Application of pcwrky1 gene in improving salt tolerance of plants

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to PcWRKY1 Application of a gene in improving salt tolerance of plants. The gene from Populus trichocarpa PcWRKY1 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the protein is shown as SEQ ID NO. 2. The application overexpresses PcWRKY1 The gene can maintain ion homeostasis by synergistically regulating Na + efflux of root systems, specifically activates an antioxidant defense system to reduce oxidative damage, while maintaining normal growth of root systems under salt stress, thereby comprehensively enhancing salt tolerance of plants.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the PcWRKY1 gene in improving the salt tolerance of plants. Background Technology

[0002] Soil salinization is a major environmental stressor restricting global forestry production and ecological construction. Sodium salt (NaCl) stress causes osmotic pressure imbalance and ion toxicity (especially Na+). ＋ Multiple mechanisms, including sodium accumulation and reactive oxygen species (ROS) bursts, severely affect plant growth and development. Poplar (Populus), an important fast-growing timber and ecological restoration tree species, faces severe challenges in its cultivation in my country's saline-alkali areas. ＋ Once absorbed by the root system, these substances disrupt intracellular ion homeostasis, inhibit key physiological processes, and ultimately lead to stunted growth, reduced biomass, and even death. Although poplars have developed certain salt tolerance mechanisms during evolution, their natural salt tolerance is still insufficient to cope with moderate to severe saline soils, necessitating genetic improvement through molecular breeding.

[0003] Transcription factors are central to plant responses to environmental stress and the regulation of complex gene networks. The WRKY family of transcription factors, as an important class, has been widely recognized for its involvement in plant responses to and adaptations to various abiotic stresses. In the model plant Arabidopsis thaliana, several WRKY members have been identified as key regulators of salt stress response. For example, overexpression of AtWRKY25 enhances salt tolerance in Arabidopsis, and AtWRKY8 and AtWRKY71 have also been reported to positively regulate salt tolerance. In crops, rice OsWRKY54 affects Na+ by directly regulating the expression of OsHKT1;5. ＋ The transport of [something]; soybean GmWRKY16 enhances salt tolerance through the ABA signaling pathway. These studies indicate that WRKY transcription factors play an important role in maintaining ion homeostasis and signal transduction by regulating downstream target genes.

[0004] However, most existing research focuses on herbaceous model plants or crops such as Arabidopsis thaliana and rice. Due to their long growth cycles and complex genetic backgrounds, the functional analysis of WRKY family members in woody plants under salt stress is relatively lagging. While some studies have reported on poplar WRKY genes, they primarily focus on drought and heavy metal stress responses, and do not address how these genes systematically regulate root ion balance (such as Na+) under salt stress. ＋The synergistic mechanism between efflux and antioxidant defense systems (such as SOD and POD activity) remains poorly understood. In particular, it is unknown whether a core WRKY transcription factor can simultaneously integrate both ion homeostasis and redox homeostasis pathways in the important tree species Populus × canescens, and ultimately maintain normal root growth under salt stress.

[0005] Therefore, identifying key WRKY transcription factors in *Populus alba* responding to salt stress revealed that they synergistically enhance root Na+ levels. ＋ The synergistic regulatory mechanism of efflux capacity to maintain ion homeostasis and specific activation of antioxidant enzyme systems to mitigate oxidative damage is of great scientific value for a deeper understanding of the salt adaptation mechanism of woody plants. It also provides key candidate genes and theoretical basis for the precise breeding of salt-tolerant poplar varieties through genetic engineering technology. Summary of the Invention

[0006] In view of the current situation that there is insufficient mining of key salt tolerance genes in woody plants, the sensitivity of poplar (especially gray poplar) to salt stress and the lack of efficient genetic improvement methods, and the fact that existing WRKY transcription factor research is mostly focused on model plants and has limited understanding of how such transcription factors synergistically regulate the physiological mechanism of salt tolerance in forest trees, this invention aims to provide a key salt tolerance transcription factor PcWRKY1 gene derived from gray poplar and its application.

