Long-chain non-coding RNA and application thereof

Abstract

This invention discloses a long non-coding RNA and its applications. By analyzing and comparing the expression of long non-coding RNAs in wild-type and ERβ gene knockout mice, this invention identified a long non-coding RNA involved in regulating osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs), namely long non-coding RNA MSTRG.47495.1 (lncRNA MSTRG.47495.1). Overexpression of this long non-coding RNA in BMSCs effectively promotes osteogenic differentiation of BMSCs, enhances bone regeneration, and promotes bone defect repair in rats with skull injuries. Based on this, the long non-coding RNA of this invention can be used to prepare drugs for treating bone metabolic diseases and bone formation disorder-related diseases by promoting osteogenic differentiation of BMSCs and enhancing bone regeneration. Furthermore, the long non-coding RNA can also be used to construct bone organoids.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical manufacturing technology. More specifically, it relates to a long non-coding RNA and its applications. Background Technology

[0002] The essence of bone metabolic diseases lies in the disruption of the dynamic balance between bone resorption and bone formation. Osteoporosis, characterized by decreased bone mass and destruction of bone microstructure, leads to increased bone fragility. Its pathological basis lies in the decreased osteogenic potential of bone marrow mesenchymal stem cells (BMSCs) and the excess of osteoclast-mediated bone resorption (OCs) over osteoblast-mediated bone formation (OBs). Bone formation disorders, including osteogenesis imperfecta (also known as brittle bone disease), osteomalacia, rickets, and fibrous dysplasia of bone, are primarily characterized by insufficient bone regeneration. Currently, clinical treatments for these bone diseases still have many limitations. For osteoporosis, mainstream drugs such as anti-resorption agents can slow bone loss but are ineffective in promoting new bone formation; while bone-forming drugs suffer from high costs, inconvenient administration, and uncertain long-term safety. There is currently no cure for bone diseases such as osteogenesis imperfecta, and treatment is mainly symptomatic and supportive. Therefore, there is an urgent clinical need for novel treatment strategies that can fundamentally regulate bone metabolism balance, efficiently promote bone repair, and have minimal side effects.

[0003] Bone choroidal stem cells (BMSCs) possess self-renewal and multi-lineage differentiation potential, capable of differentiating into various cell types such as OB, chondrocytes (CC), and adipocytes (AC) under specific induction conditions, making them valuable in tissue engineering and regenerative medicine. Furthermore, BMSCs' low immunogenicity and ease of isolation and culture make them crucial seed cells for bone tissue repair and regeneration. For example, researchers have observed that xenografted modified BMSCs in rat femoral condyle defects exhibit strong osteogenic properties, thereby accelerating bone repair. It is evident that the osteogenic differentiation efficiency of BMSCs directly affects bone formation capacity, and this process is precisely regulated by multiple factors, including transcription factors, signaling pathways, and epigenetic modifications. Therefore, identifying factors involved in regulating BMSC osteogenic differentiation, such as long non-coding RNA (lncRNA), and utilizing them to promote BMSC osteogenic differentiation can fundamentally regulate bone metabolism balance, efficiently promote bone repair, and ultimately treat bone metabolic diseases and bone formation disorders. Summary of the Invention

[0004] To address the shortcomings of the existing technologies, this invention provides a long non-coding RNA, named lncRNA MSTRG.47495.1, which can regulate osteogenic differentiation of BMSCs and enable the development of therapeutic drugs for bone metabolic diseases and bone formation disorder-related diseases.

[0005] The first objective of this invention is to provide a long non-coding RNA.

[0006] A second object of the present invention is to provide the use of the long non-coding RNA or an overexpression agent of the long non-coding RNA in the preparation of a formulation for promoting osteogenic differentiation of bone marrow mesenchymal stem cells.

[0007] A third object of the present invention is to provide the use of the long non-coding RNA or an overexpression agent of the long non-coding RNA in the preparation of formulations for enhancing bone regeneration.

[0008] A fourth object of the present invention is to provide the use of the long non-coding RNA or an overexpression agent of the long non-coding RNA in the preparation of formulations for bone defect repair.

[0009] A fifth objective of this invention is to provide the use of the long non-coding RNA or an overexpression reagent of the long non-coding RNA in the construction of bone organoids.

[0010] A sixth object of the present invention is to provide the use of the long non-coding RNA or an overexpression reagent of the long non-coding RNA in the preparation of formulations for constructing bone organoids.

[0011] A seventh object of the present invention is to provide the use of the long non-coding RNA or an overexpression agent of the long non-coding RNA in the preparation of a medicament for treating bone metabolic diseases.

[0012] An eighth object of the present invention is to provide the use of the long non-coding RNA or an overexpression agent of the long non-coding RNA in the preparation of a medicament for treating bone formation disorder-related diseases.

