Sifamide neuropeptide gene and application thereof in promoting growth of vannamei shrimp

Abstract

The present application relates to the field of aquaculture and biotechnology, and particularly relates to a SIFamide neuropeptide gene and its application in promoting the growth of Marsupenaeus vannamei. The SIFamide gene of Marsupenaei vannamei is shown in the nucleotide sequence of SEQ ID NO:1. The application of the SIFamide neuropeptide gene in the growth and intestinal peristalsis of Marsupenaeus vannamei. The nucleotide sequence of the interference fragment for inhibiting the SIFamide neuropeptide gene is shown in SEQ ID NO:4. After the nucleotide sequence (double-stranded RNA) of the interference fragment of the present application is applied to Marsupenaeus vannamei by intramuscular injection, the weight of Marsupenaeus vannamei increases significantly and the intestinal peristalsis frequency is obviously improved under the condition that the expression of the SIFamide gene is inhibited. The method has small damage to Marsupenaeus vannamei and does not affect the normal feeding, molting, habitat and other behaviors of Marsupenaeus vannamei, and the effect is stable.

Description

Technical Field

[0001] This invention relates to the fields of aquaculture and biotechnology, specifically to a SIFamide neuropeptide gene and its application in promoting the growth of Litopenaeus vannamei. Background Technology

[0002] Litopenaeus vannamei ( Litopenaeus vannamei Litopenaeus vannamei is one of the largest farmed shrimp species in my country and globally. Its growth rate and feed utilization efficiency directly affect farming costs and economic benefits. Therefore, effectively regulating the growth performance of Litopenaeus vannamei has always been a key focus of research and industrial application in aquaculture. Current technologies for improving shrimp growth rate mainly rely on optimizing feed formulations, improving farming environmental conditions, and regulating endocrine and neural regulatory factors. Among these, neuropeptides, as important signaling molecules connecting the nervous system with digestion and growth regulation, play a crucial role in rhythm regulation, feeding behavior, and intestinal function regulation. Existing research has shown that various neuropeptides and their receptors participate in the feeding, molting, reproduction, and energy metabolism processes of crustaceans.

[0003] SIFamide is a highly conserved neuropeptide in arthropods, and has been shown to participate in feeding behavior, energy state perception, and central nervous system regulation in insects. However, existing research mainly focuses on model insects, and studies on the function of SIFamide in crustaceans are relatively limited, especially its physiological functions in Litopenaeus vannamei and its applications in aquaculture production, which lack systematic reports.

[0004] RNA interference (RNAi) is a gene expression silencing mechanism mediated by double-stranded RNA. It regulates the expression level of target genes by inducing the specific degradation of target gene mRNA. This technology is characterized by high specificity, relatively simple operation, and good reversibility, and has been widely used in functional gene research and the regulation of organismal traits. Summary of the Invention

[0005] The purpose of this invention is to provide a SIFamide neuropeptide gene and its application in promoting the growth of Litopenaeus vannamei.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A SIFamide neuropeptide gene, the SIFamide gene of Litopenaeus vannamei is shown in the nucleotide sequence of SEQ ID NO:1.

[0007] An application of the SIFamide neuropeptide gene, specifically its application in the growth and intestinal peristalsis of Litopenaeus vannamei.

[0008] The SIFamide neuropeptide gene is used in the preparation of formulations to promote the growth and intestinal motility frequency of Litopenaeus vannamei.

[0009] Application of inhibiting the expression of the SIFamide neuropeptide gene in promoting the growth and intestinal peristalsis of Litopenaeus vannamei.

[0010] A nucleotide sequence of an inhibitory fragment of the SIFamide neuropeptide gene, which inhibits the SIFamide neuropeptide gene, is shown in SEQ ID NO:4.

[0011] The nucleotide sequence of the double-stranded RNA that inhibits the SIFamide neuropeptide gene is shown in SEQ ID NO:5.