[0007] To address the shortcomings of existing technologies, this invention is achieved through the following solution:

[0008] This invention provides the application of the PcWRKY1 gene or its encoded protein in improving the salt tolerance of plants, wherein the nucleotide sequence of the PcWRKY1 gene is shown in SEQ ID NO.1;

[0009] The amino acid sequence of the protein encoded by the PcWRKY1 gene is shown in SEQ ID NO.2.

[0010] SEQ ID NO.1:

[0011]

[0012] SEQ ID NO.2:

[0013] *

[0014] This invention also provides the application of the PcWRKY1 gene or its encoded protein in enhancing plant salt tolerance by regulating root ion homeostasis and antioxidant defense mechanisms through altering plant root architecture.

[0015] This invention also provides the PcWRKY1 gene or its encoded protein for enhancing the Na+ of plant roots. ＋ Applications in ion efflux.

[0016] This invention also provides the PcWRKY1 gene or its encoded protein for enhancing plant root health. ＋ Applications in ion absorption.

[0017] This invention also provides the application of the PcWRKY1 gene or its encoded protein in enhancing the activity of SOD, POD and CAT in plant roots.

[0018] In this invention, the plant is a woody plant, including plants of the genus *Populus*. In practical application, the plant is preferably *Populus simonii*.

[0019] This invention provides an overexpression vector comprising the PcWRKY1 gene and a vector;

[0020] The vector was obtained by linearizing the pCAMBIA2306 vector with Xba I enzyme.

[0021] The present invention also provides a recombinant Agrobacterium, characterized in that the recombinant Agrobacterium is obtained by transforming Agrobacterium tumefaciens with the above-mentioned overexpression vector.

[0022] This invention provides a method for improving the salt tolerance of plants, characterized in that the method involves overexpressing the PcWRKY1 gene in plants.

[0023] The present invention also provides a method for cultivating salt-tolerant plants, characterized in that the cultivation method includes the following steps:

[0024] Based on the design of specific primers for the PcWRKY1 gene, the PcWRKY1 gene was amplified. The PcWRKY1 gene was then ligated into the pCAMBIA2306 vector linearized by Xba I enzyme to obtain the PcWRKY1 gene overexpression vector. The overexpression vector was transformed into Agrobacterium tumefaciens to obtain recombinant Agrobacterium. The recombinant Agrobacterium was then used to infect plant materials using the stem segment method to obtain salt-tolerant transgenic plants.

[0025] The nucleotide sequences of the specific primers are shown in SEQ ID NO.3 to SEQ ID NO.4.

[0026] SEQ ID NO.3: ATGGCTGCTTCTTCAGGGAG;

[0027] SEQ ID NO. 4: CTACCAAAAACTCTCCACTTCC.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The PcWRKY1 gene was cloned and functionally identified from Populus tomentosa, providing a new gene resource with clear application effects for salt-tolerant breeding of woody plants, filling the gap in the research and application of such key regulatory factors in this tree species.

[0030] (2) This invention confirms that PcWRKY1 functions not through a single pathway, but through a “dual synergistic” mechanism of synergistic regulation of ion homeostasis and synergistic activation of antioxidant defense. This synergistic regulation of ion channels and antioxidant systems constitutes a three-dimensional defense network, comprehensively alleviating salt stress from both the root cause (ion poisoning) and secondary damage (oxidative stress) levels.

[0031] (3) This invention provides a complete technical solution from gene cloning, vector construction to genetic transformation. The solution is mature, reliable and highly reproducible. It is not only applicable to Populus tomentosa, but also provides an effective technical path and gene tool for the salt tolerance genetic improvement of other Populus species and even woody plants. Attached Figure Description

[0032] Figure 1 DNA identification results for PcWRKY1 gene overexpression (a) and silencing (b) lines;

[0033] Figure 2 Results of RNA expression level identification for PcWRKY1 gene overexpression (a) and silencing (b) lines;

[0034] Figure 3 After treatment with 100 mM NaCl for 21 days, the root phenotypes of PcWRKY1-overexpressing, silenced, and wild-type Populus tomentosa are shown in (a) and the root length statistics are shown in (b).