[0013] The above-mentioned objective of this invention is achieved through the following technical solution: This invention, while studying the effects of estrogen receptor-β (ERβ) on bone metabolism, discovered that ERβ gene knockout (ERβ...) - / - In mice with ERβ, the number of trabeculae increased and the interosseous spaces decreased. Based on this, this invention compares and analyzes wild-type (WT) mice with ERβ... - / -Based on the results of transcriptome sequencing (RNA-seq) of mice and experiments related to osteogenic differentiation of BMSCs, a lncRNA that can regulate osteogenic differentiation of BMSCs was discovered and named lncRNA MSTRG.47495.1. Its cDNA sequence is shown in SEQ ID NO.1.

[0014] This invention reveals that stem cell scaffolds constructed using mBMSCs overexpressing lncRNA MSTRG.47495.1 can promote the repair of skull defects in rats, while stem cell scaffolds constructed using mBMSCs with knocked-down lncRNA MSTRG.47495.1 inhibit skull defect repair in rats. This invention confirms the crucial role of lncRNA MSTRG.47495.1 in bone formation and its significant potential in promoting osteogenic differentiation of BMSCs and enhancing bone regeneration. lncRNA MSTRG.47495.1 may serve as a novel preventative and therapeutic target for bone metabolic diseases and bone formation disorders, by promoting osteogenic differentiation of BMSCs, enhancing bone regeneration, and treating or improving osteoporosis and other bone diseases related to insufficient bone regeneration capacity, such as decreased osteogenic potential of BMSCs or osteogenesis insufficiency. Therefore, this invention seeks protection for the aforementioned lncRNA MSTRG.47495.1 and its applications in regulating osteogenic differentiation of BMSCs.

[0015] The present invention provides a long non-coding RNA, wherein the long non-coding RNA is lncRNAMSTRG.47495.1, and its cDNA sequence is shown in SEQ ID NO.1.

[0016] Given that regulating the expression level of the lncRNA MSTRG.47495.1 can regulate osteogenic differentiation of BMSCs, this invention seeks protection for the use of the lncRNA MSTRG.47495.1 in regulating osteogenic differentiation of BMSCs.

[0017] The present invention also claims protection for the use of substances capable of regulating the expression level of said lncRNA MSTRG.47495.1 in regulating osteogenic differentiation of BMSCs.

[0018] The present invention also claims the use of a substance capable of regulating the expression level of said lncRNA MSTRG.47495.1 in the preparation of a formulation for regulating osteogenic differentiation of BMSCs.

[0019] Specifically, promoting the expression of lncRNA MSTRG.47495.1 promotes osteogenic differentiation of BMSCs; inhibiting the expression of lncRNA MSTRG.47495.1 inhibits osteogenic differentiation of BMSCs.

[0020] Specifically, the BMSCs are mBMSCs.

[0021] Optionally, the substance used to promote the expression of lncRNA MSTRG.47495.1 is a recombinant overexpression vector containing the cDNA sequence of lncRNA MSTRG.47495.1; the substance used to inhibit the expression of lncRNA MSTRG.47495.1 is a small hairpin RNA (shRNA) designed based on RNA interference technology that targets lncRNA MSTRG.47495.1.

[0022] In a specific embodiment of the present invention, the sequence of the shRNA is shown in SEQ ID NO.2.

[0023] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression agent of the lncRNA MSTRG.47495.1 in the preparation of formulations for promoting osteogenic differentiation of bone marrow mesenchymal stem cells.

[0024] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of formulations for enhancing bone regeneration.

[0025] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of formulations for bone defect repair.

[0026] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the construction of bone organoids.

[0027] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of formulations for constructing bone organoids.

[0028] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of a medicament for treating bone metabolic diseases.

[0029] Specifically, the bone metabolic disease is osteoporosis.

[0030] The pathological basis of osteoporosis is the decreased osteogenic potential of bone mesenchymal stem cells (BMSCs) in patients, with osteogenic resorption (OC)-mediated bone resorption exceeding osteogenic regeneration (OB). Overexpression of the lncRNA MSTRG.47495.1 described in this invention can promote osteogenic differentiation of BMSCs and enhance bone regeneration, thus it can be used to treat osteoporosis.

[0031] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of a medicament for improving bone metabolic diseases.

[0032] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression reagent of the lncRNA MSTRG.47495.1 in the preparation of a medicament for treating bone formation disorder-related diseases.

[0033] Specifically, the bone formation disorder-related disease is osteogenesis imperfecta.

[0034] Osteogenesis imperfecta and other bone formation disorders are characterized by insufficient bone regeneration. Overexpression of the lncRNA MSTRG.47495.1 described in this invention can promote osteogenic differentiation of BMSCs and enhance bone regeneration, thus it can be used to treat osteogenesis imperfecta and other bone formation disorders.

[0035] The present invention also claims protection for the use of the lncRNA MSTRG.47495.1 or an overexpression agent of the lncRNA MSTRG.47495.1 in the preparation of a medicament for improving bone formation disorder-related diseases.

