Dsrna based on the orco gene of the red turpentine beetle and preparation and use thereof
By designing dsRNA of the Orco gene of the red turpentine beetle and using RNAi technology to interfere with its olfactory recognition ability, the problems of pesticide resistance and environmental pollution caused by chemical pesticide control of the red turpentine beetle were solved, achieving green and precise pest control.
Patent Information
- Application Number
- CN202610034009.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2046-01-12
AI Technical Summary
Existing technologies for controlling red turpentine beetles rely on chemical pesticides, which lead to problems such as pest resistance, environmental pollution, and disruption of the ecological balance. The application of RNAi technology in the control of red turpentine beetles is not yet mature.
We designed dsRNA based on the Orco gene of the red turpentine beetle and introduced it into the beetle's body by injection to interfere with its olfactory recognition ability or disrupt its chemical communication function. We then used highly specific RNAi technology for pest control.
It achieves green and precise control of the red turpentine beetle, avoids pollution from chemical pesticides, effectively interferes with the pest's olfactory recognition behavior, and provides a practical and feasible pest control solution.
Smart Images

Figure CN121896225B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of forestry bio-genetic engineering technology, specifically relating to dsRNA designed based on the Orco gene of the red turpentine beetle, its preparation and application. Background Technology
[0002] Red turpentine beetle ( Dendroctonus valens The bark beetle (also known as the powerful bark beetle) is native to North America. Belonging to the family Bark Boreridae in the order Coleoptera, its adults and larvae primarily bore into the phloem of pine trees, such as Pinus tabuliformis, severely damaging the trees' vascular tissue and causing rapid weakening or even widespread death. This poses a continuous and serious threat to forestry ecological security and economic development.
[0003] Currently, the control of the red turpentine beetle still heavily relies on synthetic chemical pesticides. While these methods can rapidly reduce insect populations in the field in the short term, their long-term, large-scale use easily induces pesticide resistance in pests, leading to decreased efficacy and increased costs. Furthermore, the non-targeted application of chemical pesticides, while killing harmful insects, can also harm beneficial insects and organisms, disrupting the ecological balance of forests. Additionally, pesticide residues can pollute soil and water sources through rainwater runoff, causing profound negative impacts on the ecological environment and biodiversity.
[0004] RNA interference (RNAi) technology, as an emerging biological control strategy, efficiently and specifically silences key genes in pests by introducing double-stranded RNA (dsRNA) complementary to the target gene sequence, thereby interfering with their growth, development, or behavior. Compared with traditional chemical pesticides, RNAi technology has significant advantages such as strong targeting, safety for non-target organisms, low likelihood of developing resistance, and good environmental compatibility, making it a cutting-edge research area in the field of green pest control in agriculture. Existing studies have explored the application of RNAi technology to the control of various pests. Currently, the specific application of Orco gene-based RNAi technology to the control of the red turpentine beetle still faces a series of practical challenges and technological gaps, hindering the practical application of RNAi technology in the green control of this important forestry pest. Summary of the Invention
[0005] This invention aims to provide dsRNA designed based on the Orco gene of the red turpentine beetle, as well as its preparation and application, offering a new option for the control of the red turpentine beetle. The application involves introducing dsRNA into the red turpentine beetle to interfere with its olfactory recognition ability or disrupt its chemical communication function, which has significant application value for the control of the red turpentine beetle.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: A dsRNA designed based on the Orco gene, wherein the dsRNA is a double-stranded RNA consisting of a nucleotide sequence as shown in SEQ ID NO:1 as the sense strand and a nucleotide sequence as shown in SEQ ID NO:2 as the antisense strand.
[0007] The present invention also provides a method for preparing dsRNA as described above, comprising the following steps: S1. Total RNA was extracted from *Red Lipid-Between* and reverse transcribed into cDNA; S2. Using the cDNA described in S1 as a template, perform PCR amplification to obtain the target fragment; S3. Clone the target fragment described in S2 into a vector to construct a recombinant plasmid; S4. Using the recombinant plasmid described in S3 as a template, perform PCR amplification to obtain a DNA template with the T7 promoter. S5. Using the DNA template described in S4, perform in vitro transcription to synthesize dsRNA.
