Application of heterologous overexpression of UvHsbA gene in improving disease resistance of rice

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of heterologous overexpression of UvHsbA gene in improving disease resistance of rice. The application initiatively introduces the UvHsbA gene of a pathogenic fungus Ustilaginoidea virens into rice to realize overexpression, and develops a new use of the UvHsbA gene in improving disease resistance of rice. Overexpression of the UvHsbA gene in rice can significantly improve the resistance of rice to rice sheath blight, rice blast, sheath blight and white leaf blight, and does not affect the agronomic characters of rice, thereby providing a new gene resource and a key technical means for breeding of disease-resistant rice, especially directional breeding of broad-spectrum and durable resistant varieties, and having great theoretical and practical significance for reducing use of pesticides, guaranteeing high and stable yield of rice and food safety.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of heterologous overexpression of the UvHsbA gene in improving disease resistance in rice. Background Technology

[0002] Rice is one of my country's most important food crops, and its safe production is of great significance to national food security and social stability. Rice blast is a widespread fungal disease of rice, and in recent years it has shown an increasing prevalence in major rice-growing areas of my country. This disease not only directly leads to rice yield loss, but the rice blastotoxin produced by its pathogen can also contaminate rice, posing a potential threat to human and animal health, and has become one of the important factors restricting the high-quality and safe production of rice.

[0003] Currently, the control of rice false smut still relies mainly on chemical pesticides. However, long-term use of pesticides can easily lead to increased pesticide resistance in pathogens, environmental pollution, and pesticide residues in rice. In terms of genetic breeding, traditional disease-resistant breeding mainly relies on hybridization and phenotypic selection to introduce resistance genes from existing rice genetic resources into cultivated varieties. However, this method has limitations such as a long cycle and low efficiency. More importantly, highly efficient rice false smut-resistant gene resources available in nature are relatively scarce, and known resistance genes often have a narrow resistance spectrum, easily losing resistance due to variations in the physiological races of the pathogen, making it difficult to achieve a long-lasting and broad-spectrum resistance effect.

[0004] Therefore, how to overcome the limitations of existing disease-resistant genetic resources, utilize modern biotechnology to discover and utilize novel disease-resistant genes, and establish efficient, environmentally friendly, and sustainable new strategies for breeding disease-resistant rice has become a key technical problem urgently needing to be solved in this field. Through techniques such as heterologous gene overexpression, precise regulation of rice disease-resistant genetic pathways provides a potential pathway for creating new rice materials with novel disease-resistant mechanisms, which has significant application value for improving the disease resistance of rice varieties, reducing dependence on chemical pesticides, and ensuring food security and quality. Summary of the Invention

[0005] This invention addresses the limitations of existing rice disease resistance breeding technologies, such as limited resistance gene resources and a single resistance spectrum, by providing a novel strategy for improving rice resistance based on pathogen-derived genes. Through heterologous overexpression of the UvHsbA gene from *Aspergillus oryzae* in rice, the resulting transgenic rice exhibits significantly enhanced resistance to rice false smut, rice blast, sheath blight, and bacterial blight, without affecting agronomic traits. This demonstrates that heterologous overexpression of the UvHsbA gene provides strong resistance while maintaining good biocompatibility and agronomic compatibility. This invention provides novel gene resources and key technological means for rice disease resistance breeding, particularly for the targeted cultivation of broad-spectrum, durable resistant varieties. The transgenic rice materials created using this technology can be directly used as superior disease-resistant parents in hybridization breeding, and can also serve as model materials for in-depth analysis of plant-pathogen interaction mechanisms, possessing significant theoretical and practical implications for reducing pesticide use, ensuring high and stable rice yields, and safeguarding food security.

[0006] One of the objectives of this invention is to provide the application of the UvHsbA gene of Aspergillus oryzae in any of the following: A1) Application in improving disease resistance in rice; A2) Application in the preparation of products that enhance the disease resistance of rice; A3) Application in the cultivation of transgenic rice with enhanced disease resistance; A4) Application in the preparation of transgenic rice products with enhanced disease resistance; The amino acid sequence encoded by the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.2.

[0007] Furthermore, by heterologously overexpressing the UvHsbA gene of Aspergillus rice in rice, the disease resistance of rice can be improved or transgenic rice with improved disease resistance can be cultivated.