[0036] Specifically, the overexpression reagent is a recombinant overexpression vector containing the cDNA sequence of the lncRNA MSTRG.47495.1.

[0037] The present invention also provides a formulation for promoting osteogenic differentiation of BMSCs, enhancing bone regeneration, or repairing bone defects, wherein the formulation contains an overexpression reagent of the lncRNA MSTRG.47495.1.

[0038] Specifically, the overexpression reagent is a recombinant overexpression vector containing the cDNA sequence of the lncRNA MSTRG.47495.1.

[0039] Specifically, the formulation also contains a delivery vector capable of delivering the recombinant overexpression vector into the body.

[0040] The present invention has the following beneficial effects: This invention provides a long non-coding RNA, lncRNA MSTRG.47495.1, involved in regulating osteogenic differentiation of bone mesenchymal stem cells (BMSCs). Overexpression of lncRNA MSTRG.47495.1 in BMSCs effectively promotes osteogenic differentiation, enhances bone regeneration, and promotes bone defect repair. This invention thus provides the application of lncRNA MSTRG.47495.1 in the preparation of formulations for promoting osteogenic differentiation of BMSCs, enhancing bone regeneration, and repairing bone defects. lncRNA MSTRG.47495.1 can also be used for the construction of bone organoids. Given that lncRNA MSTRG.47495.1 can effectively promote osteogenic differentiation of BMSCs and enhance bone regeneration, it can also be used to develop drugs for treating or improving bone metabolic diseases and bone formation disorders. In other words, this invention not only benefits the repair of bone defects but also facilitates the development of drugs for the treatment of bone metabolic diseases and bone formation disorders. Attached Figure Description

[0041] Figure 1 The figures show volcano plots of differentially expressed lncRNAs identified by RNA sequencing, and the expression levels of lncRNA MSTRG.47495.1 in mBMSCs cultured in osteogenic induction differentiation medium at different time points; Figure A is the volcano plot; Figure B is the expression level detection result; P <0.01; P <0.001; P <0.0001.

[0042] Figure 2 This image shows the gel electrophoresis results and sequencing results of the PCR amplification products during the cloning and sequencing of the cDNA sequence of lncRNA MSTRG.47495.1 using rapid cDNA end amplification (RACE) technology. Figure A shows the electrophoresis results of the extracted total RNA; Figure B shows the electrophoresis results of the partial sequence of the MSTRG.47495.1 gene obtained by PCR amplification; Figure C shows the electrophoresis results of the 5′-RACE PCR amplification products; Figure D shows the electrophoresis results of the 3′-RACE PCR amplification products; Figure E shows the full-length sequence of the middle region of the MSTRG.47495.1 gene; Figure F shows the full-length end sequence obtained by the 5′-RACE experiment; Figure G shows the full-length end sequence obtained by the 3′-RACE experiment; and Figure H shows the complete full-length cDNA sequence of lncRNA MSTRG.47495.1.

[0043] Figure 3Figure 1 shows the results of nuclear / cytoplasmic localization experiments of lncRNA MSTRG.47495.1 and its effect on the proliferation and differentiation of mBMSCs; Figure A shows the expression level of lncRNA MSTRG.47495.1 in overexpressing and knocked-down cells; Figure B shows the results of nuclear / cytoplasmic localization experiments of lncRNA MSTRG.47495.1; Figure C shows the MTT assay results in lncRNA MSTRG.47495.1 overexpressing cells; Figure D shows the alkaline phosphatase (ALP) staining and visualization analysis results in lncRNA MSTRG.47495.1 overexpressing and knocked-down cells; Figure 1 P <0.01; P <0.01; in the figure P <0.001; P <0.0001.

[0044] Figure 4 This study investigated the effects of overexpression or knockdown of lncRNA MSTRG.47495.1 on the expression of osteogenic-related factors ALP, bone morphogenetic protein-2 (BMP2), Runt-related transcription factor 2 (RUNX2), and β-1 collagen (COL1A1) in mBMSCs. Figures A through C show the Western blot analysis, relative protein expression levels, and relative mRNA expression levels of these osteogenic-related factors in cells overexpressing lncRNA MSTRG.47495.1, respectively. Figures D through F show the Western blot analysis, relative protein expression levels, and relative mRNA expression levels of these osteogenic-related factors in cells knocked down by lncRNA MSTRG.47495.1, respectively. P <0.01; P <0.01; P <0.001; P <0.0001.

[0045] Figure 5This figure shows the effect of overexpression or knockdown of lncRNA MSTRG.47495.1 on bone mineral density (BMD) in rats with skull defects in a skull defect experiment. Figure A shows the 3D reconstruction of the skull of rats in the lncRNA MSTRG.47495.1 overexpression group and its corresponding control group; Figure B shows the 3D reconstruction of the skull of rats in the lncRNA MSTRG.47495.1 knockdown group and its corresponding control group; Figure C shows the BMD index of rats in the lncRNA MSTRG.47495.1 overexpression group and its corresponding control group; Figure D shows the BMD index of rats in the lncRNA MSTRG.47495.1 knockdown group and its corresponding control group. P <0.01; P <0.0001.

