Molecular markers associated with the heading date of wheat and their application

CN121852610BActive Publication Date: 2026-08-07LUDONG UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LUDONG UNIVERSITY
Filing Date
2026-03-17
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

[0003]目前,在小麦穗部研究中,关于小麦抽穗期相关分子标记的报道仍然较少

Benefits of technology

[0008] (1) Based on genome-wide association analysis, this invention has discovered a new and stable SNP locus (AX-111551340) that is significantly associated with the heading date of wheat, and developed the molecular marker MTA73-3A-ID2. This molecular marker can be used to identify the heading date trait of wheat to be tested and accelerate the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852610B_ABST
    Figure CN121852610B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to a wheat heading stage and application thereof, and belongs to the technical field of crop selection and cultivation. The molecular marker is MTA73-3A-ID2, is closely related to a wheat heading stage significantly related SNP site AX-111551340, and the nucleotide sequence is shown as SEQ ID NO: 3 or 4. When the nucleotide sequence is shown as SEQ ID NO: 3, the genotype of the wheat to be measured is CTAGTAAAAA, when the nucleotide sequence is shown as SEQ ID NO: 4, the genotype of the wheat to be measured is C, and compared with the wheat with the genotype CTAGTAAAAA, the wheat with the genotype C has a significantly advanced heading stage. The application has the advantages that the molecular marker can be used for identifying the heading stage trait of the wheat to be measured, and the breeding process is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular markers and their applications, specifically to molecular markers related to the heading stage of wheat and their applications, belonging to the field of crop selection and breeding technology. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the most important food crops grown globally. Currently, with increasing extreme weather events, climate change is severely impacting wheat production. Achieving stable wheat yields to ensure global food security has become one of the major challenges facing breeders. Heading date (HD) is a key trait for wheat adaptation to different climates, regions, and planting seasons. Therefore, genetic improvement of the wheat heading date trait is crucial for achieving high and stable wheat yields. Traditional breeding processes require significant time and effort. With the rapid development of high-throughput sequencing and gene chip technologies, genome-wide association studies (GWAS) have become a fast and convenient method, greatly promoting research on SNP marker-based association analysis of wheat agronomic traits. In summary, utilizing genome-wide association analysis to identify loci significantly associated with wheat heading date and developing molecular markers will provide effective marker resources for marker-assisted breeding, thereby reducing breeding workload, assisting in the development of high-yielding new wheat varieties, and ensuring global food security and sustainable agricultural development.

[0003] Currently, there are still few reports on molecular markers related to the wheat heading stage in wheat ear research. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to wheat heading stage and its application, providing effective gene resources and molecular markers for crop genetic improvement and genome selection-assisted breeding.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The application of the molecular marker MTA73-3A-ID2 associated with wheat heading date, wherein the molecular marker MTA73-3A-ID2 is closely associated with the SNP site AX-111551340, which is significantly associated with wheat heading date. AX-111551340 is located on wheat chromosome 3A, and its physical location in the Chinese spring reference genome sequence Ref Seq v2.1 is 539337183. The molecular marker MTA73-3A-ID2 is amplified using the wheat genomic DNA to be tested as a template by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2. The nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4. When the nucleotide sequence is as shown in SEQ ID NO: 3, the genotype of the wheat to be tested is CTAGTAAAAA. When the nucleotide sequence is as shown in SEQ ID NO: 4, the genotype of the wheat to be tested is C. Compared with wheat with genotype CTAGTAAAAA, wheat with genotype C has a significantly earlier heading date.

[0007] The advantages of this invention are:

[0008] (1) Based on genome-wide association analysis, this invention has discovered a new and stable SNP locus (AX-111551340) that is significantly associated with the heading date of wheat, and developed the molecular marker MTA73-3A-ID2. This molecular marker can be used to identify the heading date trait of wheat to be tested and accelerate the breeding process.