[0008] Furthermore, the CDS sequence of the UvHsbA gene of Aspergillus rice is shown in SEQ ID NO.1.

[0009] Furthermore, the disease resistance includes resistance to *Ustilaginoidea virens*, *Rhizoctonia solani*, *Magnaporthe oryzae*, and / or *Xanthomonas oryzae pv. oryzae*.

[0010] The second objective of this invention is to provide the application of an overexpression vector containing the *Aspergillus oryzae* UvHsbA gene in any of the following A1)-A4): A1) Application in improving disease resistance in rice; A2) Application in the preparation of products that enhance the disease resistance of rice; A3) Application in the cultivation of transgenic rice with enhanced disease resistance; A4) Application in the preparation of transgenic rice products with enhanced disease resistance; The amino acid sequence encoded by the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.2.

[0011] Furthermore, the skeletal carrier of the vector is the expression vector pEXT06f.

[0012] Furthermore, the method for constructing a vector containing the UvHsbA gene of Aspergillus oryzae includes: amplifying the cDNA of Aspergillus oryzae using primers as shown in SEQ ID NO.3-4 to obtain the UvHsbA gene fragment as shown in SEQ ID NO.1, and ligating it into the expression vector pEXT06f using homologous recombinase to obtain the overexpression vector pEXT06f-UvHsbA.

[0013] The third objective of this invention is to provide a method for improving the disease resistance of rice or cultivating transgenic rice with improved disease resistance, by transforming an overexpression vector containing the UvHsbA gene of Aspergillus rice into rice to obtain transgenic rice.

[0014] Furthermore, an overexpression vector containing the UvHsbA gene of Aspergillus oryzae was transformed into Agrobacterium tumefaciens, and then transformed into rice using an Agrobacterium tumefaciens-mediated genetic transformation system, thereby improving the disease resistance of rice or obtaining transgenic rice with improved disease resistance.

[0015] Beneficial effects: This invention breaks through the limitations of traditional disease resistance breeding that relies solely on the plant's own resistance gene resources. It innovatively introduces the UvHsbA gene from the pathogen *Aspergillus oryzae* into rice and achieves overexpression, developing a new application for improving rice disease resistance. This opens up a completely new and extremely rich gene resource library for disease resistance breeding in rice and other crops, solving the problem of scarce disease resistance gene sources. Research has shown that heterologous overexpression of UvHsbA in rice not only does not affect agronomic traits such as plant height, tiller number, thousand-grain weight, and seed setting rate, but also significantly enhances the broad-spectrum resistance of transgenic rice to multiple pathogens such as *Aspergillus oryzae*, *Bacillus thuringiensis*, *Sheath blight*, and bacterial leaf blight, greatly expanding the adaptability of varieties and reducing the difficulty and cycle of breeding that requires the aggregation of multiple disease resistance genes for different diseases. The UvHsbA gene and its expression vector can be directly used for transgenic rice breeding, significantly improving the accuracy and efficiency of disease resistance breeding and shortening the breeding cycle. The genetically modified rice materials created can be directly used as superior disease-resistant parents for hybridization breeding, and can also serve as model materials for in-depth analysis of plant-pathogen interaction mechanisms. This has significant theoretical and practical implications for reducing pesticide use, ensuring high and stable rice yields, and safeguarding food security. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This document presents a statistical analysis of the growth and development phenotypes of rice plants heterologously overexpressing the UvHsbA gene in this embodiment of the invention. Figure A shows the Western blotting analysis of UvHsbA-Flag protein expression in UvHsbA heterologously overexpressing rice plants. Figures BC show the field growth morphology of control (EV) and UvHsbA heterologously overexpressing (HE-8 and HE-11) rice plants, including images and statistical data on effective tiller number, plant height, thousand-grain weight, and seed setting rate. Lowercase letters indicate P < 0.05 in the statistical analysis.