[0035] Figure 4 After treatment with 100 mM NaCl for 21 days, the Na content in the roots of PcWRKY1-overexpressing, silenced, and wild-type poplar plants was significantly reduced. ＋ Flow velocity (a) and H ＋ Flow rate (b);

[0036] Figure 5 After treatment with 100 mM NaCl for 21 days, the Na content in the roots of PcWRKY1-overexpressing, silenced, and wild-type poplar plants was significantly reduced. ＋ content;

[0037] Figure 6 After treatment with 100 mM NaCl for 21 days, the SOD activity of roots of PcWRKY1 overexpressing, silencing and wild-type Populus tomentosa was measured.

[0038] Figure 7 After treatment with 100 mM NaCl for 21 days, the POD activity of roots of PcWRKY1 overexpression, silencing and wild-type Populus tomentosa was determined.

[0039] Figure 8 After treatment with 100 mM NaCl for 21 days, the CAT activity of PcWRKY1 overexpression, silencing, and wild-type Populus tomentosa roots was measured. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0041] Example 1

[0042] Construction of PcWRKY1 gene overexpression and silencing vector

[0043] (1) Construction of PcWRKY1 gene overexpression vector

[0044] Total RNA was extracted from tissue culture seedlings of Populus × canescens using the conventional CTAB method. The RNA was digested with commercially available DNase I to remove genomic DNA contamination, and then first-strand cDNA was synthesized using a reverse transcription kit. Based on published Populus × canescens genome data, specific primers were designed to amplify the PcWRKY1 coding region (CDS). The forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4.

[0045] SEQ ID NO.3: ATGGCTGCTTCTTCAGGGAG;

[0046] SEQ ID NO. 4: CTACCAAAAACTCTCCACTTCC.

[0047] PCR amplification was performed using high-fidelity DNA polymerase. The reaction system (50 μL) contained: cDNA template, forward and reverse primers, dNTPs, high-fidelity enzyme and corresponding buffer.

[0048] The PCR reaction program was set as follows: 94℃ pre-denaturation for 5 minutes; followed by 94℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 35 cycles; and finally 72℃ extension for 10 minutes.

[0049] After the reaction, the product was subjected to 1.0% agarose gel electrophoresis. The target band of approximately 1.8 kb was excised under UV light, and the DNA fragment was purified using a gel extraction kit. The purified product was ligated into the pMD19-T cloning vector and transformed into *E. coli* DH5α competent cells. The cells were then screened using blue-white screening, colony PCR, and sequencing for verification. A recombinant plasmid containing the correct sequence was obtained and named pMD19-T-PcWRKY1.

[0050] Using the pMD19-T-PcWRKY1 plasmid as a template, PCR was performed using primers SEQ ID NO.5 and SEQ IS NO.6. The target fragment was recovered after detection by agarose gel electrophoresis. The pCAMBIA2306 vector was digested with Xba I restriction enzyme at 37℃ for 1 h in a 10 μL volume. The recovered DNA fragment was ligated to the digested linearized vector using homologous recombination. The ligation product was transformed into DH5α *E. coli* via heat shock, and single colonies with normal growth were selected for sequencing. The positive plasmid was transformed into *Agrobacterium* to obtain PcWRKY1-overexpressing recombinant *Agrobacterium*.

[0051] SEQ ID NO.5: CGGTACCCGGGGATCCTCTAGAATGGCTGCTTCTTCAGGGAG;

[0052] SEQ ID NO. 6: GGGCGAATTGGTCGACTGGCCAAAAACTCTCCACTTCC.

