Molecular marker for early identification of disease resistance traits in tibetan sheep and application thereof

Abstract

The application provides a kind of Tibetan sheep early identification of disease resistance traits molecular marker and its application, belong to Tibetan sheep disease resistance traits detection technical field, the molecular marker is located at the 96165986 th base of international sheep reference genome Oar_v4.0 version chromosome 7;Variation type is G / A, there are three genotypes of GG, GA and AA, the IL-1 alpha, IL-6, TNF-alpha, TNF-beta, IL-1Ra content of the Tibetan sheep individual of the molecular marker site genotype AA is significantly lower than the genotype of GG and GA Tibetan sheep individual, the IL-10 content of the Tibetan sheep individual of the genotype of GG is significantly lower than the genotype of AA Tibetan sheep individual.According to the genotype of the molecular marker site, the content of key cytokine in the Tibetan sheep individual can be determined, which provides a new SNP molecular marker resource for early identification of disease resistance traits of Tibetan sheep.

Description

Technical Field

[0001] This invention belongs to the field of disease resistance detection technology for Tibetan sheep, and particularly relates to a molecular marker for early identification of disease resistance in Tibetan sheep and its application. Background Technology

[0002] Tibetan sheep are a unique and superior livestock breed native to the Qinghai-Tibet Plateau. Adapted to the extreme environments of high altitude, low temperatures, and oxygen deficiency, they are a core breed in local animal husbandry and a vital means of livelihood for herders. In Tibetan sheep farming, disease is a key factor restricting its development. Infections by pathogens such as bacteria and viruses not only lead to increased morbidity and mortality rates but also cause decreased growth performance and reduced reproductive capacity, resulting in significant economic losses to the Qinghai-Tibet Plateau's animal husbandry industry. Therefore, improving the disease resistance of Tibetan sheep is a core requirement for achieving high-quality, efficient, and sustainable development in local animal husbandry.

[0003] Disease resistance is a complex quantitative trait. Traditional breeding methods for disease resistance in Tibetan sheep mainly rely on phenotypic observation and later performance testing, which has drawbacks such as long identification cycles, low accuracy, and poor breeding efficiency. Disease resistance phenotypes in Tibetan sheep usually only appear after infection with pathogens, making it difficult to judge their resistance potential early on based on appearance. Furthermore, phenotypic identification is easily interfered with, resulting in low screening accuracy. Traditional breeding methods require long-term monitoring of Tibetan sheep, with breeding cycles typically lasting several years or even longer, which cannot meet the livestock industry's demand for rapid development of superior disease-resistant breeds.

[0004] Molecular marker-assisted breeding technology is an effective way to solve traditional breeding problems. Among them, single nucleotide polymorphisms (SNPs), as the most widely distributed and genetically stable molecular markers in the genome, are widely used in the genetic improvement and molecular breeding of important economic traits in livestock and poultry due to their advantages such as rapid detection, high accuracy, and ease of high-throughput analysis. Cytokines are important signaling molecules in the immune system, including multiple families such as interleukins (ILs) and tumor necrosis factor (TNF), which participate in regulating the body's inflammatory response, immune cell proliferation and differentiation, and pathogen clearance. Among them, IL-1α and IL-6, as pro-inflammatory cytokines, can activate immune cells and promote the release of inflammatory factors, playing a key role in the early immune response against pathogen infection; TNF-α and TNF-β can regulate the activation and proliferation of immune cells and participate in the regulation of inflammatory responses; IL-1Ra, as an IL-1 receptor antagonist, can competitively inhibit the pro-inflammatory effect of IL-1, maintaining the balance of the body's inflammatory response; IL-10, as an anti-inflammatory cytokine, can inhibit the secretion of pro-inflammatory cytokines, regulate the function of immune cells, and prevent excessive inflammatory responses from damaging the body. The levels of these cytokines directly reflect the body's immune status and disease-fighting potential, and the differences in their expression levels are closely related to individual disease-fighting traits. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a molecular marker for early identification of disease resistance traits in Tibetan sheep and its application.

[0006] This invention provides a molecular marker for early identification of disease resistance traits in Tibetan sheep. The molecular marker is located at 96,165,986 bases on chromosome 7 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A, with three genotypes: GG, GA, and AA. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the AA genotype at the molecular marker site are significantly lower than those with the GG and GA genotypes. The IL-10 level in Tibetan sheep individuals with the GG genotype is significantly lower than that in Tibetan sheep individuals with the AA genotype.

[0007] The present invention provides a DNA molecule comprising the aforementioned molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention provides primer pairs for detecting the genotype of the aforementioned molecular marker, including an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0009] This invention provides a kit for early identification of disease resistance traits in Tibetan sheep, comprising the primer pair and PCR reaction reagents.

[0010] This invention provides a method for detecting the genotype of the aforementioned molecular marker, characterized by comprising the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primer pair to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 147 of the amplification products to determine the genotype of the SNP molecular marker.