[0018] Figure 2This invention presents an analysis of the disease resistance of rice plants heterologously overexpressing the UvHsbA gene in this embodiment. Figure A shows the resistance analysis of control and UvHsbA heterologously overexpressing rice plants to rice false smut. Figure B shows the resistance analysis of control and UvHsbA heterologously overexpressing rice plants to sheath blight. Figure C shows the resistance analysis of control and UvHsbA heterologously overexpressing rice plants to rice blast. Figure D shows the resistance analysis of control and UvHsbA heterologously overexpressing rice plants to bacterial blight. Lowercase letters indicate P < 0.05 in statistical analysis. Detailed Implementation

[0019] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0020] Example This invention cloned and identified a protein encoding the fungal cell wall UvHsbA from *Aspergillus oryzae*. The CDS fragment of this gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. Studies have found that heterologous overexpression of this gene in crops such as rice can significantly improve the resistance of rice to multiple pathogens, resulting in broad-spectrum disease-resistant rice varieties. Details are as follows: 1. Preservation and culture of the tested strains and plants. (1) The Aspergillus oryzae used in this invention is the wild-type strain HWD-2, which was provided by our laboratory.

[0021] (2) The rice variety used in this invention is Zhonghua 11 (ZH11), which can be purchased from the International Rice Research Institute (IRRI) and serves as the background plant for the genetic transformation of rice in this invention.

[0022] (3) The Escherichia coli strain TOP10 and Agrobacterium tumefaciens strain EHA105 used in this invention were purchased from Beijing TransGen Biotech Co., Ltd.

[0023] 2. Construction of the overexpression vector for the UvHsbA gene of Aspergillus oryzae and its transformation in rice. The primers shown in SEQ ID NO.3-4 were designed to amplify the coding sequence of the UvHsbA gene, specifically as follows: F (SEQ ID NO.3): ACGGGGGACAAGCTTGGTACCATGAAGTTCTTCAGCTCCGTCATC R (SEQ ID NO.4): GTCTTTGTAGTCCATACTAGTAAACTCCAGGGAAGGCTTGC Using wild-type cDNA of Aspergillus oryzae as a template, PCR amplification was performed using a high-fidelity enzyme. The PCR reaction system consisted of: 10× buffer 10.0 µL, 2.5 mM dNTPs 8.0 µL, Primer STAR Taq enzyme (Takara) 1.0 µL, template cDNA 4.0 µL, forward and reverse primers 5.0 µL each (primer concentration 10 μM), and water added to a final volume of 100 µL.

[0024] The PCR amplification program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 1 kb / 1 min, for 34 cycles; and 72℃ extension for 6 min.

[0025] Finally, the PCR amplification products were separated by nucleic acid electrophoresis on a 1% agarose gel. After staining with nucleic acid dye, the gel was photographed under UV light, the results were recorded, and the UvHsbA gene PCR product was recovered by gel excision. The electrophoretic bands were recovered using the Axygen gel recovery kit. The UvHsbA gene coding sequence as shown in SEQ ID NO.1 was obtained. The recovered UvHsbA gene PCR product was ligated into the XbaI / SpeI double-digested pEXT06f vector (purchased from Changzhou Baige Biotechnology Co., Ltd., the vector contains the CaMV 35S promoter) using a universal biological homologous recombinase to obtain the overexpression vector pEXT06f-UvHsbA carrying the UvHsbA gene.

[0026] The empty vector pEXT06f and the overexpression vector pEXT06f-UvHsbA plasmid were transformed into Agrobacterium EHA105 by electroporation, and then transformed into rice ZH11 using the Agrobacterium-mediated genetic transformation (ATMT) system. The rice transformation was performed by Wuhan Tianwen Biotechnology Co., Ltd. The specific steps are as follows: (1) Seed disinfection and callus induction: Prepare sterile induction medium in advance. Pour 50 mL of induction medium into a 100 mL Erlenmeyer flask. Peel off the seed husks and, under sterile conditions, soak the seeds in 75% ethanol for 1 min, then soak them in 0.15% HgCl2 for 25 min, and finally wash them 10 times with sterile ddH2O. Inoculate 12 seeds into each flask of medium and culture them in the dark for 50 days to induce callus formation.

[0027] (2) Subculture of callus: Prepare subculture medium 3 days in advance, sterilize it and dry the medium. Select pale yellow, granular, dry and viable callus from the induced callus and transfer it into subculture medium for dark culture for 20 days.

