cells CKO Mice were purchased from Cyagen (Suzhou) Co., Ltd.

[0078] Isoflurane, purchased from Reward, product number: R510-22-10;

[0079] 75% alcohol, purchased from Lierkang, product number: 43385;

[0080] Heparin, purchased from Nanjing Xinbai Pharmaceutical Co., Ltd., drug production approval number: H32025851;

[0081] Physiological saline was purchased from Shandong Qidu Pharmaceutical Co., Ltd., with drug production approval number: H20113297.

[0082] Fetal bovine serum (FBS), purchased from Oricell, catalog number: FBSAD-01011;

[0083] DMEM medium, purchased from Gibco, catalog number: C11995500BT;

[0084] Papain, purchased from Sigma-Aldrich, catalog number: P4762;

[0085] Phosphate-buffered saline (PBS), purchased from Biosharp, catalog number: BL302A;

[0086] Treasure Blue, purchased from Weil, item number: WB0010;

[0087] The NIH3T3 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, catalog number: SCSP-515.

[0088] 1% penicillin-streptomycin (P / S), purchased from Coolaber, catalog number: 15140122;

[0089] Calf serum (CS), purchased from CellBox, catalog number: CC-01E-02;

[0090] 0.25% EDTA-trypsin, purchased from Gibco, catalog number: 25200056;

[0091] Fludarabine (Flu), purchased from MedChemExpress, product number: HY-B0069;

[0092] Interferon beta, purchased from MedChemExpress, product number: HY-P73130;

[0093] Lipofectamine 3000, purchased from Thermo Fisher Scientific, product number: L3000-015;

[0094] Trizol, purchased from Adelaide, item number: RN0102;

[0095] Chloroform, purchased from Adelaide, product number: RN6602;

[0096] Isopropanol, purchased from Sinopharm Group, product number: 80109218;

[0097] Anhydrous ethanol, purchased from Sinopharm Group, product number: 10009218;

[0098] RNA nuclease-free water (nuclease-free water), purchased from Beyotime, product number: R0021;

[0099] All-in-One First-Strand Synthesis Master Mix Reverse Transcription Kit, purchased from Yugong, catalog number: EG15133S;

[0100] F488 SYBR qPCR Mix, purchased from Yugong, product number: EG23111L;

[0101] RIPA protein lysis buffer, purchased from Biosharp, catalog number: BL625A;

[0102] BCA protein standards and protein quantification kits were purchased from Yamei, catalog number: ZJ102;

[0103] Protease inhibitor, purchased from Kangwei, product number: CW2200S;

[0104] 1.5M Tris·HCl (pH 8.8), purchased from Changsha Weishier, item number: 01E210913;

[0105] 1.0M Tris·HCl (pH 6.8), purchased from Changsha Weishier, product number: WB02009A;

[0106] Sodium Dodecyl Sulfate (SDS), purchased from VETEC, product number: WXBC7812V;

[0107] Glycine, purchased from VETEC, item number: WXBD5703V;

[0108] Tris hydrochloric acid (powder), purchased from VETEC, product number: WXBC9891V;

[0109] TEMED, purchased from VETEC, item number: V900853;

[0110] APS, purchased from Weir, item number: WB7018A;

[0111] 30% acrylamide, purchased from Changsha Weishier, item number: 01D210902;

[0112] Methanol, purchased from Aladdin, product number: M116115-1L;

[0113] Protein loading buffer, purchased from Yamei, catalog number: LT101;

[0114] Electrophoresis indicator (Marker), purchased from Thermo Fisher Scientific, item number: 26616;

[0115] Tween-20, purchased from Sinopharm Group, product number: 30189328;

[0116] p-STAT1 antibody, purchased from Abcam, catalog number: ab109461;

[0117] STAT1 antibody, purchased from Huaan, catalog number: ET1612-22;

[0118] GAPDH antibody, purchased from Wuhan Sanying, catalog number: 10494-1-AP;

[0119] HRP conjugated with goat anti-rabbit polyclonal antibody, purchased from Huaan, product number: HA1001;

[0120] Antibody diluent, purchased from Abbkine, catalog number: BMU103;

[0121] Enhanced Chemiluminescence (ECL) luminescent liquid, purchased from Vibio, product number: K12045D50;

[0122] 4% paraformaldehyde fixative, purchased from Beyotime, product number: P0099;

[0123] Sucrose, purchased from Sinopharm Group, product number: 10021463;

[0124] OCT embedding agent, purchased from SAKURA, catalog number: 7684-00;

[0125] Triton 100, purchased from Changsha Weishier, item number: WB00009;

[0126] Anti-fluorescence quenching sealing solution, purchased from Beyotime, product number: P0126;

[0127] BSA, purchased from Changsha Weishier, item number: 738328;

[0128] BV421 fluorescent anti-mouse CD3 antibody, purchased from BioLegend, catalog number: 100227;

[0129] APC fluorescent anti-mouse / human CD45R / B220 antibody, purchased from BioLegend, catalog number: 103212;

[0130] Recombinant rat-derived anti-mouse PDPN antibody, purchased from Abcam, catalog number: ab256559;

[0131] Rabbit-derived anti-mouse / human CXCL13 antibody, purchased from Bioss, catalog number: bs-4509R;

[0132] Goat anti-rat 488 fluorescent antibody, purchased from Abcam, catalog number: ab150157;

[0133] Goat anti-rabbit Cy3 fluorescent antibody, purchased from Proteintech, catalog number: SA00009-2;

[0134] NaH2PO4, purchased from Sinopharm Group, product number: 20040718;

[0135] Na2HPO4, purchased from Sinopharm Group, product number: 10020318;

[0136] Xylene, purchased from Sinopharm Group, product number: 10023418;

[0137] Anhydrous ethanol, purchased from Sinopharm Group, product number: 10009218;

[0138] Hematoxylin staining solution, purchased from Servicebio, product number: G1004;

[0139] Eosin staining solution, purchased from Servicebio, product number: G1001;

[0140] Differentiation solution, purchased from Servicebio, catalog number: G1039;

[0141] Anti-blue solution, purchased from Servicebio, product number: G1040;

[0142] Neutral resin mounting medium, purchased from Coolaber, catalog number: CN7760.