[0008] Preferably, in S2, the step of using the cDNA described in S1 as a template for PCR amplification to obtain the target fragment specifically involves: Using cDNA as a template, PCR amplification was performed using primers dsDvalOrco-F and dsDvalOrco-R to obtain the target fragment; The nucleotide sequence of the primer dsDvalOrco-F is shown in SEQ ID NO:3, and the nucleotide sequence of the primer dsDvalOrco-R is shown in SEQ ID NO:4.
[0009] Preferably, in S4, using the recombinant plasmid described in S3 as a template, PCR amplification is performed to obtain a DNA template with the T7 promoter, specifically as follows: Using the recombinant plasmid described in S3 as a template, PCR amplification was performed using primers T7-dsDvalOrco-F and T7-dsDvalOrco-R to obtain a DNA template with the T7 promoter. The nucleotide sequence of primer T7-dsDvalOrco-F is shown in SEQ ID NO:5, and the nucleotide sequence of primer T7-dsDvalOrco-R is shown in SEQ ID NO:6.
[0010] The present invention also provides a gene encoding the dsRNA, the nucleotide sequence of which is shown in SEQ ID NO:7.
[0011] The present invention also provides expression vectors, expression cassettes, transgenic cell lines or host bacteria containing the aforementioned genes.
[0012] The present invention also provides the application of the dsRNA in the preparation of products for the control of red turpentine beetles.
[0013] The present invention also provides the application of the dsRNA in the preparation of products that interfere with the olfactory recognition ability of the red lipophila or disrupt its chemical communication function.
[0014] The present invention also provides a method for controlling the red liptinous beetle, comprising the following steps: introducing the dsRNA into the red liptinous beetle.
[0015] Preferably, the importation operation is performed via injection.
[0016] Preferably, the injection method involves injecting the thorax of the red liptinous beetle, and then placing the beetle in a 4°C refrigerator after injection.
[0017] Preferably, the effective dose of the dsRNA is ≥2µg per animal.
[0018] Compared with the prior art, the present invention has the following advantages and technical effects: This invention discloses a dsRNA designed based on the Orco gene of the red turpentine beetle, its preparation, and its application. For the first time, the Orco gene is used as a control target for the red turpentine beetle. A dsRNA is designed based on a gene fragment from Orco and introduced into adult red turpentine beetles. This successfully blocks the chemical communication pathway by which the beetle relies on olfaction for host localization, thus disabling its ability to find suitable hosts and achieving pest control. The dsRNA of this invention has high specificity, targeting a specific gene of a particular insect, and does not produce harmful substances that pollute the environment. The RNAi designed using this invention effectively interferes with the olfactory recognition behavior of the red turpentine beetle, ultimately providing a practical and feasible technical solution for the green and precise control of this pest, and has significant application prospects.
[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0020] Figure 1 The predicted transmembrane domains of the Orco gene from the red liptinous beetle; Figure 2 Phylogenetic tree of the Orco gene in different insects; Figure 3 The expression profile of the Orco gene in the red turpentine beetle is shown, among which... Figure 3 In the diagram, A represents the expression profile at different developmental stages. Figure 3 In the figure, B represents the expression profile of different tissues in male and female adults. In the figure, ns represents P > 0.05. This means P ≤ 0.05. This means P ≤ 0.01. This means P ≤ 0.001; Figure 4 The expression level of the Orco gene at different time points after dsRNA injection; Figure 5 The behavioral responses of male and female adults of the red lippery beetle injected with dsRNA to 3-carene were studied. Figure 5 In this context, A represents the behavioral response of female adult red turpentine beetles to 3-carene. Figure 5 In this context, B represents the behavioral response of male adults to 3-carene. Detailed Implementation
[0021] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0022] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0023] Source of experimental materials: In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.
