Application of knocking out Glyma.12G128600 gene to improve soybean resistance to helicoverpa armigera

Abstract

The application discloses a knockout Glyma.12G128600 gene for improving the insect resistance of soybean looper, and relates to the technical field of biotechnology. Glyma.12G128600 The application realizes the improvement of multiple traits of soybean by knocking out a gene of the soybean. The soybean plant with the knocked-out gene shows significant insect resistance to the looper, can significantly reduce the weight of the looper larvae, and reduce the degree of the plant being eaten. Meanwhile, the gene knockout can significantly increase the number of soybean pods and branch numbers, optimize the pod setting and branch characteristics of the plant, and lay an agronomic foundation for the yield increase of the soybean. The gene knockout can also effectively reduce the plant height of the soybean, optimize the plant type structure, improve the lodging resistance of the plant, and adapt to the high-density planting cultivation in the field. The application provides important technical support for the insect-resistant breeding of soybean and the cultivation of high-yield and high-quality varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to knockout. Glyma.12G128600 Application of gene therapy to enhance soybean resistance to the beet armyworm. Background Technology

[0002] Soybeans Glycine max Soybean (L.) Merr. is an important crop used for both grain and oilseed production. Pests and diseases are a significant factor severely restricting soybean yield. The beet armyworm (Spodoptera litura), belonging to the family Noctuidae in the order Lepidoptera, has a very wide distribution and hosts over 390 species across 109 families. It feeds on over 90 species, primarily legumes, melons, cruciferous vegetables, and aquatic vegetables. It is characterized by its omnivorous, polyphagous, voracious, and rapid reproductive characteristics. Newly hatched larvae congregate near the eggs, feeding on the leaf mesophyll, creating irregular, transparent white spots. They also have the habit of spinning silk and being dispersed by the wind. From the 2nd to 3rd instar, they disperse and move to other areas, still feeding on the leaf mesophyll, creating cavities or notches. The 4th instar, nocturnal, experiences a sudden increase in feeding, entering a voracious feeding stage, biting away at the leaf surface, leaving only the main vein. Older larvae may also bore into the host plant, making the damage even more concealed. The beet armyworm severely affects the normal growth of soybeans, impacting both yield and quality.

[0003] Traditional methods for controlling the beet armyworm face numerous challenges. The use of chemical pesticides not only increases production costs but also brings a series of environmental and ecological problems, such as the threat of pesticide residues to the quality and safety of agricultural products. Furthermore, it easily leads to pesticide resistance in the beet armyworm. Therefore, there is an urgent need for a safe and efficient method for controlling the beet armyworm. Summary of the Invention

[0004] The purpose of this invention is to provide a knockout Glyma.12G128600 The application of gene-enhancing techniques to improve soybean resistance to the beet armyworm addresses the problems existing in current technologies. This invention discovers the method of knocking out... Glyma.12G128600 Genes can enhance soybean's resistance to the beet armyworm and improve various agronomic traits, providing important technical support for soybean insect-resistant breeding and the cultivation of high-yield and high-quality varieties.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides knockout Glyma.12G128600 The application of gene-based biomaterials in improving soybean resistance to the beet armyworm. Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0006] This invention also provides knockout Glyma.12G128600 The application of genetically modified biomaterials in increasing soybean pod number, the aforementioned Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0007] This invention also provides knockout Glyma.12G128600 The application of gene-based biomaterials in increasing soybean segment number, the Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0008] This invention also provides knockout Glyma.12G128600 The application of genetically modified biomaterials in reducing soybean plant height, the aforementioned Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0009] Furthermore, the biomaterial is the substance described in (1) or (2): (1) Gene knockout vector; (2) A recombinant microbial strain containing the gene knockout vector described in (1).

[0010] This invention also provides a method for improving the resistance of soybeans to the beet armyworm, comprising: applying a method to soybean plants... Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0011] The present invention also provides a method for increasing the number of soybean pods, comprising: […]. Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0012] The present invention also provides a method for increasing the number of nodes in soybeans, comprising: increasing the number of nodes in soybean plants... Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0013] The present invention also provides a method for reducing soybean plant height, comprising: […]. Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0014] Furthermore, the CRISPR / Cas9 gene editing system was used to... Glyma.12G128600 Gene knockout.