[0143] 2. Experimental solutions and their preparation:

[0144] 5% BSA blocking solution: Dissolve 0.5g of BSA powder in 10mL of PBS buffer;

[0145] 0.2% Triton 100 permeabilization buffer: Add 200 μL of Triton 100 stock solution to PBS buffer and bring the volume to 100 mL;

[0146] 0.2 mol / L PB solution: Prepare solution A: a 0.2 mol / L NaH2PO4 solution. Weigh 31.2 g of NaH2PO4·2H2O and dissolve it in double-distilled water to a final volume of 1000 mL. Prepare solution B: a 0.2 mol / L Na2HPO4 solution. Weigh 71.632 g of Na2HPO4·12H2O and dissolve it in double-distilled water to a final volume of 1000 mL. Mix 19 mL of solution A and 81 mL of solution B thoroughly to obtain a 0.2 mol / L PB solution with a pH of 7.4.

[0147] 30% sucrose-PB dehydration solution: Weigh 15g of sucrose and add double-distilled water to bring the volume to 50mL.

[0148] 3. Short nucleotides used in the experiment and their sequences:

[0149] Primers: The primers for each gene consist of a forward (Fwd) column and a reverse (Reverse) column, purchased from Sangon Biotech, and include the following sequences:

[0150] SEQ NO.1: Actin-Fwd: GTGCTATGTTGCTCTAGACTTCG,

[0151] SEQ NO.2: Actin-Rev: ATGCCACAGGATTCCATACC;

[0152] SEQ NO.3: Stat1-Fwd: TCACAGTGGTTCGAGCTTCAG,

[0153] SEQ NO.4: Stat1-Rev: GCAAACGAGACATCATAGGCA;

[0154] SEQ NO.5: Stat2-Fwd: TCCTGCCAATGGACGTTCG,

[0155] SEQ NO.6: Stat2-Rev: GTCCCACTGGTTCAGTTGGT;

[0156] SEQ NO.7: Irf1-Fwd: ATGCCAATCACTCGAATGCG,

[0157] SEQ NO.8: Irf1-Rev: TTGTATCGGCCTGTGTGAATG;

[0158] SEQ NO.9: Irf9-Fwd: GAGCTCTTCAAGACCACCTACTT,

[0159] SEQ NO.10: Irf9-Rev: TAACAGGAACAAGGCAGCTTTCT;

[0160] SEQ NO.11: Cxcl13-Fwd: GGTGTTCTGGAGTGATTTCAACTG,

[0161] SEQ NO.12: Cxcl13-Rev:ATTTGGCACGAGGATTCACACAT;

[0162] siRNA: The siRNA of each gene contains a forward (Fwd) and a reverse (Reverse) column, purchased from Hanheng, and includes the following sequences:

[0163] SEQ NO.13: Negative Control SiRNA (NC)-Fwd: 5'-UUCUCCGAACGUGUCACGUTT-3', SEQ NO.14: Negative Control SiRNA (NC)-Rev: 5'-ACGUGACACGUUCGGAGAATT-3';

[0164] SEQ NO.15: Stat1 SiRNA (SiStat1)-Fwd: 5'-GCAUAGAGCAGGAAAUCAATT -3',

[0165] SEQ NO. 16: Stat1 SiRNA (SiStat1)-Rev: 5'-GCAUAGAGCAGGAAAUCAATT-3'.

[0166] Example 1: FRC differentiation and development in transplanted blood vessels accompanied by STAT1 activation

[0167] Experimental methods:

[0168] 1. Establishment of an allogeneic vascular transplantation animal model: Male C57BL / 6J (wild-type, WT) mice, BALB / c (wild-type, WT) mice, and fibroblast-specific Stat1 knockout (Stat1-Conditional Knock-out, Stat1-CKO) mice were housed in a specific pathogen-free (SPF) barrier system at the Central South University animal facility. The temperature and humidity of the housing were maintained within a suitable range for mouse survival. Mice were anesthetized using continuous isoflurane gas inhalation. After anesthesia, 6-8 week old BALB / c donor mice were fixed on a surgical board. A cotton ball soaked in 75% alcohol was applied to the mouse's abdomen using forceps. A midline abdominal incision was made in the donor mouse, the internal organs were moved to one side, the inferior vena cava was exposed, and heparin solution was injected into it. Use forceps to remove the fatty tissue covering the aorta; separate a suitable length of blood vessel from the aortic arch to the aortic bifurcation, irrigate until the lumen is free of blood, electrocoagulate, and cut with microscissors. Place the cleaned aortic segment into a culture dish containing heparin solution. Anesthetize and fix 6-8 week old C57BL / 6J recipient mice (or Stat1-CKO recipient mice), cut open the neck skin to expose the carotid artery, and carefully separate the tissue surrounding the carotid artery; ligate both ends of the carotid artery with silk sutures and cut it in the middle with scissors. Insert a nylon cannula onto the blood vessel and fix one end of the cannula with a hemostatic clamp. Cut the blood vessel close to the ligated end with scissors, making the incision clean; rinse the blood vessel with heparin to remove any remaining blood; clamp both ends of the blood vessel with fine microforceps, invert the blood vessel and place it onto the nylon cannula, and fix it with silk sutures. Take an appropriate length of donor aortic segment, first place the blood vessel onto the arterial cannula and ligate it with silk sutures, and finally remove the hemostatic clamp to restore blood supply.