[0011] This invention provides the application of the molecular markers, DNA molecules, primer pairs, or kits described herein in the assisted breeding of disease resistance traits in Tibetan sheep.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The molecular marker described in this invention is located at 96,165,986th base on chromosome 7 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A, named g96165986G>A, and there are three genotypes. When the 96,165,986th base on chromosome 7 is G, the genotype is GG or GA; when the 96,165,986th base on chromosome 7 is A, the genotype is AA. Through association analysis between different genotypes and the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10, it was found that the levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the AA genotype were significantly lower than those with the GG and GA genotypes (p<0.05), and the IL-10 level in Tibetan sheep individuals with the GG genotype was significantly lower than that in individuals with the AA genotype (p<0.05). This invention demonstrates that the base at the g96165986G>A SNP site on Tibetan sheep chromosome 7 is a SNP marker related to IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the base at the 96165986th nucleotide site on Tibetan sheep chromosome 7, the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description

[0013] Figure 1 The results of agarose gel electrophoresis for detecting the amplification products of the g96165986G>A SNP site on chromosome 7 of Tibetan sheep, where M is the Marker and 1-3 are three replicates of the amplification product; Figure 2 The peak diagram and sequence of SNP sites obtained after purification and sequencing of PCR amplification products. Detailed Implementation

[0014] This invention provides a SNP molecular marker associated with disease resistance in Tibetan sheep. The SNP molecular marker is located at 96,165,986 bases on chromosome 7 of the International Sheep Reference Genome Oar_v4.0. The variant type is G / A, with three genotypes: GG, GA, and AA. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the AA genotype at the SNP molecular marker site are significantly lower than those with the GG and GA genotypes. The IL-10 level in Tibetan sheep individuals with the GG genotype is significantly lower than that in Tibetan sheep individuals with the AA genotype.

[0015] This invention provides a DNA molecule containing the aforementioned SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.1, specifically as follows (where the bolded and underlined sites are the SNP molecular marker sites): GCAGTCAAGCAGCAACTCCAGAGTCAGCTGTCCAGGCTCTCCCTGGGGCCCTGTCCAGGGCTCCTGGACTTCTCCTTCTGAGTGCACTCTTGGAAACAGCACAAGAAGCATCCATCAGCTTCAACTGGCCCTGCTTCATGAAAACA G GCTGTTGATGACTCAAACCTGGAGTTATGTTACAGAGATGGCACTGGGCATGTGTCAGAAGGGAACTCCTACCTTCGGGATGACCCCAAAACCAAGAGTTTTCTGTGTACAGAACTCAAGGAATAATGTCGCCCTGGAGGAAGCAAAATTCTCTGCAATAAG GAACACGCAGGTTTCCAGAAGCACAAATAGCTTGATGAACTCATTCATAGCTAGCTAATCAGTTTCCAAGTGTGAAGTTCCCCTAAGCTCTTAAATATCACCTCAAATCCTGGATGGAGAGACAGTTTTGAGCCCTGTCTCCTGTGTCCTTGCTGGTAGACCT.

[0016] This invention provides primer pairs for detecting the genotype of the aforementioned SNP molecular marker, including an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3, as detailed below: F: 5'-GCAGTCAAGCAGCAACTCCA-3' (SEQ ID NO. 2); R: 5'-AGGTCTACCAGCAAGGACACA-3' (SEQ ID NO. 3).

[0017] This invention also provides a kit for early identification of disease resistance traits in Tibetan sheep, comprising the aforementioned primer pair and PCR reaction reagent. This invention does not specifically limit the type of PCR reaction reagent; commercially available PCR reaction reagents in the field can be used. In the specific implementation of this invention, the PCR reaction reagent preferably used is Gold Mix (green).

[0018] The present invention also provides a method for detecting the genotype of the SNP molecular marker, comprising the following steps: 1) extracting genomic DNA from the blood of the sample to be tested; 2) using the genomic DNA obtained in step 1) as a template, performing PCR amplification with primers in the kit to obtain amplification products; 3) sequencing the amplification products and analyzing the genotype of the 147th position of the amplification products to determine the genotype of the SNP molecular marker.

[0019] In this invention, genomic DNA is extracted from the blood sample to be tested. The method for extracting the blood genomic DNA is not particularly limited in this invention; conventional genomic DNA extraction methods in the art can be used.

[0020] In this invention, the obtained genomic DNA is used as a template, and PCR amplification is performed using the primers in the kit to obtain amplification products. In this invention, the PCR amplification system is in 25 μL units, preferably comprising: 22 μL of gold-labeled mix (green), 1 μL of upstream primer, 1 μL of downstream primer, and 1 μL of template (genomic DNA). The preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min. After obtaining the amplification products, the amplification products are sequenced, and the genotype at position 147 of the amplification products is analyzed to determine the genotype of the SNP molecular marker. In this invention, the amplification products are preferably sequenced after passing agarose gel electrophoresis. The sequencing is preferably performed using direct sequencing. The nucleotide sequence of the amplification products is shown in SEQ ID No. 1, and the SNP marker is located at position 147 of the nucleotide sequence shown in SEQ ID No. 1. In this invention, the sequencing results of the amplified products are preferably compared using the bioanalysis software MEGA 6.0, the sequencing peak diagram is analyzed, and genotyping is completed.