[0024] Example 1 Identification of the atypical odor receptor Orco gene in the red turpentine beetle: Test insects: Adult *Turmeric beetles* used in this experiment were collected from Tunlanchuan Forest Farm, Guandishan State-owned Forest Administration Bureau, Shanxi Province. A pair of adults were artificially transferred indoors to fresh *Pinus tabuliformis* logs. Artificial rearing conditions were: temperature 25±1℃, relative humidity 65%±5%, and a light-dark cycle of 10L:14D. After the adults emerged, well-developed and more active individuals were selected for subsequent experiments.
[0025] Total RNA extraction and cDNA synthesis: Total RNA was extracted from the antennae of *Begonia rubrum* using the Trizol method. The specific steps are as follows: (1) Take the above-mentioned adult antennae disinfected with 75% ethanol into a 1.5 mL enzyme-free centrifuge tube that has been pre-cooled with liquid nitrogen, add 400 µL of Trizol, grind thoroughly with an electric grinder, and immediately add Trizol to 1 mL. Place on ice for 5 min until the sample is completely dissolved.
[0026] (2) Centrifuge at 12000rpm for 15min at 4℃, discard the precipitate, gently aspirate the supernatant and transfer it to a new 1.5mL centrifuge tube, and place on ice for 5min.
[0027] (3) Add 0.2 mL of chloroform to each 1 mL of Trizol used, cap the EP tube, shake vigorously for 15 s, and let stand on ice for 5 min.
[0028] (4) Centrifuge at 12,000 rpm for 15 min at 4℃. (The sample is divided into three layers: an upper colorless aqueous phase, a white middle layer, and a lower red organic layer). The RNA is mainly in the aqueous phase. Transfer 300 µL of the aqueous phase to a new 1.5 mL centrifuge tube.
[0029] (5) Add an equal volume of pre-cooled isopropanol, mix by inverting the container, and let stand on ice for 10 minutes.
[0030] (6) Centrifuge at 4℃ and 12000rpm for 5min and remove the supernatant.
[0031] (7) Wash the precipitate with at least 1 mL of 75% ethanol (prepared with RNase-free water) for every 1 mL of Trizol used.
[0032] (8) Centrifuge at 4℃ and 12000rpm for 5min, then discard the supernatant. Remove any remaining water after a brief centrifugation.
[0033] (9) Repeat steps (7) and (8).
[0034] (10) Air dry in a clean bench, then add 30µL of RNase-free water to dissolve the RNA.
[0035] (11) The concentration and purity of RNA were detected using a NanoDrop micro-nucleic acid analyzer, and the integrity of RNA was detected using an electrophoresis apparatus and a gel imaging system. Qualified RNA samples were selected for subsequent experiments.
[0036] First-strand cDNA was synthesized according to the instructions for the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Novizan, Nanjing) reverse transcription reagent. The specific reaction steps are as follows: (1) Genomic DNA removal: Add 1µg of total RNA and 4µL of 4×gDNA wiper Mix to an enzyme-free centrifuge tube, add RNase-free ddH2O to 16µL, gently mix with a pipette and incubate at 42℃ for 2min.
[0037] (2) cDNA synthesis: Add 4µL of 5×HiScript III qRT Super Mix to the above reaction solution, gently mix with a pipette, and place in a PCR instrument to react at 37℃ for 15min and 85℃ for 5s. After the reaction, use a NanoDrop micro-nucleic acid analyzer to detect the concentration and quality of cDNA. After the detection, aliquot and store in a -20℃ freezer for later use.
[0038] Sequence verification of the Orco gene in the red turpentine beetle: The Orco gene sequence was identified from the transcriptome data of *Leptochloa rubra*, as shown in SEQ ID NO:12. Full-length primers for the Orco gene (upstream primer: Dval-Orco-F, downstream primer: Dval-Orco-R) were designed using Primer Premier 5.0 software. The Dval-Orco-F primer sequence is shown in SEQ ID NO:13, and the Dval-Orco-R primer sequence is shown in SEQ ID NO:14. These primers were then sent to Shanghai Sangon Biotech Co., Ltd. for synthesis. The specific reaction system is shown in Table 1.