[0015] The present invention discloses the following technical effects: This invention knocks out soybeans Glyma.12G128600This gene knockout technique has achieved multiple improvements in soybean traits, demonstrating significant technological value. Soybean plants with this gene knocked out exhibit significant resistance to the beet armyworm, significantly reducing the weight of beet armyworm larvae, lessening the extent of plant damage, reducing over-reliance on chemical pesticides, lowering control costs, and minimizing ecological pollution and pesticide residues. Simultaneously, this gene knockout significantly increases the number of soybean pods and nodes, optimizing plant pod-setting and branching characteristics, laying an agronomical foundation for increased soybean yield. It also effectively reduces soybean plant height, optimizes plant structure, enhances lodging resistance, and is suitable for dense planting in the field. The biological materials and methods involved in this invention are convenient to operate and highly targeted. The resulting gene-edited plants exhibit synergistic improvements in agronomic traits and insect resistance, providing efficient gene targets and technical solutions for soybean insect-resistant breeding and the cultivation of high-yield and high-quality varieties, with broad application prospects. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 for Glyma.12G128600 PCR sequencing results of gene-edited soybean plants; among them, W82 is a wild-type soybean plant; ko-Glyma.12G128600#1 and ko-Glyma.12G128600#2 are... Glyma.12G128600 Gene-edited soybean plants; Figure 2 for Glyma.12G128600 A diagram illustrating gene editing; Figure 3 Phenotypic images of wild-type soybean plants and gene-edited soybean plants that were eaten by the beet armyworm; Figure 4 A statistical graph showing the increase in weight of the beet armyworm in wild-type soybean and gene-edited soybean groups; Figure 5 Phenotypic images of the beet armyworm from wild-type soybean and gene-edited soybean groups; Figure 6 Phenotypic diagrams of wild-type soybean plants and gene-edited soybean plants growing in the field; Figure 7 A statistical graph showing the number of pods in wild-type soybean plants and gene-edited soybean plants; Figure 8 A statistical graph showing the number of branches in wild-type soybean plants and gene-edited soybean plants; Figure 9A statistical graph showing the plant height of wild-type soybean plants and gene-edited soybean plants. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] The soybean variety Tianlong No. 1 in the following examples has been disclosed in the literature “Wang Ruizhen, Yang Zhonglu, Zhou Xinan, Zhao Xianwei, Zhao Chaosen, Xiong Wenhua, Peng Yang. Introduction and promotion of high-yield and high-quality spring soybean Tianlong No. 1 [J]. Soybean Science and Technology, 2015(05):6-10.”

[0024] Example 1 Functional identification of Glyma.12G128600 protein and its encoding gene I. Construction of the pBK2-Cas9-U6-Glyma.12G128600 gene knockout vector To investigate the role of the Glyma.12G128600 gene in regulating soybean resistance to the beet armyworm, its function was identified by constructing gene-edited transgenic plants.

[0025] Knockout vectors were constructed using the CRISPR / Cas9 gene editing system and the Boyuan knockout vector kit. First, prediction... Glyma.12G128600 The gene knockout target was designed with SgRNA on the CDS near the start coding region, and the pBK2-Cas9-U6-Glyma.12G128600 gene knockout vector was constructed according to the instructions.

[0026] 1. Design Glyma.12G128600 Gene knockout targets Predicted Glyma.12G128600 Three gene knockout targets: Target 1: TGAGGTGACGCGCGGGAACG (SEQ ID NO.1); Target 2: AGCTTGACGGCGGAGAGCTC (SEQ ID NO.2); Target 3: CCACCGGACGAGCTTGACGG (SEQ ID NO.3).