[0046] Figure 6 The images show the H&E staining and imaging results of rats in the group with overexpression and knockdown of lncRNA MSTRG.47495.1 and their corresponding control group in the skull defect experiment.

[0047] Figure 7 Masson's trichrome staining imaging results of rats in the group with overexpression and knockdown of lncRNA MSTRG.47495.1 and their corresponding control group in the skull defect experiment. Detailed Implementation

[0048] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0049] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0050] Example 1 ERβ - / - Detection and analysis of differentially expressed lncRNAs in mice This invention utilizes RNA-seq to study WT and ERβ. - / - Differentially expressed lncRNAs in mice were detected and analyzed. The WT mouse strain used was C57BL / 6J; the ERβ... - / - The breeding pairs of mice (heterozygous female and heterozygous male, Cat#004745) were obtained from the JACKSON laboratory with C57BL / 6J as the background.

[0051] 1. Detection of differentially expressed lncRNAs using RNA-seq The experimental mice (three-month-old female C57BL / 6J WT and ERβ) - / - After anesthesia, the two thighs were separated, and the muscles and other tissues were carefully removed, leaving the femur intact. The remaining tissue on the bone surface was gently wiped with gauze soaked in saline solution. To prevent degradation, the bone tissue was ground with liquid nitrogen, and RNA was extracted using Trizol reagent (Invitrogen). ERβ was extracted according to the method provided by the reagent manufacturer. - / - Total RNA from the femur of WT mice was extracted; the concentration and purity of the extracted RNA were evaluated using Nanodrop (ThermoFisher Scientific); qualified RNA was used to construct complementary deoxyribonucleic acid libraries from the total RNA using the Small RNA Sample Prep Kit (Illumina); the integrity and size of cDNA were detected using an Agilent 2100 bioanalyzer (Agilent Technologies); finally, qualified cDNA were sequenced on a single-end HiSeq Xten platform (Illumina, San Diego, CA, USA) to generate a volcano map of differentially expressed lncRNAs.

[0052] Volcano diagram of differentially expressed lncRNAs identified by RNA sequencing, as shown below. Figure 1 As shown in Figure A, the present invention relates to ERβ. - / - Seventy-one differentially expressed lncRNAs were identified in mice. Among these differentially expressed lncRNAs, this invention selected one lncRNA with significantly upregulated expression (i.e., lncRNA MSTRG.47495.1) for further study.

[0053] 2. qRT-PCR detection of lncRNA MSTRG.47495.1 mBMSCs were cultured in osteogenic induction differentiation medium (Wuhan Pronosei Biotechnology Co., Ltd., catalog number PD-003). Cells were collected at 0, 3, 7, 10, and 14 days of culture. RNA was extracted from the cells using Trizol at 4°C. The extracted RNA was reverse transcribed into cDNA and analyzed by qRT-PCR using a Bio-Rad high-throughput quantitative PCR instrument. Triple copies were used to detect the expression of lncRNA MSTRG.47495.1. GAPDH was used as an internal control. The primers for qRT-PCR detection of lncRNA MSTRG.47495.1 are shown in Table 1 and were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.

[0054] Table 1 Primers for qRT-PCR detection of lncRNA MSTRG.47495.1

[0055] During the osteogenic differentiation induction process of mBMSCs, this invention, using qRT-PCR detection, found that the expression level of lncRNA MSTRG.47495.1 increased with the duration of osteogenic differentiation induction. Figure 1 As shown in B, this indicates that lncRNA MSTRG.47495.1 plays an important role in bone formation.

[0056] Example 2: Obtaining the cDNA sequence of lncRNA MSTRG.47495.1 To determine the cDNA sequence of lncRNA MSTRG.47495.1, this invention commissioned Shanghai Sangon Biotech Co., Ltd. to clone and sequence the cDNA sequence of lncRNA MSTRG.47495.1 using RACE experiments. The sequences of the primers used in the RACE experiments are shown in Table 2, and all primers shown were designed and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0057] Table 2 Primers used in the RACE experiment

[0058] 1. Total RNA extraction Total RNA was extracted from untreated mBMSCs using the TRIzol® Plus RNA Purification Kit (12183-555, Invitrogen), following the manufacturer's instructions. The extracted RNA was analyzed by agarose gel electrophoresis using a gel imaging system (Gene Genius) and purity was simultaneously assessed using a UV spectrophotometer (Hitachi). Once the purity met the requirements, it was reverse transcribed into cDNA.

[0059] The electrophoresis results of the extracted total RNA are as follows: Figure 2 As shown in Figure A. The results showed that the two main bands, 28S and 18S, were clear and distinct, indicating that the total RNA had good integrity. At the same time, the A260 to A280 ratio measured by UV spectrophotometry was 1.92, indicating that the extracted RNA had high purity and could be used for subsequent experiments.