[0039] Table 1 Reaction System
[0040] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 42 s, 35 cycles, 72℃ complete extension for 5 min, and 12℃ hold.
[0041] Agarose gel electrophoresis was used to detect the singleness and integrity of bands.
[0042] The PCR product was purified using the FastPure Gel DNA Extraction Mini Kit (Novizan, Nanjing) and ligated into the pCE2 TA / Blunt-Zero Vector. The vector was then introduced into DH5α competent cells and seeded onto ampicillin-resistant LB solid medium. After overnight culture, single white spots were picked and cultured in corresponding resistant liquid LB medium. After preliminary identification by bacterial culture PCR, the cells were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0043] The sequencing results were compared with the Orco gene sequence in the transcriptome to obtain the complete sequence of the target gene, which is 1443 bp in length and encodes 480 amino acids.
[0044] The physicochemical properties of the target gene were predicted using Expasy and TMHMM, and the results are as follows: The theoretical isoelectric point of the target gene is 7.60, and its molecular weight is 54.1 kDa; DvalOrco is a protein with 7 transmembrane domains, with the N-terminus inside the cell membrane and the C-terminus outside the cell membrane (e.g., ...). Figure 1 As shown), it conforms to the transmembrane domain characteristics of the Orco gene. The phylogenetic tree shows ( Figure 2 The clustering of Orco genes in insects of the same order indicates a high degree of evolutionary conservation; DvalOrco and the Central European mountain pine beetle ( Dendroctonus ponderosae The Orcos of the same species cluster in the same branch, indicating a close kinship.
[0045] SEQ ID NO:12:
[0046] SEQ ID NO:13: Dval-Orco-F: 5'-ATGATCAACAAGTTCAAAGTGGTCGG-3'.
[0047] SEQ ID NO:14: Dval-Orco-R: 5'-TTACTTGAGTTGCACCAGCACCATG-3'.
[0048] Example 2 Spatiotemporal expression pattern analysis of the Orco gene in the red turpentine beetle: Determination of Orco gene expression in red turpentine beetle: Samples of different tissues (antennae, head, thorax, abdomen, legs, wings) and different developmental stages (adults, young larvae, mature larvae, pupae, and eggs) of male and female red turpentine beetles were collected using dissecting tools. Total RNA was extracted and cDNA was synthesized using the Trizol method according to the steps in Example 1.
[0049] RT-qPCR primers (Dval-Orco-qPCR-F and Dval-Orco-qPCR-R) for the Orco gene were designed using Primer Premier 5.0 software. The housekeeping gene was selected as extension factor 1-a (EF-1-a), and the primers included (EF-1-aF and EF-1-aR). Primer sequences are shown in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18. Real-time quantitative PCR was performed on a Roche Lightcycler 96 using PerfectStart® Green qPCR SuperMix (TransGold, Tianjin). The reaction system is shown in Table 2.
[0050] Table 2 Reaction System
[0051] The RT-qPCR amplification program was as follows: 94℃ pre-denaturation for 30s, 94℃ denaturation for 5s, 60℃ annealing for 15s, 72℃ extension for 10s, with a cycle number of 45; 3 biological replicates were set for each tissue, and 3 technical replicates were set for each biological template.
[0052] Using 2 in Microsoft Excel -ΔΔCTThe relative expression levels of the Orco gene in different tissues and developmental stages of the red turpentine beetle were calculated. The processed data were analyzed using one-way ANOVA in IBM SPSS Statistics 26, with multiple comparisons performed using the Tukey method. Bar charts were then generated using GraphPad Prism 8.0 (GraphPad, USA).
[0053] SEQ ID NO:15: Dval-Orco-qPCR-F: 5'-GCATATACTGCGACTGGGCT-3'.
[0054] SEQ ID NO:16: Dval-Orco-qPCR-R: 5'-GAACTTGGTCAAGCAGTGCG-3'.