[0027] Design amplification primers according to the target knockout kit instructions: 1F:cagtGGTCTCAtgcaTGAGGTGACGCGCGGGAACGGTTTTAGAGCTAGAAATAGC (SEQ IDNO.4); 1R:cagtGGTCTCAGAGCTCTCCGtgcaccagccgggaatcgaa (SEQ ID NO.5); 2F: cagtGGTCTCAACGGCGGAGAGCTCGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 6); 2R: cagtGGTCTCAaaacCCGTCAAGCTCGTCCGGTGGTGCACCAGCCGGGAATCGAA (SEQ ID NO. 7).

[0028] Construct the amplification product sequence of the knockout vector: CGACTTGCCTTCCGCACAATACATCATTTCTTCTTAGCTTTTTTTCTTCTTCTTCGTTCATACAGTTTTTTTTTGTTTATCAGCTTACATTTTCTTGAACCGTAGCTTTCGTTTTCTTCTTTTTAACTTTCCATTCGGAGTTTTTGTATCTTGTTTCATAGTTTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGATTGAATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCCCTGGGAATCTGAAAGAAGAGAAGCAGGCCCATTTATATGGGAAAGAACAATAGTATTTCTTATATAGGCCCATTTAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA TGAGGTGACGCGCGGGAACG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA AGCTT GACGGCGGAGAGCTC GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA CCACCGGACGAGCTTGACGG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCA (SEQ ID NO. 8).

[0029] Glyma.12G128600 CDS sequence of the gene:

[0030] 2. Amplification of the target fragment The target fragment was amplified according to the dual-target amplification system shown in Table 1.

[0031] Table 1. Dual-target amplification system (20 μL) PCR conditions: 98℃ for 3 min; 98℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 25 cycles; 72℃ for 5 min.

[0032] 3. Golden Gate Cloning Table 2 Golden Gate cloning reaction system After mixing the system shown in Table 2 thoroughly, centrifuge briefly, and immediately incubate at 37°C for 30-60 min; then heat at 65°C for 20 min to terminate the reaction, and transfer to ice for later use.

[0033] 4. Transformation reaction ① Thaw the cloned competent cells DH5α on ice, take 10 μL of Golden Gate clone, add it to 100 μL of competent cells DH5α, gently tap the tube wall a few times to mix, and place on ice for 15 min.

[0034] ② Heat shock at 42 ℃ for 45 s, followed by ice bath for 5 min.

[0035] ③ Add 500 μL of antibiotic-free LB medium and incubate at 37 ℃ and 200 rpm with shaking for 60 min. Spread the bacterial culture evenly on a kanamycin antibiotic plate and incubate the plate upside down at 37 ℃ overnight.

[0036] 5. Sequencing for microbial detection and sequencing Five single clones were selected and colony PCR was performed using 2×BioRun Pfu PCR Mix for verification. Positive clones with the correct target band size and brightness were selected for sequencing confirmation. Plasmids were extracted from the positive clones to obtain the pBK2-Cas9-U6-Glyma.12G128600 gene knockout vector.

[0037] Sequencing primer U6cef: TACAGCTAGAGTCGAAGTAG (SEQ ID NO.10).

[0038] 6. Preparation of recombinant Agrobacterium The pBK2-Cas9-U6-Glyma.12G128600 gene knockout vector was transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium.

[0039] II. Recombinant Agrobacterium-mediated stable genetic transformation of soybean 1. Seed disinfection Select mature soybean seeds (Tianlong No. 1) that are uniform in size, plump, relatively smooth, and free of disease spots, and spread them evenly on an open petri dish. Place the dish in a vacuum desiccator under a fume hood. Place a beaker containing 200 mL of sodium hypochlorite solution into the desiccator, slowly add 50 mL of concentrated hydrochloric acid, and then immediately cover the dish. After sterilizing the seeds in chlorine gas for 5 hours, leave the dish uncovered and blow air on it for 2 hours in a clean bench before covering it again for later use.

[0040] 2. Preparation of explants Sterilized soybean seeds were buried overnight in germination medium (GM) with the hilum facing down. After overnight germination, the germinated soybean seeds were cut in half lengthwise along the hilum using a scalpel, ensuring the integrity of the cotyledon embryos on both sides. The seed coat was removed, and most of the hypocotyl was cut off, leaving the hypocotyl 3-5 mm from the cotyledon. With a sterile blade, about 10 incisions were made near the growing point of the cotyledon to obtain a half-seed with an intact embryo, which was then used as an explant.