[0009] (2) The molecular marker MTA73-3A-ID2 developed in this invention has the advantages of stable amplification, high detection efficiency and low cost. It can be used for genetic improvement of wheat during the heading stage, providing effective marker resources for molecular marker-assisted breeding and helping to cultivate high-yield new wheat varieties.

[0010] (3) By applying the molecular marker MTA73-3A-ID2 developed in this invention, which is related to the heading period of wheat, it is possible to determine whether there is a variation in the heading period locus of the wheat variety (line) to be tested. This greatly improves the selection efficiency and quality of wheat varieties (lines), minimizes costs, and directly realizes the identification of the target locus in wheat germplasm resources and breeding offspring. It provides a reliable molecular marker for the genetic improvement of wheat yield-related traits and genome selection-assisted breeding. Attached Figure Description

[0011] Figure 1 This is an image showing the electrophoretic detection results of the molecular marker MTA73-3A-ID2 on a non-denaturing polyacrylamide gel;

[0012] Figure 2 This is a correlation analysis diagram of the heading period in a natural population under seven environmental conditions and BLUE.

[0013] Figure 3 This is a Manhattan plot of genome-wide association analysis at the wheat heading stage. Detailed Implementation

[0014] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0015] I. Discovery of SNP loci associated with wheat heading stage

[0016] Genome-wide association analysis (GWA) was performed on 55K microarray data and multi-environment heading date phenotypic data of 258 wheat varieties (lines) using the GAPIT mixed linear model in R. Based on previously reported loci, a novel SNP locus stably and significantly associated with wheat heading date was identified. This SNP locus is located at position 539337183 on wheat chromosome 3A (Ref Seq v2.1 of the Chinese spring reference genome), with genotypes of CC or TT, and is designated AX-111551340.

[0017] II. Molecular Marker Development

[0018] Within a 1 Mb physical region upstream and downstream of AX-111551340, and combining previously reported resequencing data from 677 hexaploid wheat accessions, potential Indel sites closely associated with the significant site AX-111551340 were identified in the target region (the physical location of this Indel site is 539612293, located 275110 bp downstream of AX-111551340, with genotype C or CTAGTAAAAA). A new Indel molecular marker associated with wheat heading stage was developed (denoted as MTA73-3A-ID2).

[0019] Primers were designed targeting the aforementioned Indel site. The designed primers are MTA73-3A-ID2-F / R, and their nucleotide sequences are as follows:

[0020] MTA73-3A-ID2-F: CAGGGTCATACTGTTTACCATTTTGA (SEQ ID NO: 1);

[0021] MTA73-3A-ID2-R: GCCCTACGATGAGGCTATA (SEQ ID NO: 2).

[0022] The corresponding Indel molecular marker can be obtained by PCR amplification of the DNA of the wheat to be tested using the above primers MTA73-3A-ID2-F / R.

[0023] III. Natural Population Detection

[0024] A natural population of 258 common hexaploid wheat accessions was selected (Tables 1-1 to 1-6), and the genotypes of the Indel loci were identified using the Indel molecular marker MTA73-3A-ID2.

[0025] 1. PCR amplification

[0026] Using wheat genomic DNA as a template, PCR amplification was performed using the primers MTA73-3A-ID2-F / R. The PCR amplification system was 10 μL, specifically consisting of: 1 μL of DNA template with a concentration of 10 ng / μL or higher, 0.5 μL of upstream primer with a concentration of 10 μmol / L, 0.5 μL of downstream primer with a concentration of 10 μmol / L, 5 μL of 2×Taq PCR premixed reagent, and 3 μL of ddH2O. Amplification was performed using a standard amplification program, as follows:

[0027] (i) Denaturation at 94℃ for 4 min;

[0028] (ii) 34 cycles of standard PCR program: denaturation at 95°C for 40 s, annealing at 58°C for 40 s, extension at 72°C for 40 s;

[0029] (iii) Extend at 72℃ for 5 minutes;

[0030] (iv) End amplification and store at 4°C.