[0028] (3) Infection and co-culture: The Agrobacterium tumefaciens cultured by streaking was scraped into the suspension medium (100 μL AS, 2 mL 50% glucose added), and incubated at 28℃ and 200 r / min for 30 min until it became slightly turbid (OD). 600 (≈0.4). While shaking the bacteria, collect the callus tissue into a 250 mL sterile Erlenmeyer flask, pour the Agrobacterium tumefaciens bacterial solution into the callus tissue, soak for 30 min, then discard the bacterial solution and allow the callus tissue to air dry for 4 h. Pour the solution into a co-culture dish, evenly spread the fully dried callus tissue onto the co-culture medium using a spoon, seal with sealing adhesive, and incubate in the dark at 19°C for 3 days.

[0029] (4) Washing: Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 30 seconds, then discard the sterile distilled water. Repeat this process 3 times. Add sterile distilled water until the callus is completely submerged, cover and shake vigorously for 30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake vigorously for 30 seconds, then let stand for 10 minutes. Allow the washed callus to air dry for 3 hours. Pour the culture dish into a screening dish, spread the fully dried callus evenly onto the co-culture medium with a spoon, and seal with sealing glue.

[0030] (5) Screening: Prepare screening medium. Select dry callus tissues that are free from Agrobacterium contamination from the medium after 20 days of dark culture and place them on the screening medium. Culture in the dark for 20 days to screen out resistant callus tissues.

[0031] (6) Differentiation: Prepare differentiation medium 4 days in advance, select small pieces of resistant callus that are light yellow, dense, dry and attached to the medium, and select only one resistant callus tissue from each cluster and culture for 40 days.

[0032] (7) Rooting: Prepare rooting medium, remove the differentiated seedlings from the differentiation medium, take only one seedling from each piece of callus, cut off the excessively long leaves and roots with scissors, and inoculate them into rooting tubes, with one seedling in each tube. Culture in light for 20 days.

[0033] (8) Transplanting: After the transformed seedlings have grown, remove the sealing film from the rooting tube, add a certain amount of tap water, and cultivate under light for 4 days to harden the seedlings. During the hardening period, small samples can be taken for positive testing. Gently remove the transformed seedlings from the rooting tube, wash off the attached culture medium on the roots, and transplant them to the field to obtain UvHsbA heterologous overexpression (HE-1 to HE-14) and control (EV) transgenic rice lines. Western blotting is used to verify and identify whether the UvHsbA gene in the transformed rice is successfully expressed, and transgenic lines with high expression levels are preliminarily screened. The method for extracting total protein from transgenic rice is as follows: (1) Grind the rice leaves by quick freezing with liquid nitrogen, put them into a 1.5ml centrifuge tube, add total protein extraction buffer, vortex slightly to mix, and then incubate on ice for 5min. (2) Vortex for 1 minute, ice bath for 2 minutes, repeat 3 times in total; (3) Centrifuge at 12000r / min for 15min at 4℃, then use a pipette to transfer the supernatant into a new centrifuge tube and store it in an ultra-low temperature freezer at -80℃.

[0034] Add a portion of the protein extract to the loading buffer, boil in water for 10 minutes, then cool in an ice bath. Centrifuge at 12000 rpm for 5 minutes at 4°C, then perform Western blot analysis. Figure 1 As shown in Figure A, since the vector used to construct the overexpression plants carries a Flag tag, the UvHsbA-Flag protein band can be seen after the colorimetric reaction with ECL protein blot substrate, indicating that the UvHsbA protein was successfully expressed in transgenic rice.

[0035] Several rice lines heterologously overexpressing the UvHsbA gene were eventually obtained. The overexpression lines HE-8 and HE-11, along with the empty transgenic rice line EV, were selected for subsequent experiments. RNA was extracted from the three lines and reverse transcribed into cDNA. RT-PCR was used to analyze the expression level of the UvHsbA gene in the control line EV and the UvHsbA heterologously overexpressing rice plants HE-8 and HE-11. The results showed that the relative expression level of the UvHsbA gene in plants HE-8 and HE-11 was significantly increased compared to the empty transgenic rice line EV.

[0036] 3. Statistical analysis of field agronomic traits of plants with heterologous overexpression of the UvHsbA gene The growth and development phenotypes of UvHsbA heterologous overexpression transgenic rice were analyzed. UvHsbA heterologous overexpression transgenic rice (HE-8 and HE-11) and empty transgenic rice lines (EV) were planted in the same paddy field. At the waxy maturity stage, the effective tiller number, plant height, thousand-grain weight, grain size, and empty grains were recorded.