[0041] 3. Preparation of recombinant Agrobacterium bacterial suspension Recombinant Agrobacterium was added to 1 mL of LB liquid medium containing kanamycin and rifampin antibiotics, and incubated on a shaker at 200 rpm for approximately 24 hours at 28°C. The incubated bacterial suspension was then evenly spread onto LB solid medium containing kanamycin and rifampin antibiotics and incubated upside down at 28°C for 2 days. The bacterial cells were collected, resuspended in co-liquid medium (CCM), and the OD was adjusted. 600 Use it when it reaches around 0.6.

[0042] 4. Explant infection and co-culture The treated explants were immersed in resuspended bacterial solution and infected at 28°C and 120 rpm for 30 min. The infection solution was then discarded, and the explants were placed on sterile filter paper to dry. The cut surfaces were then placed on solid CCM medium with sterile filter paper and sealed. The medium was then incubated in the dark at 25°C for 3 days.

[0043] 5. Induction of new shoots After dark culture, the newly grown hypocotyls were cut off again with a scalpel, leaving only about 3-5 mm of the hypocotyl near the cotyledons. The milky buds near the growing point were scraped off with a blade. The explants were first washed 3-4 times with sterile water, then 3-4 times with liquid bud induction medium (SIM). After washing, the explants were poured onto sterile filter paper. Once no obvious bacterial suspension was visible on the surface, the treated explants were inserted at a 45-degree angle with the cut surface facing up and the cotyledon nodes facing down into solid SIM medium without selection agent. After 10-15 days, the grown cotyledons and the browned basal portion were removed, and the explants were subcultured into solid SIM medium with selection agent. The culture was then incubated at 25°C for approximately 15 days under 16 h light / 8 h dark conditions.

[0044] 6. Elongation of newly sprouted buds After screening, the cotyledons of the explants that induced new shoots were removed and inoculated into shoot elongation medium (SEM). The medium was kept at 25°C with 16 h light / 8 h darkness. Subculture was carried out once a week. During each subculture, the outer browned and blackened tissue was removed to expose the inner green tissue. Subculture was carried out 2 to 3 times as needed.

[0045] 7. Bud rooting and transplanting When the newly sprouted shoots reach 3-5 cm in length, they are cut from the explants and inserted into rooting medium (RM). Rooting is then carried out at 25°C under 16 h light / 8 h dark conditions. Once the root system is well-developed, the caps of the culture bottles are opened in a clean bench, and approximately 3 mL of sterile water is added to each bottle. The bottles are secured with bamboo skewers, covered with bags with holes punched, and hardened off in a tissue culture room. After approximately 3 days, the seedlings are removed from the culture medium, the roots are rinsed clean, and transplanted into soil (nutrient soil: vermiculite = 1:2). Rooting is then carried out at 25°C under 16 h light / 8 h dark conditions.

[0046] 8. Screening and identification of explants After the seedlings have grown a bit, apply glufosinate solution to their leaves. Observe the leaf growth after 3-4 days. If the leaves turn yellow, the plant is negative. If the leaves continue to grow normally, the plant is positive. The final result needs to be retested with test strips.

[0047] III. Identification of Gene-Edited Soybean Plants 1. Bar protein test strip detection in genetically modified knockout soybean seedlings The resistance of glufosinate to transgenic knockout seedlings in the T0 generation was detected using Bar protein test strips (e.g., ...). Figure 1 As shown in the image, test strips with two bands are initially identified as glufosinate-resistant transformation seedlings, and further PCR testing is performed.

[0048] 2. PCR detection of transgenic knockout soybean plants Leaves were taken from T0 generation transgenic knockout seedlings, and leaf DNA was extracted using the CTAB method. PCR amplification was then performed using the following primers to obtain the PCR product. Primer sequences are as follows: Upstream primer: TCATCTCATCCCGACCTCCT (SEQ ID NO.11); Downstream primer: ACCCAACACTTCCAAAGCAAA (SEQ ID NO.12).