[0169] 2. Vascular digestion and single-cell suspension preparation: Four weeks post-vascular transplantation, C57BL / 6J recipient mice were anesthetized with 1% sodium pentobarbital at 50 mg / kg. The mice were fixed, and the abdomen was cut open to expose the heart. A small incision was made in the right atrium, and physiological saline was perfused into the left ventricle until the liver turned white. The neck skin was cut open to expose the carotid artery. The tissue surrounding the carotid artery was carefully separated, and the aortic graft in the middle segment of the carotid artery was severed and placed in 10 mL of DMEM high-glucose medium containing 10% FBS. The aortic graft was observed under a stereomicroscope. The vessel was fixed with curved forceps, and the media and adventitia were separated using microforceps. The media and adventitia were placed separately in another clean culture dish containing 10% FBS in DMEM high-glucose medium. The vessel was fixed with microforceps, and the vessel was longitudinally cut open with microscissors and then transversely minced. The supernatant from the culture dish was transferred to a 50 mL centrifuge tube using a Pasteur pipette and placed on ice. Add 400 μL of 1 mg / mL papain to a culture dish containing shredded tissue pieces, ensuring the digestive solution covers the tissue. Place the dish in a shaker at 37°C and shake at 135 rpm for 10 min. Observe the digesting tissue under a microscope; grape-like cell clusters can be observed. Gently pipette several times, and transfer the supernatant from the culture dish to a 50 mL centrifuge tube using a Pasteur pipette. Continue adding 300 μL of papain to the culture dish, and repeat the above steps of "adding digestive enzyme, shaking in a constant temperature shaker, microscopic observation, collecting the digestive supernatant, and pipetting" for 5-6 rounds until the tissue is completely loosened and almost all cells are free. Filter the digestive solution through a 40 μm sieve, and rinse the sieve twice with 200 μL PBS. Centrifuge the collected cell suspension at 400 g / min for 5 min, discard the supernatant, and resuspend in an appropriate amount of PBS.

[0170] 3. Single-cell transcriptome sequencing: Cell viability in single-cell suspensions of vascular tissue was detected using trypan blue staining and counting, ensuring a viability range of 60%-90%. The single-cell suspensions were then submitted to Shanghai Ouyi Biomedical Technology Co., Ltd. for single-cell transcriptome library construction and sequencing following the 10x Genomics standardized protocol: single cells were captured using gel beads, and single-cell markers with specific barcodes and molecular identifiers were generated; 8000-10000 cells were captured, lysed, reverse transcribed, amplified, and purified using cDNA; the generated library was sequenced on the Illumina NovaSeq 6000 platform, with a sequencing depth of 30 M data per cell. The raw sequencing data was decomposed using Cell Ranger software to generate FASTQ files, and their contents were read and matched with the mouse reference genome mm10 to generate an expression matrix.

[0171] 4. Single-cell sequencing data quality control, cell clustering analysis, pathway enrichment analysis, and differentially expressed gene analysis: Based on the expression matrix, the following processing and analysis were performed using the R package Seurat: cells expressing more than 5000 genes were filtered to exclude non-cells or cell aggregates; cells with a mitochondrial gene percentage greater than 5% were filtered; logarithmic normalization and principal component analysis were performed for dimensionality reduction; cell clustering based on cell population function was performed using the FindClusters function; signal pathway enrichment analysis was performed using the R package ClusterProfiler; and differentially expressed genes (DEGs) between cell subpopulations were identified using the FindMakers function, with Bonferroni-corrected test p-values ​​less than 0.05 considered statistically significant.

[0172] 5. Cell culture, intervention, and collection: The NIH 3T3 cell line was cultured at 1.6 x 10⁻⁶ cells / mL. 5 / cm 2 -4.8x10 5 / cm 2 The cells were inoculated into T25 cell culture flasks and cultured at 37°C in a 5% CO2 incubator. The culture medium was DMEM complete medium containing 1% penicillin / streptomycin (P / S) and 10% fetal bovine serum (CS). The cells grew to a density of 4.8 x 10⁻⁶ cells every 2-3 days. 5 / cm 2 Afterwards, discard the culture medium, gently wash the cells 2-3 times with PBS, aspirate the supernatant, add 1 mL of 0.25% EDTA-trypsin, incubate at 37°C for 1 minute to de-adhere, add complete culture medium to stop digestion, gently pipette the cells in the culture flask and collect them in a 1.5 mL centrifuge tube, centrifuge at 1000 rpm for 5 minutes to collect the cell pellet, discard the supernatant after centrifugation, resuspend the cell pellet in complete culture medium, and seed again in T25 culture flasks at an appropriate density to complete passage culture. Use passages 8-10 for intervention experiments. First, collect cells by trypsin digestion and centrifugation, resuspend the pellet and count the cells at 3 x 10⁻⁶ cells / mL. 5Cells were seeded in 6-well plates and subjected to cell intervention 18-24 hours after cell adhesion the following day. Cell intervention groups included a control group (0h intervention group) and an interferon beta (IFNβ) intervention group. The IFNβ intervention concentration was 50 ng / mL, and intervention times were 2h, 6h, and 12h. After intervention, the supernatant was discarded, cells were washed twice with PBS, and the supernatant was aspirated. 300 μL of PBS was added to each well, and cells were scraped from the wells into the PBS using a cell scraper. The bottom of the wells was rinsed with a pipette, and the cell suspension was collected in a 1.5 mL centrifuge tube. The cells were centrifuged at 2000 rpm for 10 min at 4℃, the supernatant was discarded, and the cell pellet was stored at -80℃ for total RNA and total protein extraction.