[0037] The results are as follows Figure 1 As shown in B-1C, the results indicate that the effective tiller number, plant height, thousand-grain weight, and seed setting rate of rice plants heterologously overexpressing the UvHsbA gene were not significantly different from those of the empty transgenic rice line EV and wild-type rice lines, suggesting that heterologous overexpression of the UvHsbA gene in rice does not affect the agronomic traits of rice.

[0038] 4. Disease resistance assay of plants with heterologous overexpression of the UvHsbA gene Rice false smut resistance analysis: Mycelial blocks of *Ustilaginoidea virens* cultured for 14 days were punched from PSA plates using a 5 mm puncher and inoculated into 75 mL of sterile PSB medium. The plates were then incubated at 28°C and 180 r / min for 7 days in a constant temperature shaker. The concentration of the obtained *Ustilaginoidea virens* conidia was adjusted to 1×10⁻⁶. 6 At the 7th-8th stage of rice panicle differentiation, 2 mL of conidial suspension was injected into the rice spikelets using a syringe. The spikelets were then cultured at 25℃ and 100% relative humidity (RH) for 7 days, followed by further culture at 28℃ and 90% RH for 14 days. Disease incidence was assessed 21 days post-inoculation, and the number of rice false smut balls produced per panicle was counted. Ten panicles were inoculated with each strain, and the experiment was repeated three times. The results are shown in Figure 2A. The results indicated that compared to the empty transgenic rice line EV, the number of rice false smut balls produced per panicle in rice plants heterologously overexpressing the UvHsbA gene (HE-8, HE-11) was significantly reduced, suggesting that heterologous overexpression of the UvHsbA gene significantly enhances rice resistance to rice false smut.

[0039] Analysis of resistance to sheath blight: Mycelial blocks of *Rhizoctonia solani* HG84 (a strain isolated and identified in the field in Huanggang City, Hubei Province) cultured for 3 days on PDA plates were obtained using a 5 mm punch and inoculated onto rice leaves after four weeks of growth. The inoculated rice was placed in a 28℃ artificial climate incubator for moist cultivation, initially in the dark for 24 hours, and then in full light conditions. Disease incidence was observed and lesion area was counted three days after inoculation. The results are shown in Figure 2B. The results showed that compared with the empty transgenic rice line EV, the lesion area of ​​rice plants heterologously overexpressing the UvHsbA gene (HE-8, HE-11) was significantly reduced 3 days after inoculation with *Rhizoctonia solani*, indicating that heterologously overexpressing the UvHsbA gene significantly enhances the resistance of rice to *Rhizoctonia solani*.

[0040] Rice blast resistance analysis: Rice leaves at three weeks of age were used for inoculation with Magna blast fungus. The spore concentration of Magna blast fungus (Magnaporthe oryzae) strain Guy11 (a gift from Professor Zhang Zhengguang of the College of Plant Protection, Nanjing Agricultural University) was adjusted to 1×10⁻⁶ using a 0.5% Tween 20 aqueous solution. 5 Species / mL. The spore suspension was evenly sprayed onto the rice leaves using a sprayer. The inoculated rice plants were placed in a 25℃ artificial climate greenhouse for humidification, initially in the dark for 24 hours, followed by full-light cultivation. Disease incidence was observed and relative fungal biomass was calculated 5 days after inoculation. The results are shown in Figure 2C. The results showed that, compared with the empty transgenic rice line EV, the relative fungal biomass of rice plants heterologously overexpressing the UvHsbA gene (HE-8, HE-11) was significantly lower 5 days after inoculation with rice blast fungus, indicating that heterologously overexpressing the UvHsbA gene significantly enhances rice resistance to rice blast.

[0041] Bacterial blight resistance analysis: Rice plants at the late tillering stage were inoculated with Xanthomonas oryzae pv. oryzae strain PXO99 (a gift from Professor Yuan Meng's research group at Huazhong Agricultural University) using the leaf-cutting method. After isolating the bacterial blight pathogen, it was inoculated into the culture medium. After 48 hours of incubation, sterile water was added to the agar surface to adjust the bacterial concentration to 3 × 10⁻⁶. 8 Bacteria / mL, leaves were cut with surgical scissors, with a cut length of 7-8 cm. Inoculated rice plants were placed in a 28℃ greenhouse for humidified culture. The length of lesions was observed and counted 21 days after inoculation. The results are shown in Figure 2D. The results showed that, compared with the empty transgenic rice line EV, the lesion length of UvHsbA gene heterologous overexpression rice plants (HE-8, HE-11) was significantly reduced 21 days after infection with bacterial blight pathogens, indicating that UvHsbA gene heterologous overexpression rice plants can significantly enhance rice resistance to bacterial blight.