[0049] PCR products were subjected to agarose gel electrophoresis. The target bands from transgene knockout-positive plants were sequenced, and the sequencing results were compared with the background material W82. The results are shown below. Figure 2 .

[0050] 3. Obtaining T2 generation homozygous transgenic knockout soybean lines T0 generation positive transgenic knockout soybean plants were individually seeded. The offspring plants were tested using Bar protein strips and PCR sequencing, following steps 2 and 3, to obtain T1 generation isolates. Herbicide-resistant individual plants were then identified and their seeds were harvested to obtain the T2 generation. The T2 generation was further planted; offspring fully resistant to herbicides had their T1 seeds homozygous. The T2 generation positive transgenic knockout soybean homozygous lines ko-GmMAX2#1 and GmMAX2#2 were selected for analysis. Glyma.12G128600 Agronomic traits (number of pods, number of branches, and plant height) of transgenic knockout materials. Specific statistical method: 30 soybean plants were randomly selected from each row, and their number of pods, number of branches, and plant height were counted. The average of these values ​​was then taken as the average for each row.

[0051] The statistical data shows that the transgenic knockout plants had a significant increase in the number of pods and branches compared to the control W82, and a significantly lower plant height compared to the background material W82. Figures 6-9 ).

[0052] IV. Analysis of the resistance of soybean plants to the beet armyworm using Glyma.12G128600 soybean variety. 1. Select 5 healthy (full and smooth seeds without disease spots) seeds from wild-type soybean (W82) and T2 generation positive transgenic knockout soybean homozygous plants ko-GmMAX2#1 and GmMAX2#2, and sow them in nutrient soil (soil and vermiculite ratio 3:1) at 28℃ under long-day conditions (16h light / 8h darkness).

[0053] 2. Transgenic and control plants were cultured for about 20 days.

[0054] 3. Select newly hatched beet armyworm larvae with consistent viability and inoculate six larvae into the same trifoliate leaf of each plant. The weight of the larvae was measured on the seventh day after inoculation. The insect resistance test was conducted in six independent replicates, with each independent replicate consisting of three biological replicates.

[0055] The experimental results showed that the insect weight of the transgenic knockout plants was significantly lower than that of the control plants. Figures 4-5 Furthermore, the larval feeding on the control plants was significantly more severe than that on the transgenic knockout plants. Figure 3 ).

[0056] The above results indicate that soybeans Glyma.12G128600 The gene enhances the soybean's resistance to the beet armyworm, and has certain potential in improving the resistance of transgenic soybeans to the beet armyworm.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Knockout Glyma.12G128600 The application of gene-based biomaterials in improving soybean resistance to the beet armyworm is characterized by, The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

2. Knockout Glyma.12G128600 The application of gene-based biomaterials in increasing soybean pod number is characterized by, The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

3. Knockout Glyma.12G128600 The application of gene-based biomaterials in increasing the number of nodes in soybeans is characterized by, The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

4. Knockout Glyma.12G128600 The application of gene-based biomaterials in reducing soybean plant height is characterized by, The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

5. The application according to any one of claims 1-4, characterized in that, The biomaterial is a substance of (1) or (2): (1) Gene knockout vector; (2) A recombinant microbial strain containing the gene knockout vector described in (1).

6. A method for improving the resistance of soybeans to the beet armyworm, characterized in that, Including soybean plants Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

7. A method for increasing the number of soybean pods, characterized in that, Including soybean plants Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

8. A method for increasing the number of nodes in soybeans, characterized in that, Including soybean plants Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

9. A method for reducing soybean plant height, characterized in that, Including soybean plants Glyma.12G128600 Gene knockout, the steps to construct gene knockout plants; The Glyma.12G128600 The nucleotide sequence of the gene is shown in SEQ ID NO.

9.

10. The method according to any one of claims 6-9, characterized in that, The CRISPR / Cas9 gene editing system was used to... Glyma.12G128600 Gene knockout.

Images