[0055] SEQ ID NO:17: EF-1-aF: 5'-GGAGGTATTGGAACAGTAC-3'.
[0056] SEQ ID NO:18: EF-1-aR: 5'-TCTCCACAGATTTCACTTC-3'.
[0057] Real-time fluorescence quantitative results as follows Figure 3 As shown.
[0058] Depend on Figure 3 It was found that the DvalOrco gene was constitutively expressed at all developmental stages throughout the life cycle of the red turpentine beetle, but its transcriptional level showed significant stage-specific differences. The gene expression was significantly upregulated during the adult stage, significantly higher than in other developmental stages such as the egg, larval, and pupal stages. The DvalOrco gene was expressed in all tissues of both male and female adults, with high expression primarily in the antennae and legs. Differences in expression were only detected in the wing tissue, while no sex-related differences were observed in other tissues.
[0059] Example 3 Synthesis of dsRNA in the Orco gene of the red liptinous bark beetle: Design of dsRNA: The dsRNA target sequence was designed by setting parameters on the siDirect website (https: / / sidirect2.rnai.jp / ). The sequence of the sense strand of the dsRNA is shown in SEQ ID NO:1, and the sequence of the antisense strand is shown in SEQ ID NO:2.
[0060] Synthesis of dsRNA: The primers for amplifying dsDvalOrco (primers: dsDvalOrco-F and dsDvalOrco-R) and dsGFP (primers: dsGFP-F and dsGFP-R) were designed according to the method described in Example 1. The sequences of dsDvalOrco-F are shown in SEQ ID NO:3 and SEQ ID NO:4, the sequences of dsGFP-F are shown in SEQ ID NO:8, and the sequences of dsGFP-R are shown in SEQ ID NO:9.
[0061] Using the full-length Orco gene sequence plasmid and GFP plasmid returned from the sequencing as templates, and upstream and downstream primers designed according to the above-mentioned dsRNA target sequence as primers, the dsRNA fragments were amplified according to the reaction system of Example 1. After purification, ligation into a vector, and sequencing, the recombinant plasmids pCE2TA-dsDvalOrco and pCE2TA-dsGFP were obtained.
[0062] The primers T7-dsDvalOrco-F, T7-dsDvalOrco-R, T7-dsGFP-F, and T7-dsGFP-R containing T7 promoters at both ends are shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10, and SEQ ID NO:11.
[0063] The in vitro synthesis and purification of dsRNA were performed according to the instructions of the T7 RNAi Transcription Kit (Novizan, Nanjing). The specific steps are as follows: Using recombinant plasmids pCE2 TA-dsDvalOrco and pCE2 TA-dsGFP as templates, and primers containing the T7 promoter as primers, DNA templates were amplified according to the reaction system of Example 1. The reaction system is shown in Table 3, and the double-enzyme digestion system is shown in Table 4.
[0064] Table 3 Reaction System
[0065] The reaction was carried out at 37°C for 2 hours in a PCR instrument.
[0066] Table 4 Two-enzyme digestion system
[0067] The cells were incubated at 37°C for 30 minutes, and the integrity of the dsRNA was detected using an electrophoresis apparatus and a gel imaging system.
[0068] RNA was purified using the magnetic bead method according to the instructions. The concentration of the product was determined by detecting the A280 absorbance value using a NanoDrop micro-nucleic acid analyzer. The purified product was stored at -20°C. The nucleotide sequence of the target fragment obtained is shown in SEQ ID NO:7.