[0053] (2) Construction of PcWRKY1 gene interference (RNAi) vector

[0054] To obtain materials for inhibiting the function of the PcWRKY1 gene, its RNA interference vector was constructed. Using the pMD19-T-PcWRKY1 plasmid as a template, two pairs of specific primers were designed. The first pair of primers (SEQ ID NO.7, SEQ ID NO.8) was used to amplify a 269 bp PcWRKY1-specific fragment (sense strand insert), with homologous arms for Asc I and Swa I restriction sites introduced at the 5' ends of the primers, respectively. The second pair of primers (SEQ ID NO.9, SEQ ID NO.10) was used to amplify the antisense strand fragment of the same sequence, with homologous arms for BamHI and Xba I restriction sites introduced at the 5' ends of the primers, respectively.

[0055] SEQ ID NO.7: atttacaattaccatggggcgcgccGATATCCTTGATGATGGGTAC;

[0056] SEQ ID NO.8: acataagaaattcttacacatttaaatGACGGCCTAGTTGCCATTGCC;

[0057] SEQ ID NO.9: gtcaatttgcaggtatttggatccGACGGCCTAGTTGCCATTGCC;

[0058] SEQ ID NO. 10: cgggtcttaattaactctctgaGATATCCTTGATGATGGGTAC.

[0059] The sense and antisense fragments were amplified separately by PCR and then purified. Simultaneously, the linearized RNAi silencing vector pFGC5941 was double-digested with Asc I and Swa I restriction enzymes at 37°C for 1 hour to purify the vector. Using homologous recombination cloning technology, the sense fragment was ligated into the double-digested pFGC5941 vector to construct an intermediate vector. After transformation, screening, and sequencing verification in *E. coli*, the correct intermediate vector plasmid was extracted. Subsequently, the intermediate vector was double-digested with BamHI and Xba I, and the antisense fragment was inserted using homologous recombination technology, ultimately constructing a PcWRKY1 RNAi expression vector capable of transcription to form hairpin structures (hpRNA), named pFGC5941-PcWRKY1-RNAi.

[0060] The recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 competent cells using the heat shock method. The cells were then plated on plates containing the corresponding antibiotics and cultured at 28°C for 2-3 days. Single clones were picked for colony PCR verification to obtain the PcWRKY1 silent recombinant Agrobacterium engineered strain for genetic transformation.

[0061] Example 2

[0062] Creation and Molecular Identification of PcWRKY1 Gene-Transgenic Poplar Plants

[0063] (1) Genetic transformation of Populus tomentosa and screening of resistant plants

[0064] Healthy, sterile poplar stem segments were used as explants. The PcWRKY1-overexpressing and RNAi-silenced recombinant Agrobacterium strain prepared in Example 1 was activated to the logarithmic growth phase (OD600≈0.6~0.8) in YEP liquid medium containing the corresponding antibiotics. The bacterial cells were collected by centrifugation, resuspended in an equal volume of liquid co-culture medium (MS basic salts, 20 g / L sucrose, pH 5.8), and acetylsyleugenone (AS) was added to a final concentration of 100 μM. The culture was then incubated at room temperature for 30 minutes before use.

[0065] Immerse the explants of *Populus glomeratus* in the above-mentioned *Agrobacterium* bacterial solution for an appropriate time (10-15 minutes). After removal, blot off excess bacterial solution with sterile filter paper and place them on a co-culture solid medium (composition same as co-culture liquid medium, with 7 g / L agar added) lined with filter paper. Co-culture at 25°C in the dark for 2-3 days. After co-culture, thoroughly wash the explants with sterile water containing cephalosporin (Cef, 250-500 mg / L) and tmentin (200-300 mg / L) to remove residual *Agrobacterium*, and then transfer them to selection medium for resistant shoot induction.

[0066] The screening medium is prepared as follows (per 1 L):

[0067] Selection medium for overexpression plants: MS basic salts 2.2 g, sucrose 20 g, agar 7 g, pH 5.8. After sterilization, cool to approximately 50℃~55℃, add filtered sterilized 6-benzylaminopurine (6-BA) and naphthaleneacetic acid (NAA) to suitable concentrations (e.g., 0.5 mg / L 6-BA and 0.05 mg / L NAA), and add cephalosporin (100 mg / L), termethin (100 mg / L), and kanamycin (Kan, 50 mg / L) for screening.