[0012] An application of the SIFamide neuropeptide gene inhibitor, wherein the SIFamide neuropeptide gene inhibitor is used in the preparation of a formulation for promoting the growth and intestinal motility frequency of Litopenaeus vannamei.

[0013] A method to promote growth and intestinal motility frequency in Litopenaeus vannamei involves injecting double-stranded RNA containing an interfering fragment of the SIFamide neuropeptide gene into the shrimp.

[0014] The injection dose of the double-stranded RNA is 1–4 μg per gram of body weight.

[0015] Compared with the prior art, the present invention has at least the following beneficial effects: This invention reveals the negative regulatory role of the SIFamide gene in growth regulation and intestinal peristalsis regulation in Litopenaeus vannamei, providing new technical basis for the study of shrimp neuropeptide function; By inhibiting the expression or function of the SIFamide gene, the growth of Litopenaeus vannamei can be significantly promoted, which has good value for aquaculture applications. The technical solution described in this invention has a clear target and stable regulatory effect, and can be used as a new technical means to regulate the growth performance of Litopenaeus vannamei, with good prospects for promotion and application. Attached Figure Description

[0016] Figure 1 The agarose gel electrophoresis results of the full-length cDNA of the SIFamide gene in Litopenaeus vannamei are used to verify the expected size of the amplified fragment and the specificity of the PCR product.

[0017] Figure 2 Electrophoresis diagrams of SIFamide dsRNA synthesized in vitro after RNase digestion and transcription, and EGFP control dsRNA from Litopenaeus vannamei.

[0018] Figure 3 This diagram illustrates the structure of the SIFamide gene in Litopenaeus vannamei and its RNA interference targeting region. The solid lines represent the open reading frame (ORF) region of the SIFamide gene, while the shaded areas represent the targeting fragments used to synthesize double-stranded RNA.

[0019] Figure 4 This study investigated the changes in the relative expression level of the SIFamide gene in Litopenaeus vannamei after RNA interference treatment for different durations. Using the control group as a baseline, the relative expression level of the SIFamide gene in Litopenaeus vannamei after RNA interference treatment was detected by qRT-PCR.

[0020] Figure 5 This study investigated the weight and body length growth of Litopenaeus vannamei after RNA interference with the SIFamide gene. The changes in weight and body length of Litopenaeus vannamei in the control group and the RNA interference treatment group were compared during the experimental period.

[0021] Figure 6 This study investigated the changes in intestinal peristalsis frequency in Litopenaeus vannamei after RNA interference with the SIFamide gene. The number of intestinal peristalsis events per unit time was recorded and compared between the control group and the RNA interference treatment group. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in detail below with reference to the accompanying drawings and specific embodiments. The described embodiments are merely some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0023] The nucleotide sequence of the SIFamide neuropeptide encoding gene in Litopenaeus vannamei is shown in SEQ ID NO:1. RNA interference primers were designed based on the open reading frame of the SIFamide gene in Litopenaeus vannamei using RNA interference technology. Total cDNA from Litopenaeus vannamei was used as a template for PCR amplification to obtain the interfering fragment, the nucleotide sequence of which is shown in SEQ ID NO:4. Double-stranded RNA was further synthesized through in vitro transcription. Experimental results showed that when the double-stranded RNA was administered to Litopenaeus vannamei via intramuscular injection, the shrimp exhibited significantly faster weight gain and a markedly increased intestinal motility frequency, even with suppressed SIFamide gene expression. This method causes minimal damage to Litopenaeus vannamei, does not affect its normal feeding, molting, or habitat behaviors, and has a stable effect. This invention provides a novel growth regulation technology for Litopenaeus vannamei aquaculture and has promising application prospects.

[0024] Example 1: Preparation of interference fragment of SIFamide gene in Litopenaeus vannamei Total RNA extraction: Healthy Litopenaeus vannamei individuals were selected, and intestinal tissue was removed by aseptic dissection scissors. Total RNA was extracted from the intestines in RNA preservation solution (TaKaRa BioInc. Japan). The specific operation steps were as follows: Takara Trizol kit.