[0031] 2. Non-denaturing polyacrylamide gel electrophoresis detection

[0032] The obtained PCR products were separated by constant voltage electrophoresis on a non-denaturing polyacrylamide gel (containing 5.85 g acrylamide and 0.15 g methylene acrylamide per 100 mL gel solution) for 3 h. The genotype of the wheat at this Indel locus was determined based on the electrophoresis results.

[0033] (1) If the size of the PCR product is 342bp (SEQ ID NO: 3), then the genotype of the wheat to be tested at this Indel site is CTAGTAAAAA;

[0034] (2) If the size of the PCR product is 333bp (SEQ ID NO: 4), then the genotype of the wheat to be tested at the Indel site is C.

[0035] Gel electrophoresis results of some wheat varieties (lines) are shown below. Figure 1 The genotypic identification results of all wheat varieties (lines) at this Indel locus are shown in Tables 1-1, 1-2, 1-3, 1-4, 1-5 and 1-6.

[0036] Table 1-1 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (Part 1)

[0037]

[0038] Table 1-2 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (II)

[0039]

[0040] Table 1-3 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (Part III)

[0041]

[0042] Table 1-4 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (IV)

[0043]

[0044] Table 1-5 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (V)

[0045]

[0046] Table 1-6 Identification results of the molecular marker MTA73-3A-ID2 in natural populations (VI)

[0047]

[0048] IV. Genome-wide association analysis of wheat heading stage

[0049] The heading date of wheat was determined for 258 natural populations grown in multiple environments. The best linear unbiased estimator (BLUE) for the heading date of wheat in multiple environments was calculated using the lme4 package in R.

[0050] The association analysis results between the Indel molecular marker MTA73-3A-ID2 and wheat heading date are shown in Table 2.

[0051] Table 2. Association analysis results between Indel molecular marker MTA73-3A-ID2 and wheat heading date.

[0052]

[0053] Note: BLUE represents the best linear unbiased estimate of the heading stage under 7 environments; *** indicates P<0.001, ** indicates P<0.01.

[0054] As shown in Table 2, compared with wheat with genotype CTAGTAAAAA, wheat with genotype C had a significantly earlier heading date (P<0.001). Under different environments, wheat with genotype C had a heading date 1.28-2.30 days earlier, with an advance of 0.61-1.17%.

[0055] Correlation analysis was performed on the heading date phenotypic values ​​of natural populations under seven environmental conditions and BLUE. The results are shown in […]. Figure 2 .Depend on Figure 2 It can be seen that the heading period has a high correlation under multiple environments and is less affected by environmental factors, which can be used for further analysis.

[0056] Combining multi-year, multi-location phenotypic data on heading date from 258 wheat 55K microarrays and natural populations, genome-wide association analysis was performed using the GAPIT MLM model in R. The results are shown below. Figure 3 .Depend on Figure 3 It can be seen that the Indel molecular marker MTA73-3A-ID2 is significantly associated with the heading period trait under E3, E4, E5, E6 and BLUE environments.

[0057] The above results indicate that the Indel molecular marker MTA73-3A-ID2 can be used to identify wheat heading-related traits, and has important breeding application value for the genetic improvement of wheat yield traits and the breeding of high-yielding wheat varieties.

[0058] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the protection scope of this invention.

Claims

1. The application of the molecular marker MTA73-3A-ID2, which is associated with the length of wheat heading period, in predicting the length of wheat heading period, characterized in that, The nucleotide sequence of the molecular marker MTA73-3A-ID2 is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The application is to use the wheat genomic DNA to be tested as a template, and to perform PCR amplification of the wheat genomic DNA using the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:

2. If the PCR amplification product is sequence 4, the wheat heading period is advanced.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in highland barley heading stage character assisted breeding

    CN117385091A

  • Molecular marker related to early heading character of wheat and application of molecular marker

    CN119144752A