[0068] RNAi silencing plant selection medium: except that the selection antibiotic was changed to glufosinate (Basta, such as 10 μL 10% w / v stock solution), the other components were the same as the overexpression selection medium.

[0069] The explants were cultured in a light-controlled culture chamber (25±1℃, 16 hours light / 8 hours dark), and the culture medium was replaced with fresh selection medium every 2 weeks. After about 4 to 8 weeks, resistant adventitious shoots differentiated from the explant cuts.

[0070] (2) Obtaining resistant shoot-rooted and transgenic plants

[0071] When the resistant adventitious shoots grow to 1-2 cm in height, cut them off and transfer them to the appropriate rooting medium for rooting induction.

[0072] The rooting medium is prepared as follows (per 1 L):

[0073] Rooting medium for overexpression plants: 1 / 2 MS basic salts, 20 g sucrose, 7 g agar, pH 5.8. After sterilization, cephalosporin (100 mg / L), termethin (100 mg / L), and kanamycin (25 mg / L) were added.

[0074] RNAi-silenced plant rooting medium: 1 / 2 MS basic salts, 20 g sucrose, 7 g agar, pH 5.8. After sterilization, add cephalosporin (100 mg / L), termethin (100 mg / L), and glufosinate (10 μL 10% w / v stock solution).

[0075] After culturing on rooting medium for 2-4 weeks, robust adventitious roots will grow from the base of the resistant buds, forming complete transgenic plantlets. These rooted seedlings are then transferred to 1 / 2 MS hormone-free medium containing a small amount of antibacterial agent for hardening, and then transplanted into sterilized substrate for greenhouse cultivation.

[0076] (3) Molecular identification of transgenic plants

[0077] Genomic DNA was extracted from the leaves of the resistant plants and wild-type poplar control plants, and positive plants were detected.

[0078] PCR identification of overexpressing plants: Using plant genomic DNA as a template, PCR amplification was performed using vector-specific primers (such as a combination of the 35S promoter primer on the pCAMBIA2306 vector and the PcWRKY1 gene-specific primer) or primers for the resistance gene (NptII, kanamycin resistance). Primer sequences are shown in SEQ ID NO.11 and SEQ IS NO.12. Wild-type plants were used as negative controls, and the pCAMBIA2306-PcWRKY1-OE plasmid was used as a positive control. Plants that amplified bands of the expected size were preliminarily identified as transgenic positive plants. Results are as follows: Figure 1 As shown in (a), Figure 1 In (a), from left to right, are: standard band, PcWRKY1-OE1 strain, PcWRKY1-OE2 strain, PcWRKY1-OE3 strain, wild-type poplar, negative water control group and positive plasmid control group.

[0079] SEQ ID NO.11:ATTGCGATAAAGGAAAGGC;

[0080] SEQ ID NO. 12: AGGAGAAACAGGAGGAGGG.

[0081] RNAi-silenced plant PCR identification: PCR amplification was performed using pFGC5941 vector-specific primers or resistance gene (Bar) primers, following the same method as above. Primer sequences are shown in SEQ ID NO.13 and SEQ IS NO.14. Results are as follows: Figure 1 As shown in (b), Figure 1In (b), from left to right, are: standard band, PcWRKY1-RNAi7 strain, PcWRKY1-RNAi8 strain, PcWRKY1-RNAi9 strain, wild-type poplar, negative control group and positive control group.

[0082] SEQ ID NO.13: CCGACAGTGGTCCCAAAGA;

[0083] SEQ ID NO. 14: CTGCCCTAAGGTCATGTGATG.

[0084] For PCR-positive overexpression and RNAi lines, the transcriptional level of the target PcWRKY1 gene was further detected using quantitative real-time PCR (qRT-PCR). Total RNA was extracted from root, leaf, and other tissues of each line and reverse transcribed into cDNA. Using cDNA as a template, qRT-PCR analysis was performed using PcWRKY1-specific quantitative primers (e.g., SEQ ID NO.15, SEQ ID NO.16) and internal reference genes (e.g., Populus tomentosa Actin2 / 7 gene, primers SEQ ID NO.17, SEQ ID NO.18). Two... -ΔΔCt The method was used to calculate the relative gene expression levels. Primer sequences are shown in SEQ IS NO.15~SEQ IS NO.18. Results are as follows: Figure 2 As shown.