[0042] In summary, heterologous overexpression of the UvHsbA gene of Aspergillus rice in rice not only does not affect the agronomic traits of rice, but also significantly enhances the broad-spectrum resistance of rice to pathogens such as Aspergillus oryzae, Sheath blight, Rice blast fungus, and Bacterium oxysporum.

[0043] In summary, this invention innovatively introduces the UvHsbA gene of the pathogen *Aspergillus oryzae* into rice for overexpression, developing a new application for improving rice disease resistance and in rice disease resistance breeding. Research has found that heterologous overexpression of the UvHsbA gene in rice significantly improves resistance to various pathogens such as *Aspergillus oryzae*, *Rhizoctonia solani*, *Magnaporum oryzae*, and *Bacillus bacterialis*, without affecting key agronomic traits of transgenic rice. The UvHsbA gene and its expression vector can be directly used in transgenic rice breeding, greatly improving the accuracy and efficiency of disease resistance breeding and shortening the breeding cycle. The created transgenic rice materials can be directly used as superior disease-resistant parents in hybridization breeding, which has significant theoretical and practical implications for reducing pesticide use, ensuring high and stable rice yields, and food security.

[0044] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of the *Aspergillus oryzae* UvHsbA gene in any of the following: A1) Application in improving disease resistance in rice; A2) Application in the preparation of products that enhance the disease resistance of rice; A3) Application in the cultivation of transgenic rice with enhanced disease resistance; A4) Application in the preparation of transgenic rice products with enhanced disease resistance; The amino acid sequence encoded by the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.2; By heterologously overexpressing the UvHsbA gene of Aspergillus rice in rice, the disease resistance of rice can be improved or transgenic rice with improved disease resistance can be cultivated. The disease resistance refers to resistance to rice false smut, rice sheath blight, rice blast fungus and / or bacterial blight.

2. The application according to claim 1, characterized in that, The CDS sequence of the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.

1.

3. Application of overexpression vectors containing the *Aspergillus oryzae* UvHsbA gene in any of the following A1)-A4): A1) Application in improving disease resistance in rice; A2) Application in the preparation of products that enhance the disease resistance of rice; A3) Application in the cultivation of transgenic rice with enhanced disease resistance; A4) Application in the preparation of transgenic rice products with enhanced disease resistance; The amino acid sequence encoded by the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.2; the disease resistance refers to resistance to *Aspergillus oryzae*, *Rhizoctonia solani*, *Bacillus oryzae*, and / or *Bacillus oryzae*.

4. The application according to claim 3, characterized in that, The skeletal carrier of the vector is the expression vector pEXT06f.

5. The application according to claim 4, characterized in that, The method for constructing a vector containing the UvHsbA gene of Aspergillus oryzae includes: amplifying the cDNA of Aspergillus oryzae using primers as shown in SEQ ID NO.3-4 to obtain the UvHsbA gene fragment as shown in SEQ ID NO.1, and ligating it into the expression vector pEXT06f using homologous recombinase to obtain the overexpression vector pEXT06f-UvHsbA.

6. A method for improving the disease resistance of rice or cultivating transgenic rice with improved disease resistance, characterized in that, Transgenic rice was obtained by transforming an overexpression vector containing the UvHsbA gene from Aspergillus rice into rice. The amino acid sequence encoded by the UvHsbA gene of *Aspergillus oryzae* is shown in SEQ ID NO.2; the disease resistance refers to resistance to *Aspergillus oryzae*, *Rhizoctonia solani*, *Bacillus oryzae*, and / or *Bacillus oryzae*.

7. The method according to claim 6, characterized in that, An overexpression vector containing the UvHsbA gene from Aspergillus oryzae was transformed into Agrobacterium tumefaciens, and then transformed into rice using an Agrobacterium tumefaciens-mediated genetic transformation system, thereby improving the disease resistance of rice or obtaining transgenic rice with improved disease resistance.

Images