[0173] 6. Total RNA extraction, reverse transcription, and quantitative polymerase chain reaction (qPCR) detection: Take the frozen cell pellets from the control group and the IFN-γ intervention group (6 h). Add 1 mL Trizol to each sample tube, mix well with a pipette, and place on ice. Add 0.2 mL chloroform, manually invert for 15 seconds, and incubate at room temperature for 10 minutes. Centrifuge at 12000g for 15 minutes at 4℃, separating the sample into three layers: upper RNA, middle protein, and lower chloroform. Transfer the upper RNA layer to a new small centrifuge tube. Add 0.5 mL isopropanol, manually invert for 15 seconds, and incubate on ice for 10 minutes. Centrifuge at 12000g for 10 minutes at 4℃, and discard the supernatant. Add 1 mL 75% ethanol, centrifuge at 12000g for 5 minutes at 4℃, discard the supernatant, and incubate at room temperature for 5-10 minutes. Dissolve in 10-20 μL of nuclease-free water. RNA concentration was measured and purity was assessed (absorbance at 260 nm (A260) / absorbance at 280 nm (A280) > 1.8 indicates high purity). The following reverse transcription reaction mixture was prepared on ice: template RNA 50 ng - 1 μg; All-in-One First-Strand Synthesis MasterMix 4 μL; dsDNase 1 μL; nuclease-free water to bring the total volume to 20 μL. The mixture was gently mixed and briefly centrifuged. The reaction mixture was then placed in a PCR instrument and the reverse transcription reaction was performed according to the following procedure: 37°C for 2 min; 55°C for 15 min; 85°C for 5 min. The obtained cDNA was placed on ice or immediately stored at -20°C for subsequent experiments. Prepare the following qPCR reaction system: 10-200 ng cDNA template; 10 μL F488 SYBR qPCR Mix; 0.4 μL forward primer (Fwd, 10 μM); 0.4 μL reverse primer (Rev, 10 μM); and bring the total volume to 20 μL with nuclease-free water. Place the prepared reaction system in a quantitative PCR instrument and perform the reaction and detection according to the following procedure:

[0174]

[0175] The threshold cycle number (Cq value) of the target gene (Cxcl13) obtained after detection is first subtracted from the Cq value of the internal reference gene (β-Actin) of the sample to obtain the ΔCq value; then the ΔCq value of the intervention group is subtracted from the ΔCq value of the control group to obtain the ΔΔCq value; the 2-ΔΔCq value is the relative expression level of the target gene in the intervention group compared with the control group.

[0176] 7. Total protein extraction and Western blot analysis:

[0177] (1) Total protein extraction: Add protease inhibitor and phosphatase inhibitor to the protein lysis buffer at a ratio of 1:100, shake well and place on ice. Take out the cell pellets collected after intervention for 0h, 6h, 24h and 48h, add 100ul of protein lysis buffer containing protease inhibitor and phosphatase inhibitor, mix well and lyse on ice for 20 min; centrifuge at 12000 rpm for 10 min at 4℃; transfer the obtained supernatant to a new small centrifuge tube and place on ice for later use.

[0178] (2) Protein concentration determination and sample preparation: Calculate the total number of standards and test samples. Prepare BCA working solution (A solution: B solution = 50:1) by adding 200 μL to each well. Add the standards and test samples to each well of the 96-well plate in sequence at a volume of 20 μL per well. Add 200 μL of the prepared working solution to each well and incubate the 96-well plate at 37℃ for 30 min. After incubation, measure the OD value at 562 nm wavelength in the ELISA reader. Plot a standard curve with the protein content of the standards as the x-axis and the OD value as the y-axis and obtain its regression equation. Substitute the OD value of the test sample into the equation to obtain its protein concentration. Calculate the loading volume at 20 μg per well. Then add loading buffer at a ratio of sample:loading buffer = 4:1, mix well, boil in water for 10 minutes, and place on ice for later use.

[0179] (3) Preparation of SDS-PAGE solution: Prepare the following solutions: 10% APS solution: 10g APS added to ultrapure water to make up to 100mL; 10% SDS solution: 10g SDS added to ultrapure water to make up to 100mL; PBST solution: PBS powder + 1mL Tween-20 solution added to pure water to make up to 1L; 5% skim milk blocking solution: 2.5g skim milk powder added to pure water to make up to 50mL; Electrophoresis solution: 3.03g Tris hydrochloric acid powder, 14.4g glycine, 1g SDS added to pure water to make up to 1L; Transfer solution: 3.03g Tris hydrochloric acid powder, 14.4g glycine added to water to make up to 800mL, then add 200mL methanol.

[0180] (4) SDS-PAGE gel preparation: Prepare 20 mL of 10% separating gel using the following formula: 7.9 mL ultrapure water, 6.7 mL 30% acrylamide, 5 mL Tris·HCl (pH=8.8), 0.2 mL 10% SDS, 0.2 mL 10% APS, and 8 μL TEMED. Gently shake to mix the solution evenly, and slowly pour it into the gap between the glass plates. Slowly add 1 mL of pure water on the surface of the liquid and let it stand for 40 min. Prepare 10 mL of stacking gel using the following formula: 6.8 mL ultrapure water, 1.7 mL 30% acrylamide, 1.25 mL Tris·HCl (pH=6.8), 0.1 mL 10% SDS, 0.1 mL 10% APS, and 10 μL TEMED. Absorb the water on top of the separating gel, slowly pour the stacking gel solution into it, insert a comb to remove air bubbles, and let it stand for 30 min before use.

[0181] (5) SDS-PAGE electrophoresis: Add electrophoresis indicator standard (Marker) and sample to be tested to each well in sequence; electrophoresis at 80V constant voltage for about 30 minutes, and change to 120V when the bromophenol blue dye front reaches the junction of the two gels; electrophoresis at constant voltage for about 1 hour, and stop electrophoresis when the bromophenol blue dye front reaches the end of the gel.

[0182] (6) SDS-PAGE transfer: After electrophoresis, remove the gel and place it in a wide dish containing transfer solution; soak the PVDF membrane in methanol for 2-3 minutes and then place it in the same wide dish; soak the sponge and filter paper in the wide dish. Make the "transfer sandwich" in the following order: positive electrode (white) - sponge - double filter paper - PVDF membrane - gel - double filter paper - sponge - negative electrode (black), and be careful to remove air bubbles; tighten the transfer plate, fill the electrophoresis tank with transfer solution, immerse the transfer plate in the electrophoresis tank, connect the power cord to the positive and negative electrodes, plug in the power supply, set the constant voltage to 90V and transfer the membrane in the ice-water mixture for 1.5 hours.