[0025] First-strand cDNA synthesis: The total RNA described above was reverse transcribed using the Takara M-MLV reverse transcription kit to obtain the first-strand cDNA.

[0026] Obtaining the full-length cDNA of the SIFamide gene in Litopenaeus vannamei: Based on the data of Litopenaeus vannamei submitted by our research group to NCBI ( Litopenaeus vannamei Using the full sequence recorded in the GenBank database (GenBank assembly: GCA_003789085.1), a pair of amplification primers were designed (see SEQ ID NO:6 and SEQ ID NO:7). The intermediate fragment was cloned using the first-strand cDNA as a template, and the PCR amplification reaction system is shown in Table 1.

[0027] Table 1 PCR amplification reaction system

[0028] The PCR reaction program was as follows: pre-denaturation at 94℃ for 3 min, followed by the following cycles: 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 35 cycles, with a final extension at 72℃ for 10 min, and storage at 4℃. Detection was performed by 1% agarose gel electrophoresis (see [link to relevant documentation]). Figure 1 ).

[0029] The target fragment was recovered using a column-based DNA gel extraction kit from Sangon Biotech Co., Ltd. (Shanghai). The product was ligated into the pMD18-T vector (Takara) and transformed into E. coli DH5α. After amplification and culture of single white-spot clones, the positive clones with inserted target fragments were sent to Sangon Biotech Co., Ltd. for sequencing analysis to obtain the full-length cDNA of the Litopenaeus vannamei SIFamide gene, as shown in SEQ ID NO:1.

[0030] Obtaining the dsRNA (double-stranded RNA) of the SIFamide gene in Litopenaeus vannamei: Based on the cloned Litopenaeus vannamei SIFamide gene, the open reading frame (ORF) of the SIFamide gene was determined to be 132-362 bp as shown in SEQ ID NO:1 using NCBI online sequence analysis software (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). Based on this result, dsRNA primers were designed within the SIFamide ORF using online dsRNA primer design software (https: / / www.primer3plus.com / ). The T7 promoter sequence 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO:8) was added to the front of each primer to form dsRNA synthesis primers. The primer sequences are SEQ ID NO:2 for the upstream primer and SEQ ID NO:3 for the downstream primer. All primers were sourced from Sangon Biotech Co., Ltd.

[0031] The above-mentioned Litopenaeus vannamei dsRNA primers were used to amplify total cDNA from Litopenaeus vannamei using PCR (under the same conditions as above), yielding SEQ ID NO:4. After purification using Sangon Biotech's SanPrep column PCR product purification reagent, dsRNA was synthesized in vitro by transcription according to the TranscriptAid "T7 High Yield Transcription kit" (Fermentas, Inc., USA) instructions, with the sequence shown in SEQ ID NO:5. The obtained dsRNA was digested and purified using RNase (see [link to kit]). Figure 2 The concentration was diluted to 2 μg / μl with PBS solution.

[0032] Depend on Figure 2 As can be seen, after digestion with RNase A, the main band showed no significant degradation, indicating that single-stranded RNA (ssRNA) and non-specific DNA-RNA hybrid molecules were effectively removed. The obtained dsRNA had high purity and good integrity, which can meet the requirements of subsequent RNA interference experiments for the quality and functional reliability of double-stranded RNA. Figure 3 ).

[0033] Example 2: RNA interference treatment and SIFamide gene expression detection Sixty healthy Litopenaeus vannamei shrimp with a body weight of 2.00±0.35g were selected and randomly divided into a control group and an RNA interference treatment group. Each group had three replicates, with 10 shrimp per replicate. The injection dose was 2μg SIFamidedsRNA (SEQ ID NO:5, diluted to 2μg / μl) per gram of body weight.