[0060] 2. Cloning of a partial sequence of the MSTRG.47495.1 gene Using cDNA obtained from reverse transcription as a template, PCR amplification was performed using specific primers m47495.1-F / m47495.1-R (as shown in Table 2). The PCR amplification products were detected by 1.2% agarose gel electrophoresis (electrophoresis results are shown in Table 2). Figure 2 After (as shown in B in the diagram), the target band is excised, recovered via gel, ligated into the pGM-T vector, transformed into DH5α competent cells, and sent for sequencing verification.

[0061] 3. RACE test To obtain the full-length sequence, 5′-RACE and 3′-RACE experiments were conducted.

[0062] RACE templates were synthesized using the GeneRacer™ Kit (L1500-01, Invitrogen), and the reaction system and conditions were in accordance with the manufacturer's instructions. The 5′-RACE assay was performed using two rounds of nested PCR: the first round used the 5′ GeneRacer Outer Primer with the gene-specific reverse primer r47495.1-R1; the second round used the product from the first round as a template, amplifying with the 5′ GeneRacer Inner Primer and the nested reverse primer r47495.1-R2. The 3′-RACE assay also used two rounds of nested PCR: the first round used the 3′ GeneRacer Outer Primer with the gene-specific forward primer r47495.1-F1; the second round used the 3′ GeneRacer Inner Primer and the nested forward primer r47495.1-F2. The RACE amplification products were detected by 1.5% (5′-RACE) and 1.2% (3′-RACE) agarose gel electrophoresis, respectively. (The electrophoresis results of the 5′-RACE PCR and 3′-RACE PCR amplification products are shown below.) Figure 2 (As shown in C and D in the figure), after gel extraction and recovery, the cells were cloned into the pGM-T vector, transformed into DH5α competent cells, and sequenced for analysis.

[0063] This invention successfully obtained the full-length cDNA sequence of lncRNA MSTRG.47495.1 using RACE technology. Sequencing results showed that a 194 bp partial sequence of the middle gene region was obtained by PCR amplification, as shown below. Figure 2 As shown in E; the 5′-RACE experiment yielded a 204 bp terminal sequence, the full length of which is shown in Figure 1. Figure 2 As shown in F, it contains the adapter sequence (represented by the box) and the R2 primer binding region (represented by green); the 3′-RACE experiment yielded a 258 bp terminal sequence, the full length of which is shown in Figure 1. Figure 2 As shown in G, it contains the adapter sequence (represented by a square) and the F2 primer position (represented by yellow). The three sequences were aligned and spliced ​​to obtain the complete cDNA sequence of lncRNA MSTRG.47495.1, which is 315 bp in length. Figure 2 As shown in H (SEQ ID NO.1).

[0064] Example 3: Effects of LncRNA MSTRG.47495.1 on BMSC proliferation and differentiation This invention constructs a recombinant overexpression vector of lncRNA MSTRG.47495.1 to overexpress lncRNA MSTRG.47495.1, and designs shRNAs targeting lncRNA MSTRG.47495.1 to inhibit the expression of lncRNA MSTRG.47495.1, thereby detecting the effect of lncRNA MSTRG.47495.1 on the proliferation and differentiation of BMSCs.

[0065] The experiment was divided into four groups: overexpression control group (LV-NC), lncRNA MSTRG.47495.1 overexpression group (LV), knockdown control group (SH-NC), and lncRNA MSTRG.47495.1 knockdown group (SH-1).

[0066] The experimental procedure is as follows: 1. Cell Culture The cells used in the experiment were mBMSCs, purchased from Procell, cultured in DMEM (Gibco) medium supplemented with 15% fetal bovine serum (CellMax) at 37°C and 5% CO2. When the cells reached 80-90% confluence, the mBMSCs were passaged with trypsin (Solarbio) or cryopreserved without the addition of EDTA. Only cells from passage 3 to passage 8 were used for the experiment.

[0067] 2. Cell transfection Shanghai Quanyang Biotechnology Co., Ltd. was commissioned to construct the recombinant overexpression vector of lncRNA MSTRG.47495.1 and package the shRNA into lentiviruses. The resulting recombinant overexpression vector (CMV-lncRNAMSTRG.47495.1-EF1-copGFP-T2A-Puromycin) containing lncRNA MSTRG.47495.1 and the recombinant lentivirus containing shRNA (U6-shMSTRG.47495.1-EF1-copGFP-T2A-Puromycin) were placed in complete culture medium and cultured in mBMSCs at a fusion rate of 20-30% (10 μL / mL). 9The lncRNA MSTRG.47495.1 overexpression group (LV) and knockdown group (SH-1) were constructed using the same method as described above. mBMSCs were infected with recombinant lentivirus containing control empty vector plasmid (CMV-EF1-copGFP-T2A-Puromycin) and empty vector shRNA (U6EF1-copGFP-T2A-Puromycin) to construct the overexpression control group (LV-NC) and knockdown control group (SH-NC). After culturing the four groups of cells for 16 h, the supernatant was replaced with fresh complete medium and cultured for another 72 h. Cells that were not successfully transfected were screened with 20 μg / mL puromycin (Beotenmei). Cells were collected for RNA and protein extraction 48 h later.