[0183] (7) Membrane blocking, antibody incubation, and development: After transfer, place the membrane in 5% skim milk blocking solution and shake on a shaker at room temperature for 1 hour. Dilute the primary antibody to the corresponding concentration using antibody diluent according to the corresponding antibody titer. After blocking, wash the blot membrane three times with PBST solution for 10 minutes each time, then place the membrane in a box containing an appropriate amount of primary antibody and shake on a shaker at 4°C overnight. The next day, recover the primary antibody and wash the blot membrane three times with PBST solution for 10 minutes each time. Dilute the secondary antibody to the corresponding concentration using 5% skim milk blocking solution according to the corresponding antibody titer. Place the washed blot membrane in the secondary antibody and shake on a shaker at room temperature for 1 hour. Discard the secondary antibody diluent and wash the blot membrane three times with PBST solution for 10 minutes each time. Prepare the ECL luminescent solution in a light-protected container at a volume ratio of A solution: B solution = 1:1. The membrane area: working solution volume = 10 cm² 2Apply 1 ml of ECL working solution to the membrane surface, let it stand for 1-2 minutes, and then observe and photograph the protein blot using a gel imaging system to obtain the protein blot image.

[0184] The experimental results of this embodiment are as follows: Figure 1 As shown.

[0185] Figure 1 Figure A shows the statistical analysis of the activation levels of signaling pathways in various fibroblast subpopulations [fibroblast progenitors, fibroblasts, and fibroblast reticulocytes (FRCs)] obtained from single-cell sequencing in allogeneic transplanted blood vessels; Figure B shows the statistical analysis of the mRNA levels of key regulatory elements of the interferon signaling pathway in various fibroblast subpopulations, namely Stat1, Stat2, Irf1, and Irf9; Figure C shows the statistical analysis of the relative mRNA expression levels of Stat1, Stat2, Irf1, and Irf9 in the NIH3T3 cell line under in vitro IFNβ intervention; Figure D shows the Western blot diagram and relative protein expression level statistical analysis of phosphorylated Stat1 (p-Stat1) (phosphorylated Stat1 / p-Stat1 is the active form of Stat1 protein, which can enter the nucleus to regulate the expression of downstream genes, so it is necessary to detect p-Stat1 to observe the activation of Stat1) and Stat1 protein expression levels at different time points in the NIH3T3 cell line under in vitro IFNβ intervention. Single-cell sequencing analysis showed that during the differentiation of angiogenic fibroblast progenitors into FRCs, both type I interferon (IFN I) and type II interferon (IFN II) signaling pathways were significantly activated, and the transcription of key regulatory molecules Stat1, Stat2, Irf1, and Irf9 was significantly upregulated. However, the classical tumor necrosis factor (TNF) and lymphotoxin (LT) pathways, which regulate FRC differentiation and development during the formation of secondary lymphoid structures in the embryonic period, did not show significant activation (Figures A and B). In vitro intervention results showed that under IFNβ intervention, the transcription of Stat1, Stat2, Irf1, and Irf9 genes was upregulated, with Stat1 showing the most significant upregulation (Figure C). The expression of p-STAT1 and STAT1 proteins was significantly upregulated, and a certain time gradient effect was observed (Figure D). The results suggest that the interferon signaling pathway is significantly activated during the differentiation and development of FRCs in allogeneic blood vessels, which is quite different from the activation pattern of the TNF / LT pathway during the development of traditional secondary lymphoid structures. The transcription and protein expression of the interferon pathway regulatory molecule Stat1 are significantly upregulated and its phosphorylation activity is enhanced. Stat1 may play an important regulatory role in the differentiation and development of FRCs during allogeneic vascular remodeling.

[0186] Example 2: Inhibiting STAT1 activity or downregulating STAT1 expression to suppress FRC differentiation

[0187] Experimental methods:

[0188] 1. Cellular intervention:

[0189] Inhibitor intervention: The experimental groups were divided into solvent control group (Flu-IFNβ-), IFNβ intervention group (Flu-IFNβ+), STAT1 inhibitor Fludarabine intervention group (Flu+IFNβ-), and Flu combined with IFNβ intervention group (Flu+IFNβ+). The intervention procedure was as follows: For the Flu+IFNβ- and Flu+IFNβ+ groups, complete culture medium containing Flu was added to each well of a 6-well plate containing cells, to a final concentration of 4 μM. For the Flu-IFNβ- and Flu-IFNβ+ groups, complete culture medium containing the same concentration of drug solvent DMSO as the Flu+IFNβ- and Flu+IFNβ+ groups was added. The 6-well plates were then placed back into an incubator at 37°C and 5% CO2 for incubation. After about 18 hours of intervention, the 6-well plates were removed, the supernatant was discarded, and each well was washed twice with PBS. The Flu-IFNβ+ and Flu+IFNβ+ groups were given complete culture medium containing IFNβ to bring the final IFNβ concentration to 50 ng / mL. The Flu-IFNβ- and Flu+IFNβ- groups were given the same volume of complete culture medium without IFNβ as the Flu-IFNβ+ and Flu+IFNβ+ groups. Samples were collected 6 h after intervention for subsequent experiments.