[0034] The RNA interference treatment group was administered dsRNA prepared in Example 1 to Litopenaeus vannamei via intramuscular injection, while the control group was injected with the same concentration of EFGP.

[0035] Intestinal tissues of shrimp were collected 1, 3, and 5 days after injection. Total RNA was extracted and reverse transcribed into cDNA. The relative expression level of the SIFamide gene in Litopenaeus vannamei was detected by real-time quantitative PCR (qRT-PCR).

[0036] Test results as follows Figure 4 As shown, compared with the control group, the expression level of SIFamide gene in Litopenaeus vannamei in the RNA interference treatment group remained at a low level, indicating that dsRNA has a good interference effect on the target gene.

[0037] Example 3: Effects of RNA interference on growth and intestinal motility frequency in Litopenaeus vannamei Based on the RNA interference treatment dosage and corresponding time in Example 2, 120 healthy Litopenaeus vannamei shrimp with a body weight of 2.30±0.35g were selected and randomly divided into a control group and an RNA interference treatment group. The injection dosage was 2μg per gram of body weight, with three replicates per group and 30 shrimp per replicate. The experiment lasted for 25 days, with dsRNA injected every 5 days. Afterward, the Litopenaeus vannamei shrimp in both the control group and the RNA interference treatment group were continuously fed.

[0038] Shrimp body weight was recorded before and after the experiment to assess the effect of RNA interference with SIFamide gene expression on Litopenaeus vannamei growth.

[0039] During the experiment, the intestinal peristalsis of Litopenaeus vannamei in the control group and the RNA interference treatment group was observed and recorded. By recording the number of intestinal peristalsis events per unit time under the same conditions, the differences between the control group and the RNA interference treatment group were compared to assess the changes in shrimp intestinal function after the inhibition of SIFamide gene expression.

[0040] Experimental results: The weight gain of Litopenaeus vannamei in the RNA interference treatment group was significantly different from that in the control group, such as... Figure 5 As shown, the growth rate of the interference-treated group was significantly faster, increasing by 40% compared to the control group. The intestinal peristalsis frequency of Litopenaeus vannamei in the RNA interference-treated group was significantly different from that in the control group. Results are as follows... Figure 6 As shown, the intestinal peristalsis speed in the interference treatment group was significantly faster, increasing by 20% compared to the control group.

[0041] The results above show that, compared with the control group, after a single injection of dSRNA at a dose of 2 μg per gram of body weight, the expression level of SIFamide in Litopenaeus vannamei decreased significantly. This interference effect lasted for a long time, and the difference was still significant on day 5.

[0042] As can be seen from the above, the dsRNA of the SIFamide gene in Litopenaeus vannamei provided by the present invention can significantly promote the growth rate of Litopenaeus vannamei and increase the frequency of intestinal peristalsis, providing a new growth regulation technology solution for Litopenaeus vannamei farming.

[0043] SEQID NO:1 GGTATATAAACAGGTGTCGCGGCACTCCAGGCCACTCCACGTTCACTCCCGAGTCTGCACAGTCCAGCCACCCAGCGTCTAGCCTGGTTCTCACACCGTCTCACACACCCAGACTCACGTGGTCCTCCAGAATGTCCGTTCAAGCCCGAGTCGTGTTGGCCGTCGCCCTCGTCCTCGTCGTCCTGGCCGTGTTCACCGAGCCCGTATCCGCCGGGTACAGGAAACCCCCCTTCAACGGATCCATCTTCGGAAAGCGCTCCGGCGGCGATGCTGTCTACGAACCCAGCAAGGCCCTCGCCTCTGCCTGCCAGATCGCTGTTGAGGCCTGCGCTGGCTGGTTCCCCGGACCCGAAAAGAAGTGAATTACTTATAATGAATAAGGCGAGTTACCCATACGCCGCAGATTCACGACCCACGTTTTCTCTGACCTTTTGATCTGAGCGGCGGATGTAAACAATTCTAGAATTCCTCGACAAGTCTCCATGTTTTCCATCATTTGGTGTATTACAGAAAAAAAATAATAATATGGATGTAAATCAATAGCCAACTCCTGTTTATATTCGCCGTACATATTTATCCTCAATATCTAATTGATTATTTGATTCTCTTTATACGGAAAATACGGCCATCATATACTATGTCGCAATGCTCACTTTGGGGCTTTGTTTACATTTTAGATGTTGGGCCCCTCAGTAAGGATAATGTCAATGACAGTTTTCCCAAATAAAACGAAGTCCCAAAATCTATAACAAAAATAAATCCAACCTCTGCCCTCCCCATACAGTACCATTGTCAGAGAATAAATGTATTTGTTGTAAGAATATGTGGATAATTTTGTGATTAGATATTAGATACACTGATGAATGTAATAACGTTGACTCATAAATAAACGTGGAATACTGCCTACGAAATTCAATAAACTACTATCGAGCTAA。