[0069] SEQ ID NO:1: ATCCAGGCGTCCGGACATTTTATGTTCAACTATTACGCAGATAATTCGGGATCGTTGCATATACTGCGACTGGGCTACTGTTGCATGCATTTGTTTCTTGTACTCGTTCAATATGGATGCATTTTCGGGAATTTGGTCAAAGAAAAGGACAACGTCAGCCACTTGGCAGCCAATACGATTACCATTCTATTTTTCACGCA CTGCTTGACCAAGTTCATCTATTTTGCCGCCCGGTCCAAGCTGTTCTACAGAACCCTCGGTATATGGAACCAGGCGAACAGCCACCCCATCTTTGTGGAGTCGAGCAACCGGTACCATGCGTTGGCGCTCAAGAAAATGCGCAATCTGCTCTACATCATACTGGTTGGGACGCTTTTTTCCGCAAGTGCATGGACTGGCA.
[0070] SEQ ID NO:2: TGCCAGTCCATGCACTTGCGGAAAAAAGCGTCCCAACCAGTATGATGTAGAGCAGATTGCGCATTTTCTTGAGCGCCAACGCATGGTACCGGTTGCTCGACTCCACAAAGATGGGGTGGCTGTTCGCCTGGTTCCATATACCGAGGGTTCTGTAGAACAGCTTGGACCGGGCGGCAAAATAGATGAACTTGGTCAAGCAG TGCGTGAAAAATAGAATGGTAATCGTATTGGCTGCCAAGTGGCTGACGTTGTCCTTTTCTTTGACCAAATTCCCGAAAATGCATCCATATTGAACGAGTACAAGAAACAATGCATGCAACAGTAGCCCAGTCGCAGTATATGCAACGATCCCGAATTATCTGCGTAATAGTTGAACATAAAATGTCCGGACGCCTGGAT.
[0071] SEQ ID NO:3: dsDvalOrco-F:5’-ATCCAGGCGTCCGGACATTT-3’。
[0072] SEQ ID NO:4: dsDvalOrco-R:5’-TGCCAGTCCATGCACTTGCG-3’。
[0073] SEQ ID NO:5: T7-dsDvalOrco-F: 5’-TAATACGACTCACTATAGGGATCCAGGCGTCCGGACATT T-3’。
[0074] SEQ ID NO:6: T7-dsDvalOrco-R: 5’-TAATACGACTCACTATAGGGTGCCAGTCCATGCACTTGC G-3’。
[0075] SEQ ID NO:7: TAATACGACTCACTATAGGGATCCAGGCGTCCGGACATTTTATGTTCAACTATTACGCAGATAATTCGGGATCGTTGCATATACTGCGACTGGGCTACTGTTGCATGCATTTGTTTCTTGTACTCGTTCAATATGGATGCATTTTCGGGAATTTGGTCAAAGAAAAGGACAACGTCAGCCACTTGGCAGCCAATACGATTACCATTCTATTTTTCACGCACTGCTTGACCAAGTTCATCTATTTTGCCGCCCGGTCCAAGCTGTTCTACAGAACCCTCGGTATATGGAACCAGGCGAACAGCCACCCCATCTTTGTGGAGTCGAGCAACCGGTACCATGCGTTGGCGCTCAAGAAAATGCGCAATCTGCTCTACATCATACTGGTTGGGACGCTTTTTTCCGCAAGTGCATGGACTGGCACCCTATAGTGAGTCGTATTA。
[0076] SEQ ID NO:8: dsGFP-F: 5'-GGCAGATTGTGTGGACAGGT-3'.
[0077] SEQ ID NO:9: dsGFP-R:5'-GCCATGCCCGAAGGTTATGT-3'.
[0078] SEQ ID NO:10: T7-dsGFP-F: 5'-TAATACGACTCACTATAGGGGGCAGATTGTGTGGACAGG T-3'.
[0079] SEQ ID NO:11: T7-dsGFP-R: 5'-TAATACGACTCACTATAGGGGCCATGCCCGAAGGTTATG T-3'.
[0080] Example 4 Red turpentine bark Orco gene interference and its interference effect detection: Red liptin beetle dsRNA injection: Several newly emerged male and female adults of the red turpentine beetle were randomly selected and briefly subjected to low-temperature treatment at 4°C. Then, 2 µg of dsRNA targeting the Orco gene was injected into the thorax of each adult using microinjection. The same dose of dsGFP was injected simultaneously as a negative control. The injected beetles were then placed individually in culture dishes at 4°C and provided with a certain amount of food.