[0068] The designed shRNA targeting lncRNA MSTRG.47495.1 and the corresponding negative control were synthesized by Shanghai Quanyang Biotechnology Co., Ltd., and their sequences are shown below; MSTRG.47495.1-shRNA-1 (SEQ ID NO.2): CCGGGCACTAAGTTCGGCATCAACTCGAGTTGATGCCGAACTTAGTGCTTTTTT sh-NC (SEQ ID NO.3): CCGGGATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATCTTTTTTT 3. qRT-PCR was used to detect the expression level of lncRNA MSTRG.47495.1 after transfection. RNA was extracted from cells overexpressing and knocked down with lncRNA MSTRG.47495.1 after 72 h of culture. The extracted RNA was reverse transcribed into cDNA, and the expression level of lncRNA MSTRG.47495.1 in cells overexpressing and knocked down was detected by qRT-PCR according to the method used in Example 1 to verify the success of transfection.

[0069] The expression levels of lncRNA MSTRG.47495.1 in overexpressing and knocked-down cells are as follows: Figure 3As shown in Figure A, the expression level of lncRNA MSTRG.47495.1 in mBMSCs (LV) transfected with lentivirus overexpression was significantly higher than that in mBMSCs (LV-NC) transfected with empty vector control lentivirus; while the expression level of lncRNA MSTRG.47495.1 in mBMSCs (SH-1) transfected with knockdown lentivirus was significantly lower than that in mBMSCs (SH-NC) transfected with non-target control shRNA lentivirus.

[0070] 4. Localization of lncRNA MSTRG.47495.1 To locate lncRNA MSTRG.47495.1, this invention used a nucleocytoplasmic separation kit (BestBio) to isolate and extract nuclear and cytoplasmic RNA from mBMSCs, and detected the expression of lncRNA MSTRG.47495.1 in the above two parts by qRT-PCR.

[0071] The primers used for qRT-PCR detection are shown in Table 3. GAPDH and β-actin were used as cytoplasmic controls, and U6 and MALAT1 were used as nuclear controls. The primers were designed and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0072] Table 3 Primers for qRT-PCR detection

[0073] The results of the nuclear / cytoplasmic localization experiment of lncRNA MSTRG.47495.1 are as follows: Figure 3 As shown in Figure B, lncRNA MSTRG.47495.1 is mainly expressed in the nuclei of mBMSCs.

[0074] 5. Methylthiazole-tetrazole (MTT) test mBMSCs (LV) overexpressing lncRNA MSTRG.47495.1 and the corresponding control group (LV-NC) were seeded into 96-well plates at a density of 3000 cells / well and cultured overnight at 37°C in serum-free medium, in triplicate. 20 μL of MTT solution (5 mg / mL) (Beingmate) was added to each well, and the supernatant was carefully discarded after 24 h of culture. The OD of each well was measured at a wavelength of 450 nm using a microplate reader (TECNA).

[0075] The MTT assay results of cells overexpressing LncRNA MSTRG.47495.1 are as follows: Figure 3As shown in Figure C, the OD value of the cell group overexpressing lncRNA MSTRG.47495.1 was significantly increased, indicating that overexpression of lncRNA MSTRG.47495.1 promoted the proliferation of mBMSCs.

[0076] 6. Alkaline phosphatase (ALP) staining mBMSCs overexpressing lncRNA MSTRG.47495.1 (LV) and their corresponding control group (LV-NC), and mBMSCs with knocked-down lncRNA MSTRG.47495.1 (SH-1) and their corresponding control group (SH-NC), were respectively divided into groups of 2 × 10⁻⁶. 3 Cells were seeded at a density of [number] cells / well in 6-well plates and grown in osteogenic differentiation medium (Procell) for 7 days, with medium changes every 3 days. After induction, cells were fixed with 4% paraformaldehyde, and ALP staining was performed on each group of cells according to the BCIP / NBT alkaline phosphatase chromogenic kit (Beyotime). After the chromogenic reaction was terminated, the cells were observed using an optical microscope (Canon) and photographed. Finally, the photographs were visualized and analyzed using ImageJ software (version 1.52a).

[0077] Results of ALP staining and visualization analysis in cells overexpressing and knocking down LncRNA MSTRG.47495.1 are as follows: Figure 3 As shown in Figure D, overexpression of lncRNA MSTRG.47495.1 significantly promotes osteogenic differentiation of mBMSCs, while knockdown of lncRNA MSTRG.47495.1 inhibits this process.

[0078] The above results indicate that overexpression of lncRNA MSTRG.47495.1 can promote the proliferation of BMSCs and their osteogenic differentiation.