[0044] SEQID NO:2 TAATACGACTCACTATAGGGATGTCCGTTCAAGCCCGAGT。

[0045] SEQID NO:3 TAATACGACTCACTATAGGGTCACTTCTTTTCGGGTCCGG。

[0046] SEQID NO:4 TAATACGACTCACTATAGGGATGTCCGTTCAAGCCCGAGTCGTGTTGGCCGTCGCCCTCGTCCTCGTCGTCCTGGCCGTGTTCACCGAGCCCGTATCCGCCGGGTACAGGAAACCCCCCTTCAACGGATCCATCTTCGGAAAGCGCTCCGGCGGCGATGCTGTCTACGAACCCAGCAAGGCCCTCGCCTCTGCCTGCCAGATCGCTGTTGAGGCCTGCGCTGGCTGGTTCCCCGGACCCGAAAAGAAGTGACCGGACCCGAAAAGAAGTGACCCTATAGTGAGTCGTATTA。

[0047] SEQID NO:5 UAAUACGACUCACUAUAGGGAUGUCCGUUCAAGCCCGAGUCGUGUUGGCCGUCGCCCUCGUCCUCGUCGUCCUGGCCGUGUUCACCGAGCCCGUAUCCGCCGGGUACAGGAAACCCCCCUUCAACGGAUCCAUCUUCGGAAAGCGCUCCGGCGGCGAUGCUGUCUACGAACCCAGCAAGGCCCUCGCCUCUGCCUGCCAGAUCGCUGUUGAGGCCUGCGCUGGCUGGUUCCCCGGACCCGAAAAGAAGUGACCGGACCCGAAAAGAAGUGACCCUAUAGUGAGUCGUAUUA。

[0048] SEQID NO:6 TGTCCCCTGGAGCATCC。

[0049] SEQID NO:7 TTATCTCTGATACTCGTTTCCCA。

Claims

1. Double-stranded RNA that inhibits the SIFamide neuropeptide gene, characterized in that: Total cDNA from Litopenaeus vannamei was used as a template for PCR amplification. The upstream primer for the PCR amplification is shown in SEQ ID NO:2, and the downstream primer is shown in SEQ ID NO:

3. The amplified fragment has the nucleotide sequence shown in SEQ ID NO:

4. The fragment was then transcribed into double-stranded RNA in vitro.

2. Use of a double-stranded RNA inhibiting the gene of the SIFamide neuropeptide according to claim 1, characterized in that: The application of the double-stranded RNA that inhibits the SIFamide neuropeptide gene in the preparation of a formulation for promoting the growth and intestinal motility frequency of Litopenaeus vannamei.

3. A method for promoting the growth of Litopenaeus vannamei, characterized in that: The double-stranded RNA that inhibits the SIFamide neuropeptide gene as described in claim 1 was administered to Litopenaeus vannamei via injection.

4. The method according to claim 3, characterized in that: The injection dose of the double-stranded RNA is 1–4 μg per gram of body weight.

Images