[0190] siRNA intervention: The experimental groups were: negative control group (NC+IFNβ- group), NC combined with IFNβ intervention group (NC+IFNβ+ group), SiStat1 intervention group (SiStat1+IFNβ- group), and SiStat1 combined with IFNβ intervention group (SiStat1+IFNβ+ group). The intervention procedure was as follows: For the NC+IFNβ- group and the NC+IFNβ+ group, 5 μL / well of NC was added to 125 μL / well of serum-free DMEM medium to prepare the NC dilution solution. For the SiStat1+IFNβ- group and the SiStat1+IFNβ+ group, 5 μL / well of NC was added to 125 μL / well of serum-free DMEM medium to prepare the NC dilution solution. Add 5 μL / well of SiStat1 stock solution to 125 μL / well of serum-free DMEM to prepare a SiStat1 dilution. Separately, add 5 μL / well of Lipo3000 transfection reagent to another 125 μL / well of serum-free DMEM. Mix the siRNA dilutions (i.e., the previously prepared NC and SiStat1 dilutions) with the Lipo3000 dilution and let stand for 15 min to form the transfection complex. Replace the culture medium in each well of the 6-well plate with DMEM containing 5% CS. After the liquid mixture was allowed to stand, the transfection complex was added to the wells of a 6-well plate. The 6-well plate was then placed back into the 37°C, 5% CO2 incubator for incubation. After 48 hours, the supernatant was discarded, and each well was washed twice with PBS. The NC+IFNβ+ group and the SiStat1+IFNβ+ group were added to complete medium containing IFNβ to make the final IFNβ concentration 50 ng / mL. The NC+IFNβ- group and the SiStat1+IFNβ- group were added to complete medium without IFNβ with the same volume as the NC+IFNβ+ group and the SiStat1+IFNβ+ group. Samples were collected 6 hours after intervention for subsequent experiments.

[0191] 2. Total RNA extraction and quantitative PCR detection: The steps are the same as before ("Example 1. Experimental Method 6")

[0192] 3. Immunofluorescence staining and photography: After intervention, cells were washed three times with PBS for 5 minutes each time. 4% paraformaldehyde was added and fixed at room temperature for 15 minutes; PBS was then washed three times for 5 minutes each time. 0.2% Triton 100 was added and permeabilized at room temperature for 10 minutes; PBS was then washed three times for 5 minutes each time. 5% BSA was added and blocked at room temperature for 1 hour; PBS was then washed three times for 5 minutes each time. The primary antibody was diluted to the appropriate concentration using antibody diluent according to the corresponding antibody titer, and the solution was added and incubated overnight at 4°C. The next day, cells were washed three times with PBS for 5 minutes each time. Secondary antibodies were selected according to the species of the primary antibody and diluted to the appropriate concentration using antibody diluent according to the corresponding antibody titer. The solution was added and incubated at room temperature in the dark for 1 hour; PBS was washed three times for 5 minutes each time. 25-30 μL of anti-fluorescence quencher was added. Observation and photography were performed using a fluorescence microscope. Cells were counted using Zeiss fluorescence analysis software under a 10-1 fluorescence microscope. 4 / um 2 The number of Pdpn+Cxcl13+ FRC cells was determined, the percentage of Pdpn+Cxcl13+ FRC cells in the total number of cells was calculated, and statistical analysis was performed.

[0193] The experimental results of this embodiment are as follows: Figure 2 As shown.

[0194] Figure 2 Figures A, B, and C show the following graphs: Western blot (Figure A) of p-Stat1 and Stat1 protein expression levels in the NIH3T3 cell line under combined intervention with IFNβ and the Stat1 inhibitor Fludarabine (Flu); statistical analysis of the relative mRNA expression levels of Cxcl13 and Stat1 (Figure B); immunofluorescence representation of Pdpn and Cxcl13 protein expression levels; and statistical analysis of the proportion of Pdpn+Cxcl13+ FRCs (Figure C). (Pdpn is also a classic marker of fibroblast reticulum cell FRCs, as shown in Figures C, F, and...) Figure 3Pdpn+Cxcl13+ was used as the marker for FRC cells. Figures D, E, and F show the following data: p-Stat1 and Stat1 protein expression levels in the NIH3T3 cell line under combined intervention with IFNβ and siRNA (negative controls NC and SiStat1), respectively (Figure D); statistical analysis of the relative mRNA expression levels of Cxcl13 and Stat1 (Figure E); immunofluorescence representation of Pdpn and Cxcl13 protein expression levels; and statistical analysis of the proportion of Pdpn+Cxcl13+ FRC cells (Figure F). The results showed that IFNβ intervention alone enhanced Stat1 phosphorylation activity and increased total Stat1 expression, and significantly upregulated Cxcl13 transcription and protein expression. However, IFNβ combined with inhibitor intervention or IFNβ combined with Stat1 siRNA intervention significantly inhibited the enhancement and upregulation effects. These results indicate that inhibiting Stat1 activity and expression with inhibitors or downregulating Stat1 expression with siRNA can suppress IFNβ-induced FRC differentiation.

[0195] Example 3: Inhibiting STAT1 reduces TLO formation in transplanted vessels

[0196] Experimental methods:

[0197] 1. Experimental Animal Intervention: For the inhibitor intervention experiment, 6-8 week old C57BL / 6J recipient mice were intraperitoneally injected with the drug approximately 2 weeks before transplantation. The intervention groups were: a Flu drug intervention group and a solvent control group. The intervention method was as follows: the Flu drug intervention group received an intraperitoneal injection of Flu at a dose of 10 mg / kg; the solvent control group received an intraperitoneal injection of the same drug solvent with the same composition and volume as the intervention group; the injection frequency was once every 3-4 days, for a total of 5 injections over approximately 2 weeks.

[0198] For Stat1-specific knockout experiments in fibroblast progenitor cells:

[0199] 1) gRNA preparation

[0200] Design and synthesize gRNA-A1 and gRNA-A2.

[0201] 2) Preparation of the fertilized egg:

[0202] 2-1. Preparation of fertilized eggs: Select 3-4 week old C57BL / 6 female mice and inject them with pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) at an interval of 46-48 hours.

[0203] 2-2. After injecting HCG, female mice were mated with adult fertile male mice to fertilize the female mice;

[0204] 2-3. The next day, after euthanizing the female mouse, the fertilized eggs were collected from the oviduct and placed in a 37°C constant temperature 5% CO2 incubator for later use.