[0079] 7. Detection of osteogenic-related factors expression in mBMSCs (1) RNA extraction and qRT-PCR detection RNA was extracted from lncRNA-overexpressing cells (MSTRG.47495.1) and knockdown cells cultured for 72 h. The extracted RNA was reverse transcribed into cDNA and analyzed by qRT-PCR using a high-throughput quantitative PCR instrument (primers are shown in Table 4). Triple copies were prepared. The expression of osteogenic differentiation-related factors, namely ALP, BMP2, RUNX2, and COL1A1, was detected by qRT-PCR. GAPDH was used as an internal control.

[0080] Table 4 Primers for qRT-PCR detection

[0081] The reaction system consisted of: 5 μL Geneseed® qPCR SYBR® Green Master Mix, 0.2 μL PCR Forward Primer, 0.2 μL PCR Reverse Primer, 0.2 μL template, and 4.4 μL DEPC water. The cycling conditions were: 95°C for 2 min, followed by 40 cycles each of 95°C for 15 s and 60°C for 30 s.

[0082] (2) Western blotting analysis Cells overexpressing lncRNA MSTRG.47495.1, cultured for 48 h, were lysed and knocked down for 15 min using RIPA lysis buffer (Shanghai Baiyoutian Biotechnology Co., Ltd.) containing 10% PMSF. Cells were then centrifuged at 12,500 rpm for 15 min at 4 °C. After removing the supernatant, the protein concentration of each sample was determined using a BCA protein assay kit (Invitrogen). Equal amounts of protein (10–20 μg) from each sample were loaded and separated on 10% glycine SDS-PAGE. The separated proteins were electrotransferred to a 0.2 μm polyvinylidene fluoride (PVDF) membrane at a constant current of 300 mA. The membrane was blocked at room temperature with 5% (w / v) skim milk in a three-phase buffered saline (TBST) containing 0.1% Tween 20 for 60 minutes. After a period of time, the following antibodies, diluted 1:1000, were incubated overnight at 4°C: antibodies: GAPDH (5174S, CST), ALP (CY5421-ABWAYS), BMP2 (ab284387, abcam), RUNX2 (12556S, CST), and COL1A1 (BYmab-17772, Boyan Biotechnology). Incubation was performed in Quick Block™ primary antibody dilution buffer (Shanghai Baiyoutian Biotechnology Co., Ltd.) for Western blotting, followed by incubation with a secondary antibody appropriately bound to horseradish peroxidase. Signals on the membrane were detected using a Bio-Rad Gel Doc XR system, and the reaction bands were quantified and analyzed using ImageJ software (version 1.52a). Protein expression levels were normalized to the GAPDH control.

[0083] The effects of overexpression or knockdown of lncRNA MSTRG.47495.1 on the expression of osteogenic factors ALP, BMP2, RUNX2, and COL1A1 in mBMSCs are as follows: Figure 4 As shown. By Figure 4It can be seen that after overexpression of lncRNA MSTRG.47495.1, the protein and mRNA expression levels of osteogenic factors ALP, BMP2, RUNX2 and COL1A1 were significantly increased. Figure 4 (A, B, and C in the original text). Knockdown of lncRNA MSTRG.47495.1 showed a significant decrease in the expression of osteogenic-related factors (A, B, and C in the original text). Figure 4 (D, E, and F in the text).

[0084] Example 4: Effect of overexpression of lncRNA MSTRG.47495.1 on bone defect repair in vivo 1. Skull defect experiment Dissolve 2 g of GelMA lyophilized powder in 20 mL of PBS solution containing 0.25% LAP by stirring. Digest 3rd to 5th generation BMSCs cells (knockdown and overexpression of lncRNA MSTRG.47495.1 and its control group) with trypsin, wash, and resuspend in the prepared GelMA photocurable hydrogel solution (5 × 10⁻⁶). 6 Prepare it in a container (cells / mL).

[0085] This embodiment used 10 SPF-grade male Sprague-Dawley rats (6 weeks old, weighing approximately 200 g) (Guangdong Vital River Laboratory Animals, Guangdong, China). Two rats were in the LV-NC group, three in the LV group, two in the SH-NC group, and three in the SH-1 group. In the formal experiment, rats were anesthetized with amobarbital and placed in a prone position. The skull area was prepared, disinfected with iodine, draped, and the surgical field exposed. A 3 cm longitudinal incision was made in the rat skull, cutting through the skin, subcutaneous tissue, and muscle-periosteum layer, and flaps were turned. The skull plates were bluntly dissected to expose the skull. Then, a high-speed cranial drill was used to drill two critical bone defects, approximately 4 mm in diameter and 1 mm deep, on both sides of the skull, while maintaining the integrity of the dura mater. During drilling, a syringe filled with sterile saline was used to cool the area to prevent overheating and damage to the brain tissue. Subsequently, 20 μL of 10% GelMA / BMSCs hydrogel solution was slowly dripped into the skull defect area and placed under light intensity of 10 mW / cm². 2 The hydrogel was irradiated under a 405 nm UV lamp for 10 s to check its situ presence; no significant displacement was observed when it was moved. Each rat was injected intramuscularly with 0.8 MU penicillin for 3 consecutive days post-surgery to prevent postoperative infection. Six weeks after surgery, all rats were euthanized by intraperitoneal injection of a lethal dose of amobarbital; skull specimens were collected, fixed in 4% paraformaldehyde (Solarbio, China) at room temperature for 48 h, and then stored in PBS for Micro-CT scanning (Bruker SkyScan 1276, Belgium) and histological analysis.