[0081] Orco gene interference effect test: At 48h and 72h post-dsRNA injection, test insects were randomly selected from the treatment and control groups, respectively. Three biological replicates were set up, each containing 20 adult insects. Total RNA was then extracted from the antennal tissue of *Betula rubiginii* according to the method in Example 1, and reverse transcribed into cDNA. The interference effect on the *Betula rubiginii* Orco gene was detected using real-time quantitative PCR, as described in Example 2.
[0082] Olfactory behavior measurement: Olfactory behavior was measured using a Y-tube olfactometer. The apparatus consisted of a Y-tube (both the main tube and branch arms were 15 cm long, with an inner diameter of 2 cm and an angle of 75° between the two branch arms), an air pump, two flow meters, two gas washing bottles, two activated carbon filter tubes, and several Teflon connecting tubes. The airflow was purified by the activated carbon filter tubes and humidified by the gas washing bottles. The flow rate was then controlled by the flow meters to 300 mL / min and introduced into the two branch arms of the Y-tube. The inducing source was set as follows: 10 µL of 3-Carene (at a concentration of 10 µL / mL) was evenly added to a 20 mm × 10 mm filter paper. After the solvent evaporated naturally, it was placed in one branch arm (treatment arm); a filter paper with an equal amount of n-hexane was placed in the other branch arm (control arm) to eliminate solvent interference. The insect treatment and testing procedure was as follows: 30 minutes before the test, female and male *Leptochloa crus-galli* were placed in separate culture dishes to avoid contact with the test samples. During the test, a single insect was carefully moved into the end of the main tube of the Y-shaped glass tube, and timing was started simultaneously, giving it 10 minutes to choose its behavior. The judgment criteria were: when the insect's body completely crossed the junction of the two tube arms and extended more than 5 cm towards the target arm, it was considered to have exhibited directional behavior towards that arm (treatment arm or control arm); if, after 10 minutes, the insect had not crossed the aforementioned 5 cm target line, it was considered not to have made a choice. The testing conditions were strictly controlled at a temperature of 25±1℃ and a relative humidity of 70±5%, and the entire device was covered with a 50cm×40cm black curtain to eliminate visual signal interference. To reduce systematic errors, the orientation of the two tube arms of the Y-shaped glass tube was reversed after each repetition. After each treatment test, the Y-shaped tube was cleaned with anhydrous ethanol and dried for later use. The chi-square test was used to compare the selectivity differences between the treatment group and the control group.
[0083] Results Analysis Interference effect detection and analysis: To clarify the interference effect of dsRNA on the Orco gene, real-time quantitative PCR was used to detect the relative expression levels of the target gene Orco in the antennae of male and female adults at two time points: 48 h and 72 h after interference. The results are as follows: Figure 4 As shown.
[0084] Depend on Figure 4It was found that, compared with the control group, the expression level of the Orco gene in the antennae of both male and female adults showed a significant downregulation trend at both time points: in the antennae of female adults, the relative expression level of the Orco gene was significantly downregulated by 62.56% at 48 h of interference, and the downregulation further increased to 80.68% at 72 h; while in the antennae of male adults, the relative expression level of the Orco gene was significantly reduced by 80.81% at 48 h of interference, and the downregulation decreased to 61.98% at 72 h. In summary, under the conditions of this experiment, dsRNA can effectively inhibit the expression of the Orco gene in the antennae of both male and female adults, and the interference efficiency of the Orco gene in the antennae of different sexes shows different trends with treatment time.
[0085] Olfactory behavior analysis: Based on the above experimental results, adult *Leptochloa crus-galli* beetles treated with interference for 48 hours were selected for an olfactory behavior experiment. The results are as follows: Figure 5 As shown.