[0021] This invention also provides the application of the SNP molecular marker, the DNA molecule, the primer pair, or the kit in the assisted breeding of disease resistance traits in Tibetan sheep.

[0022] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0023] Example 1

[0024] 1. Sample collection

[0025] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 77 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 45 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 55 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 177 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.

[0026] 2. Main Reagents and Instruments

[0027] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0028] 3 Methods

[0029] 3.1 Detection of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10

[0030] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) The standard was serially diluted according to the instructions; (2) 100 μL of antibody was added to each well and coated for 2 hours, then the liquid was discarded and the sample was dried; (3) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (4) 200 μL of blocking buffer was added to each well, the mixture was gently shaken and mixed, then the mixture was allowed to stand at room temperature for 30 minutes, then the liquid was discarded and the sample was dried; (5) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (6) 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard were added to each well and the mixture was gently shaken and mixed; (7) (8) Add 100 μL of HRP to each well, shake gently to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, shake gently to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.

[0031] 3.2 Extraction of genomic DNA from blood

[0032] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.

[0033] 3.3 Primer Design

[0034] Based on the gene sequence of chromosome 7 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019464.2), a pair of specific primers containing the g96165986G>A SNP site was designed using Primer Premier 5.0 software.

[0035] Primer sequences: F: 5'-GCAGTCAAGCAGCAACTCCA-3'; R: 5'-AGGTCTACCAGCAAGGACACA-3'.

[0036] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0037] 3.4 PCR amplification and sequencing

[0038] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.

[0039] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0040] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, with a length of 471 bp. The SNP marker is located at position 147 of the nucleotide sequence shown in SEQ ID No. 1.

[0041] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0042] 4. Statistical Analysis

[0043] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the gene frequency, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. Polymorphism information content (PIC) was calculated using PIC software. IBM SPSS Statistics 22 software was used to analyze the association between different genotypes in Tibetan sheep and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 using a general linear model. Results are expressed as mean ± standard error.

[0044] 5 Results

[0045] 5.1 PCR amplification and sequencing results

[0046] The amplification products of the g96165986G>A SNP site on chromosome 7 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 471 bp, which is in line with the expected size, and the next step of the experiment can be carried out.

[0047] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the GA mutation occurs at the g96165986G>ASNP site, resulting in three genotypes: GG, GA, and AA.

[0048] 5.2 Statistical Analysis Results

[0049] Genotype and allele frequencies of the g96165986G>A SNP locus on chromosome 7 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that the AA genotype had the highest frequency at the g96165986G>A SNP locus, indicating it was the dominant genotype, while the A allele frequency was 71.8%, also indicating it was the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.405, and the PIC was 0.323, indicating moderate polymorphism.

[0050] Table 1. Polymorphism of SNP site g96165986G>A on chromosome 7 of Tibetan sheep

[0051] 5.3 Association analysis between different genotypes and IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10

[0052] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep with the AA genotype were significantly lower than those with the GG and GA genotypes (p<0.05), and the IL-10 level in Tibetan sheep with the GG genotype was significantly lower than that in those with the AA genotype (p<0.05). This indicates that the base at the g96165986G>A SNP site on chromosome 7 of Tibetan sheep is a SNP marker related to IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.

[0053] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10.

[0054] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).

[0055] As can be seen from the above embodiments, the SNP molecular marker described in this invention is located at the 96,165,986th base on chromosome 7 of the International Sheep Reference Genome Oar_v4.0. The genotype of the SNP molecular marker is significantly correlated with the content of key cytokines. By detecting the genotype at the 96,165,986th nucleotide site on chromosome 7 of Tibetan sheep, the levels of IL-1α, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined, providing a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of primer pairs or kits for detecting molecular markers of inflammatory factor content in Tibetan sheep in assisted breeding of disease resistance traits in Tibetan sheep, characterized in that, The molecular marker is located at 96,165,986 bases on chromosome 7 of the International Sheep Reference Genome Oar_v4.0; the variant type is G / A, with three genotypes: GG, GA, and AA. The levels of IL-1α, IL-6, TNF-α, TNF-β, and IL-1Ra in Tibetan sheep individuals with the AA genotype at the molecular marker site were significantly lower than those with the GG and GA genotypes, and the IL-10 level in Tibetan sheep individuals with the GG genotype was significantly lower than that in Tibetan sheep individuals with the AA genotype. The primer pair includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3; The disease resistance trait of Tibetan sheep is defined as the content of inflammatory factors.

2. The application according to claim 1, characterized in that, The kit includes the primer pairs and PCR reaction reagents described above.

3. A method for detecting the genotype of a molecular marker for non-diagnostic purposes in Tibetan sheep to assess the levels of inflammatory factors, characterized in that, Includes the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification using the primer pair in claim 1 to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 147 of the amplification products to determine the genotype of the SNP molecular marker.

Images