[0085] SEQ ID NO.15: TTGGGGATGATGATTTTGATT;

[0086] SEQ ID NO.16: CTGTTCTGCTGCCAGGTGC;

[0087] SEQ ID NO.17: CCATTGAGCACGGTATTGT;

[0088] SEQ ID NO. 18: TACGACCACTGGCATACAGG.

[0089] Example 3

[0090] Functional analysis of PcWRKY1 gene in synergistic regulation of ion homeostasis and antioxidant defense to enhance salt tolerance in poplar.

[0091] This embodiment analyzes PcWRKY1 gene overexpression, silencing transgenic lines, and wild-type root Na. ＋ and H ＋ Flow rate, Na ＋ The steps for determining the content, root length, SOD, POD, and CAT activities are as follows:

[0092] (1) Transgenic poplar trees were obtained according to the method in Example 2. Three-month-old PcWRKY1 gene overexpression and silencing transgenic lines and wild-type poplar seedlings were used as experimental materials. After treatment with Hoagland nutrient solution containing 100 mM NaCl for 21 days, root length was measured. The results are as follows: Figure 3 As shown, under normal conditions, there was no significant change in root length between transgenic plants and wild-type (WT) plants. When plants were exposed to 100 mM NaCl for 21 days, root length measurements revealed that, compared with WT, salt treatment significantly increased the root length of plants overexpressing PcWRKY1, while the root length of RNAi-interfered transgenic plants was significantly reduced.

[0093] (2) Using 3-month-old hydroponic seedlings of PcWRKY1 gene overexpression, silence transgenic lines, and wild-type poplar lines as experimental materials, after treatment with Hoagland nutrient solution containing 100 mM NaCl for 21 days, the NaCl concentration at 500 μm from the root tip of the PcWRKY1 gene overexpression, silence transgenic lines, and wild-type lines was measured using a non-destructive micro-electrode system based on scanning ion-selective electrode technology. ＋ and H ＋ Flow rate. Specifically, the sample was equilibrated for 15 minutes in the test solution (0.5 mM KCl, 0.1 mM CaCl2, 0.1 mM MgCl2, 0.1 mM NaCl, 2.5% sucrose, pH 5.8). Then, the root tip was fixed under a microscope with filter paper, and a pre-calibrated ion-selective electrode was moved to a distance of 500 μm from the root tip. After the signal stabilized, the NaCl concentration was continuously recorded for 5 minutes. ＋ and H ＋ Flow rate. Detection was performed using the NMT system (NMT-YG-100, Younger USA LLC, Amherst, MA 01002, USA).

[0094] The results are as follows Figure 4 As shown, under normal conditions, the Na content in transgenic plants and wild-type (WT) plants... ＋ External discharge and H ＋ There was no significant difference in influx. However, under salt stress, the Na+ levels in the PcWRKY1-OE1 and PcWRKY1-OE2 lines were significantly different. ＋ External discharge and H ＋ The influx was significantly higher than that of the WT lines. RNAi-interference transgenic plants showed the opposite trend; that is, after 21 days of 100 mM NaCl stress, the NaCl levels in the PcWRKY1-RNAi-7 and PcWRKY1-RNAi-8 lines were significantly lower. ＋ External discharge and H ＋ The influx was significantly lower than that of the WT strain.