[0086] Depend on Figure 5 It was found that among male insects, the control group (injected with dsGFP) exhibited a highly significant selective preference for 3-carene (χ²). 2 =12.448, P<0.001), the selection response rate reached 96.7%, while the treatment group showed no significant selection preference for 3-carene (χ² = 12.448, P<0.001). 2 =0.04, ns), the selection response rate was 75.0%; among females, the control group (injected with dsGFP) showed a significant selection preference for 3-carene (χ² = 0.04, ns), and the selection response rate was 75.0%; among females, the control group (injected with dsGFP) showed a significant selection preference for 3-carene (χ² = 0.04, ns). 2 =5.143, P<0.05), the selection response rate was 93.3%, but the treatment group showed a highly significant selection preference for n-hexane (χ² = 5.143, P<0.05). 2 =8.909, P<0.001), with a selection response rate of 75.0%. Based on the above differences, it can be seen that the odor selection preference of the female insects in the treatment group deviated from the odor associated with their natural host (3-carene), suggesting that this treatment may lead to olfactory dysfunction in adult red turpentine beetles.
[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A dsRNA designed based on the Orco gene, characterized in that, The dsRNA is a double-stranded RNA consisting of a nucleotide sequence as shown in SEQ ID NO:1 as the sense strand and a nucleotide sequence as shown in SEQ ID NO:2 as the antisense strand.
2. A method for preparing dsRNA as described in claim 1, characterized in that, Includes the following steps: S1. Total RNA was extracted from *Red Lipid-Between* and reverse transcribed into cDNA; S2. Using the cDNA described in S1 as a template, perform PCR amplification to obtain the target fragment; S3. Clone the target fragment described in S2 into a vector to construct a recombinant plasmid; S4. Using the recombinant plasmid described in S3 as a template, perform PCR amplification to obtain a DNA template with the T7 promoter. S5. Using the DNA template described in S4, perform in vitro transcription to synthesize dsRNA.
3. The preparation method according to claim 2, characterized in that, In S2, the step of using the cDNA described in S1 as a template for PCR amplification to obtain the target fragment specifically involves: Using cDNA as a template, PCR amplification was performed using primers dsDvalOrco-F and dsDvalOrco-R to obtain the target fragment; The nucleotide sequence of the primer dsDvalOrco-F is shown in SEQ ID NO:3, and the nucleotide sequence of the primer dsDvalOrco-R is shown in SEQ ID NO:
4.
4. The preparation method according to claim 2, characterized in that, In S4, using the recombinant plasmid described in S3 as a template, PCR amplification is performed to obtain a DNA template with the T7 promoter, specifically as follows: Using the recombinant plasmid described in S3 as a template, PCR amplification was performed using primers T7-dsDvalOrco-F and T7-dsDvalOrco-R to obtain a DNA template with the T7 promoter. The nucleotide sequence of primer T7-dsDvalOrco-F is shown in SEQ ID NO:5, and the nucleotide sequence of primer T7-dsDvalOrco-R is shown in SEQ ID NO:
6.
5. A gene encoding the dsRNA as described in claim 1, characterized in that, The nucleotide sequence of the dsRNA gene is shown in SEQ ID NO:
7.
6. An expression vector, expression cassette, transgenic cell line, or host bacterium containing the gene as described in claim 5.
7. The use of the dsRNA as described in claim 1 in the preparation of a product for the control of red turpentine beetles.
8. The use of the dsRNA as described in claim 1 in the preparation of products that interfere with the olfactory recognition ability of the red lipophila or disrupt its chemical communication function.
9. A method for controlling the red turpentine beetle, characterized in that, The procedure includes the following steps: introducing the dsRNA as described in claim 1 into the red liptinous beetle.
10. The method for controlling the red turpentine beetle according to claim 9, characterized in that, The importation process is performed via injection.
Citation Information
Patent Citations
DsRNA (double-stranded ribonucleic acid) of targeting juvenile hormone key regulatory gene RTB-JHEH of dendroctonus valerieus as well as preparation method and application of dsRNA
CN119040321A
Rhododendron mucronatum repellent as well as preparation method and application thereof
CN121176455A