[0086] 2. Experimental Results In the skull defect experiment, the three-dimensional reconstruction images of the skulls of rats in the group overexpressing lncRNA MSTRG.47495.1 and their corresponding control group are shown below. Figure 5 As shown in Figure A; the three-dimensional reconstruction of the skulls of rats in the lncRNA knockdown MSTRG.47495.1 group and its corresponding control group is shown in Figure A. Figure 5 As shown in Figure B, bone regeneration in the control group rats was limited, mainly at the defect edges, with no bone bridges forming throughout the defect area. Compared to the control, the group overexpressing lncRNA MSTRG.47495.1 showed significant bone formation and integration, while the group knocking down lncRNA MSTRG.47495.1 showed virtually no bone formation or integration.

[0087] In the skull defect experiment, the bone marrow defect (BMD) of rats in the group overexpressing lncRNA MSTRG.47495.1 and its corresponding control group was as follows: Figure 5 As shown in Figure C, the BMD of the group overexpressing lncRNA MSTRG.47495.1 was significantly higher than that of the control group. P <0.0001). BMD in rats with knocked-down lncRNA MSTRG.47495.1 and their corresponding control group was as follows: Figure 5 As shown in Figure D, the BMD of the group with knocked-down lncRNA MSTRG.47495.1 was significantly lower than that of the control group. P = 0.0055). Quantitative data on bone further validated that the repair level in the group overexpressing lncRNA MSTRG.47495.1 was significantly better than that in the control group, while the group knocking down lncRNA MSTRG.47495.1 inhibited bone repair capacity.

[0088] To understand the specific recovery status, this invention also performed histological analyses such as H&E and Masson trichrome staining, and scanned the results.

[0089] In the skull defect experiment, the H&E staining and imaging results of rats in the overexpression and knockdown of lncRNA MSTRG.47495.1 group and their corresponding control group are as follows: Figure 6 As shown in the diagram, in the overexpression control group, fibrous connective soft tissue (ST) formed at the defect site, but very limited regenerated bone tissue (RT) was observed at its edges. In the lncRNA MSTRG.47495.1 overexpression group, denser RT was observed at both the edges and center of the defect. In the knockdown control group, fibrous connective soft tissue (ST) formed at the defect site, but very limited regenerated bone tissue (RT) was observed at its edges. In the lncRNA MSTRG.47495.1 knockdown group, little RT was observed at the edges and center of the defect.

[0090] In the skull defect experiment, the Masson trichrome staining imaging results of rats in the overexpression and knockdown of lncRNA MSTRG.47495.1 group and their corresponding control group are as follows: Figure 7 As shown in the figure. Compared with the overexpression control group, the blue-green collagen area in the lncRNA MSTRG.47495.1 overexpression group was larger and exhibited a reticular interweaving pattern, indicating that the lncRNA MSTRG.47495.1 overexpression group promoted collagen maturation and bone matrix deposition. Furthermore, the central bone defect area (OB, marked with a red triangle) was densely packed, suggesting significantly better osteogenic activity than the control group. Compared with the knockdown control group, the blue-green collagen area in the lncRNA MSTRG.47495.1 knockdown group was smaller and showed significant fiber breakage, indicating that the lncRNA MSTRG.47495.1 knockdown group inhibited collagen maturation and bone matrix deposition. Furthermore, the central bone defect area (OB) was almost nonexistent, suggesting significantly lower osteogenic activity than the control group.

[0091] The above results indicate that overexpression of lncRNA MSTRG.47495.1 can significantly promote osteogenic differentiation and bone formation of BMSCs, thereby promoting bone defect repair, and can provide new targets and treatment options for bone metabolic diseases and bone formation disorders.

[0092] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of an overexpression reagent of a long non-coding RNA in the preparation of a formulation for bone defect repair, wherein the long non-coding RNA is lncRNA MSTRG.47495.1, and its cDNA sequence is shown in SEQ ID NO.

1.

2. The use of an overexpression reagent of a long non-coding RNA in the preparation of a drug for treating osteoporosis, wherein the long non-coding RNA is lncRNA MSTRG.47495.1, and its cDNA sequence is shown in SEQ ID NO.

1.

3. Use according to claim 1 or 2, characterized in that, The overexpression reagent is a recombinant overexpression vector containing the cDNA sequence of the long non-coding RNA.

Images