[0205] 3) Pronuclear microinjection:

[0206] 3-1. Preparation of microinjection needles and fixation needles;

[0207] 3-2. Add the prepared gRNA injection solution into the microinjection needle;

[0208] 3-3. Select morphologically normal fertilized eggs and place them in an injection dish. Under a 200-400x inverted microscope, inject the exogenous gene injection solution into the nucleus of the fertilized egg cells via microinjection.

[0209] 3-4. After injection, transfer the fertilized eggs to M16 medium and place them in a 37℃ constant temperature 5% CO2 incubator. After culturing for 0.5-1h, perform the transplant; or culture until the 2-cell state and perform the transplant the next day.

[0210] 4) Preparation of surrogate mice and embryo transfer:

[0211] 4-1. Preparation of pseudopregnant female mice: Select fertile female mice of appropriate age and mate them with male mice that have been sterilized after vasectomy. Stimulate the female mice to undergo a series of pregnancy changes to obtain pseudopregnant female mice, which will be used as surrogate mice after the fertilized eggs are transgenic.

[0212] 4-2. The fertilized eggs that have been injected with the exogenous gene were transferred into the oviduct of a surrogate mother mouse on the day of thrombus formation;

[0213] 4-3. After transplantation, place the surrogate mother mouse in a clean cage and keep her warm until she regains consciousness before returning her to the cage.

[0214] 4-4. After successful oviduct transplantation, the mother mouse will usually give birth 19-20 days after the operation; one week after birth, the mice are clawed or tail clipped for identification, and PCR identification is performed at the same time; three weeks after birth, the mice are separated into individual cages for independent housing.

[0215] 5) Identification of newborn F0 mice:

[0216] 5-1. Collect tissues (toe or tail tissues) from 1-2 week old juvenile mice;

[0217] 5-2. Dissociate the tissue and extract the genome;

[0218] 5-3. PCR amplification and electrophoresis were performed using specific primers (Primer-F1, Primer-R1, Primer-F2, Primer-R2) targeting the target gene to screen for positive offspring F0.

[0219] 6) Succession and lineage establishment

[0220] 6-1. Crossbreed positive mice (F0) with non-transgenic mice and pass them through generations;

[0221] 6-2. Identification of newborn mice: F0 mice that can be normally transmitted through the germline have a 50% chance of carrying the integrated target gene in their offspring, i.e., the F1 generation Stat1. flox Heterozygous mice;

[0222] 6-3. The above Stat1 flox Heterozygous mice were raised to sexual maturity and then mated with their siblings. The resulting F2 mice had a 25% chance of being homozygous, i.e., Stat1. flox / flox Homozygous mice can be used for experiments and further construction of Stat1. CKO Mice.

[0223] 6-4. Stat1 flox / flox Homozygous mice were raised to sexual maturity and then bred with Col1a2-CreER tool mice (i.e., fibroblast-specific tamoxifen-induced Cre recombinase tool mice) to obtain Stat1. CKO Heterozygous mice;

[0224] 6-4. The above Stat1 CKO Heterozygous mice were raised to sexual maturity and then subjected to the above-mentioned Stat1. flox / flox homozygous mice and Stat1 CKO Heterozygous mice were crossbred in an in vitro fertilization (IVF) facility to propagate the Stat1 strain. CKO Homozygous mice.

[0225] 7) Stat1 is induced by intraperitoneal injection of tamoxifen approximately 2 weeks before transplantation. CKO Stat1-specific knockout of fibroblast progenitor cells in homozygous mice was performed using tamoxifen at a dose of 75 mg / kg, administered every 3-4 days for a total of 5 injections over approximately 2 weeks.

[0226] SEQ NO.17: gRNA-A1: GACTAGTCGTGCCCTCAGCC-AGG;

[0227] SEQ NO.18: gRNA-A2: CAGGTCTCAAATTGGTCAGT-GGG;

[0228] SEQ NO.19:Primer-F1: 5'-GAAATGGCACTTGGTTTAAGCATG-3';

[0229] SEQ NO.20: Primer-R1: 5'-CGAACTTGTGGCCGTTTACGT-3';

[0230] SEQ NO.21:Primer-F2: 5'-CTTGATTGCCTGATTTTGACCACA-3';

[0231] SEQ NO. 22: Primer-R2: 5'-TTGCCATTCAGCCAACATTCATAG-3'.

[0232] 2. Vascular Sample Collection and Frozen Section Preparation: The method for collecting graft aortic vessels is described in "Example 1. Experimental Method 2". Each graft aorta was immersed in 10 mL of 4% paraformaldehyde and placed at 4°C for 8-12 hours for antigen fixation. After fixation, the samples were washed three times with PSB for 5 minutes each time. The samples were then immersed in 30% sucrose-PB dehydration solution and placed at 4°C overnight until the vessels settled to the bottom, completing tissue dehydration. The next day, an appropriate amount of OCT gel was poured into the embedding frame. The vascular sample from the previous step was removed, excess liquid was absorbed with gauze, and the sample was placed vertically into the embedding frame and centered. The frame was then marked. The embedding frame was stored at -80°C for subsequent frozen section preparation and other experiments.

[0233] 3. Cryosectioning of Vascular Samples: Preheat the microtome to the preset temperature (-20℃). Fix the sample holder and sample in the quick-freezing rack position. Insert the pre-cooled sample holder into the sample, and insert the pre-cooled blade into the blade holder. Adjust the relative position of the blade holder and sample to bring them close together. Set the section thickness to 8µm, trim and section the sample, and mount the cut complete sample cross-section onto a glass slide at room temperature. After sectioning, place the sectioned samples at room temperature for about 2 hours, then store at -80℃.