[0095] (3) Root samples of PcWRKY1 gene overexpression, silenced transgenic lines, and wild-type poplar were harvested respectively. The Na+ content of transgenic plants and wild-type plants was determined by atomic absorption spectrometry. ＋ Concentration. Specifically, the roots were dried at 70°C for 48 hours, ground into powder, and digested with a nitric acid-sulfuric acid (4:1, v / v) mixture. The extract was filtered, diluted, and quantified using an atomic absorption spectrophotometer (Perkin Elmer AA300, USA). Results are as follows: Figure 5 As shown, under normal conditions, the transgenic plants and wild-type (WT) plants Na ＋ Without significant changes in concentration, exposure of plants to 100 mM NaCl for 21 days revealed that, compared to WT, salt treatment significantly reduced NaCl levels in plants overexpressing PcWRKY1. ＋ Concentration, while RNAi interferes with the Na of transgenic plants ＋ The concentration increased significantly.

[0096] (4) Root samples from PcWRKY1 gene-overexpressing, silenced transgenic lines, and wild-type poplar were harvested and tested using commercial kits for peroxidase (POD) and superoxide dismutase (SOD) activities (Beijing Shengbao Biotechnology Co., Ltd., China). Specifically, plant root tissues were homogenized in pre-cooled PBS buffer, centrifuged, and the supernatant was used as the enzyme solution. POD activity was determined by the guaiacol method, and SOD activity was evaluated by the nitroblue tetrazolium (NBT) photoreduction method. All indicators were tested in triplicate. The results of SOD, POD, and CAT activities are shown below. Figure 6-8 As shown, under normal conditions, there were no significant differences in SOD, POD, and CAT activities between transgenic and wild-type (WT) plants. However, under salt stress, the SOD, POD, and CAT activities of the PcWRKY1-OE1 and PcWRKY1-OE2 lines were significantly higher than those of the WT line. RNAi-interference transgenic plants showed the opposite trend; after 21 days of 100 mM NaCl stress, the SOD, POD, and CAT activities of the PcWRKY1-RNAi-7 and PcWRKY1-RNAi-8 lines were significantly lower than those of the WT line.

[0097] In summary, this embodiment, through comparative analysis of overexpression, silencing of PcWRKY1, and wild-type Populus tomentosa, confirms that under salt stress, overexpression of this gene can significantly enhance root Na+. ＋ External discharge and H ＋ Absorption, reducing Na in roots ＋Accumulation of nutrients and specific enhancement of SOD, POD, and CAT antioxidant enzyme activities ultimately promote root growth, thus synergistically enhancing the plant's salt tolerance from both ion homeostasis and redox balance perspectives. Silencing this gene leads to the opposite phenotype, further validating the key regulatory function of PcWRKY1. The above studies demonstrate that PcWRKY1 synergistically regulates ion homeostasis in Populus tomentosa roots (promoting Na+ absorption). ＋ The key genes for efflux and antioxidant defense (activation of SOD, POD and CAT activity) are found to significantly enhance plant salt tolerance, and their overexpression has important application value in the genetic improvement of poplar stress resistance and the breeding of trees in saline-alkali areas.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Overexpression PcWRKY1 The application of genes in improving plant salt tolerance is characterized by, The PcWRKY1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The application is through overexpression PcWRKY1 Genes to enhance plant root Na + Ion efflux, enhanced H + Ion absorption and enhancement of SOD, POD and CAT activity in plant roots; The plant in question is a grey poplar.

2. A method for improving the salt tolerance of plants, characterized in that, The method involves overexpression in plants. PcWRKY1 Gene; The PcWRKY1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plant in question is a grey poplar.

3. A method for cultivating salt-tolerant plants, characterized in that, The cultivation method includes the following steps: according to PcWRKY1 Gene-specific primers were designed to amplify the gene. PcWRKY1 Genes will PcWRKY1 Genes linked to Xba I Obtained by linearization of the pCAMBIA2306 vector PcWRKY1 Gene overexpression vectors are used to transform Agrobacterium tumefaciens into recombinant Agrobacterium. The recombinant Agrobacterium is then used to infect plant materials using the stem segment method to obtain salt-tolerant transgenic plants. The nucleotide sequences of the specific primers are shown in SEQ ID NO.3 to SEQ ID NO.4; The PcWRKY1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plant in question is a grey poplar.

Images