[0234] 4. Immunofluorescence staining and photography: Place the frozen sections to be stained at room temperature for 20 minutes; gently rinse with tap water for 3-5 minutes to remove the OCT gel; wash three times with PBS, 5 minutes each time. Add 0.2% Triton 100 and permeate at room temperature for 10 minutes; wash three times with PBS, 5 minutes each time. Add 5% BSA and block at room temperature for 1 hour; wash three times with PBS, 5 minutes each time. Dilute the primary antibody to the corresponding concentration using antibody diluent according to the corresponding antibody titer, add the primary antibody diluent, and incubate overnight at 4°C. The next day, wash three times with PBS, 5 minutes each time. Select the secondary antibody according to the species of the primary antibody, and dilute the secondary antibody to the corresponding concentration using antibody diluent according to the corresponding antibody titer, add the secondary antibody diluent, and incubate at room temperature in the dark for 1 hour; wash three times with PBS, 5 minutes each time. Add 25-30 μL of anti-fluorescence quenching agent and mount the slide. Observe and photograph under a fluorescence microscope. Use Zeiss fluorescence analysis software to count the number of TLOs formed in the sample and measure the area per unit area (10⁻¹²) of the TLOs. 4 / um 2 The number of Pdpn+Cxcl13+ FRC cells was determined and statistically analyzed.

[0235] The experimental results of this embodiment are as follows: Figure 3 As shown.

[0236] Figure 3 In the image, Figures A and B show the immunofluorescence representations of transplanted blood vessels at week 4 after allogeneic vascular transplantation in the control group (Vehicle) and the inhibitor group (Flu), respectively (Figure A) and the number of TLO cells ( / vessel) and the number of FRC cells per unit area [Pdpn+Cxcl13+ FRC cells ( / mm²)]. 2 )]Statistical analysis chart (Chart B); Charts C and D are the control group mice (Stat1) flox / flox Stat1-specific knockout mice (mice) and Fibroblast progenitor cells (Stat1) CKO (Mouse) Immunofluorescence representation of transplanted blood vessels at week 4 after allogeneic vascular transplantation (Figure C), and the number of TLO cells ( / vessel) and the number of FRC cells per unit area [Pdpn+Cxcl13+ FRC cells ( / mm²)]. 2 Statistical analysis chart (Figure D). Results showed that, compared to the control group (Vehicle), the inhibitor (Flu) group exhibited significantly reduced T and B cell infiltration in transplanted blood vessels, significantly reduced FRC cell infiltration, and significantly decreased TLO numbers; compared to the control group mice (Stat1) flox / flox Mice), Fibroblast progenitor cell Stat1-specific knockout mice (Stat1 CKO In mice, T and B cell infiltration in transplanted blood vessels was significantly reduced, as was FRC cell infiltration, and the number of TLOs was significantly decreased. These results indicate that inhibiting Stat1 can reduce TLO formation in transplanted blood vessels.

[0237] Example 4: Inhibition of STAT1 improves transplant vascular remodeling

[0238] Experimental methods:

[0239] H&E staining: Place frozen sections to be stained at room temperature for 20 min; gently rinse with tap water for 3-5 min to remove OCT gel; wash 3 times with PBS, 5 min each time. Incubate sections in hematoxylin working solution for 1-5 min for nuclear staining; differentiate in differentiation solution for 2-4 s, rinse 3-4 times with tap water; blue inversion solution for 4 s, rinse 3-4 times with tap water; dehydrate by soaking in 85% ethanol for 4 min, then in 95% ethanol for 4 min. Incubate in eosin staining solution for 1-4 min for cytoplasmic staining; dehydrate by soaking in 100% ethanol 3 times, 4 min each time; soak in xylene twice, 4 min each time. Mount the sections with neutral resin after the above staining procedures. Observe and photograph under a microscope. Measure the intima and media thickness of the blood vessel cross-section using Image Pro Plus software, calculate the intima / media thickness ratio (I / M), and perform statistical analysis.

[0240] The experimental results of this embodiment are as follows: Figure 4 As shown.

[0241] Figure 4 In the image, Figure A and Figure B show representative H&E staining of transplanted blood vessels at week 4 after allogeneic vascular transplantation in mice of the control group (Vehicle) and the inhibitor group (Flu), respectively (Figure A) and the neointimal area (102). 4 um 2 Figure B shows the statistical analysis of the intima / media thickness ratio; Figures C and D show the control group mice (Stat1) respectively. flox / flox Stat1-specific knockout mice (mice) and Fibroblast progenitor cells (Stat1) CKO Mouse) Allogeneic blood vessel transplantation, week 4: Representative H&E staining of transplanted blood vessels (Figure C) and neointimal area (10) 4 um 2 The results showed that, compared with the control group (Vehicle), the inhibitor group had significantly less neointima and a significantly lower neointima-to-media thickness ratio; compared with the control group mice (Stat1), the inhibitor group had significantly less neointima and a significantly lower neointima-to-media thickness ratio. flox / flox Mice), Fibroblast progenitor cell Stat1-specific knockout mice (Stat1 CKO In mice, transplanted vascular remodeling was significantly reduced, and the ratio of neointima to media thickness was significantly decreased. These results indicate that inhibiting Stat1 can effectively improve transplanted vascular remodeling.

[0242] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0243] The embodiments described above are merely illustrative of several implementations of this disclosure, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this disclosure, and these all fall within the protection scope of this disclosure. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A STAT1 inhibitor for treating transplanted vascular remodeling; said STAT1 inhibitor is selected from one or more of the following: 1) a small interfering RNA that targets STAT1 or its transcript and is capable of inhibiting STAT1 expression or gene transcription; said small interfering RNA sequence is shown in SEQ ID NO. 15; 2) a STAT1 gene knockout agent comprising: The CRISPR-Cas9 gene editing vector contains gRNA-A1 and gRNA-A2 as shown in SEQ ID NO.17 and NO.

18.

2. A medicament comprising the STAT1 inhibitor of claim 1, characterized in that: The active ingredient is a STAT1 inhibitor, and it also contains pharmaceutically acceptable excipients.

Images