Leptin mRNA, pharmaceutical compositions thereof and anti-tumor applications

Abstract

The present application discloses a kind of leptin mRNA and its pharmaceutical composition and anti-tumor application.Specifically, the present application provides an isolated mRNA, which comprises mRNA sequence encoding leptin or leptin fusion protein CDS, the mRNA sequence of the CDS of the encoding leptin is obtained by the nucleotide sequence shown in SEQ ID NO:2, i.e. + The anti-tumor function of T cells can be used alone or in combination with tumor vaccine to inhibit tumor growth, providing a new treatment strategy for tumor immunotherapy.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a leptin mRNA and its pharmaceutical composition and anti-tumor applications, particularly lipid nanoparticles encapsulating leptin or its fusion protein mRNA and their effects on enhancing CD8+. + Applications of T-cell immune function and / or anti-tumor therapy. Background Technology

[0002] Cancer has become one of the leading causes of death worldwide. The International Agency for Research on Cancer (IARC) of the World Health Organization predicts that by 2050, the number of new cancer cases globally will exceed 35 million. The occurrence and development of cancer are inextricably linked to the body's immune system. Immunotherapy involves using drugs or special technologies such as genetic engineering to enhance the anti-tumor function of the patient's own immune system, thereby treating cancer. CD8 + T cells play a crucial role in recognizing and killing tumor cells, and currently, various methods exist to enhance CD8 levels. + Immunotherapy targeting T-cell effector function has been applied clinically, including immune checkpoint therapy, adoptive cell therapy, and tumor vaccines. However, the response rate to immune checkpoint therapy remains low, largely due to significant individual patient variability; some immunotherapy regimens are only effective in patients with high expression or deletion of specific genes. CAR-T therapy is currently the most representative adoptive cell therapy, but it is less effective against solid tumors and is prone to causing severe side effects, such as cytokine storms, which can lead to high fever, tissue damage, and even death. Therefore, targeting the enhancement of CD8... + The anti-tumor function of T cells, which inhibits tumor growth, still requires the development of more drugs to achieve better therapeutic effects.

[0003] In the tumor microenvironment, T cells, subjected to prolonged antigen stimulation and regulation by various immunosuppressive molecules, gradually lose their effector function and differentiate into an exhausted subset (Philip M. and A. Schietinger, CD8(+) T cell differentiation and dysfunction in cancer. Nat Rev Immunol, 2022. 22(4): p.209-223.). CD8 cells in an exhausted state... +T cells remain infiltrated in the tumor microenvironment but are unable to effectively kill tumor cells and do not respond to existing immunotherapies (Miller BC, DR Sen, R. Al Abosy, et al., Subsets of exhausted CD8(+) T cells differentially mediate tumor control and respond to checkpoint blockade. Nat Immunol, 2019. 20(3): p. 326-336.). Inhibiting CD8 in the tumor microenvironment... + T cell differentiation into exhausted subsets is crucial for enhancing the body's anti-tumor immune response. Leptin is a protein secreted by mature adipocytes, with a molecular weight of approximately 14-16 kDa. Compared to protein therapy, mRNA therapy has a shorter production cycle, lower cost, and does not induce immune rejection. Multiple mRNA-related tumor vaccines have also demonstrated the high feasibility of this treatment method. Therefore, using leptin-mRNA to enhance CD8... + Suppressing tumor growth by leveraging the anti-tumor function of T cells may be a viable strategy. Summary of the Invention

[0004] The technical problem to be solved by this invention is to overcome the limitations and unsatisfactory effects of existing immunotherapy methods, and to provide a novel tumor immunotherapy regimen. This invention provides an mRNA encoding leptin or a leptin fusion protein and its pharmaceutical composition, particularly lipid nanoparticles encapsulating said mRNA; this invention also provides an mRNA encoding leptin or a leptin fusion protein and its pharmaceutical composition for enhancing CD8... + Applications of T-cell immune function and / or anti-tumor therapy.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution.

[0006] A first aspect of the present invention provides an isolated mRNA comprising an mRNA sequence encoding leptin or a leptin fusion protein CDS, said mRNA sequence encoding leptin CDS being transcribed from the nucleotide sequence shown in SEQ ID NO: 2, i.e., as shown in SEQ ID NO: 6.

[0007] In some embodiments of the present invention, the leptin fusion protein is a leptin-albumin fusion protein or a leptin-Fc monomer fusion protein.

[0008] In some embodiments of the present invention, the leptin fusion protein is composed of albumin or an Fc monomer, such as IgG1 Fc monomer, linked to the C-terminus of the leptin coding region.

[0009] In some embodiments of the present invention, the leptin fusion protein is connected from the C-terminus of the leptin coding region to the N-terminus of albumin or the Fc monomer via linker 1.

[0010] In some embodiments of the present invention, the C-terminus of the albumin or Fc monomer is linked to the tag protein via linker 2;

[0011] The nucleotide sequence encoding albumin is shown in SEQ ID NO: 8 for example, the nucleotide sequence encoding IgG1 Fc monomer is shown in SEQ ID NO: 9 for example, the nucleotide sequence encoding linker 1 is shown in SEQ ID NO: 16 for example, and the nucleotide sequence encoding linker 2 is shown in SEQ ID NO: 17 for example.

[0012] In some embodiments of the present invention, the mRNA sequence encoding the leptin fusion protein is selected from the following sequences:

[0013] (1) The mRNA sequence encoding the leptin-albumin fusion protein obtained by transcription from the nucleotide sequence shown in SEQ ID NO: 3; and

[0014] (2) The mRNA sequence encoding the leptin-Fc monomer fusion protein obtained by transcription from the nucleotide sequence shown in SEQ ID NO: 4.

[0015] In some embodiments of the present invention, the mRNA further comprises conventional components of an mRNA molecule or vaccine, such as an mRNA sequence obtained by transcription from one or more of the following DNA sequences:

[0016] (1) The encoding sequence of the 5' UTR, for example, as shown in SEQ ID NO: 14;

[0017] (2) The encoding sequence of the 3' UTR, for example as shown in SEQ ID NO: 15;

[0018] (3) A polyA tail coding sequence, wherein the polyA tail coding sequence consists of 50-150 repeating thymines; preferably 100;

[0019] (4) An HA tag, the sequence of which is as shown in SEQ ID NO: 10; and

[0020] (5) The T7 promoter, the sequence of which is as shown in SEQ ID NO: 11;

[0021] The tag protein is for experimental purposes and is not needed in actual use. It can also be other known tag proteins. The promoter can usually be included in the expression vector. In this case, it does not need to be included in the mRNA of this invention. Similarly, other existing promoters other than T7 can be selected.

[0022] It is well known that isolated mRNA suffers from poor stability and low translation efficiency, and typically requires nucleotide modification to enhance stability, improve translation efficiency, and reduce immunogenicity. "Modification" refers to altering any substance, compound, or molecule in some way. A molecule can undergo a series of modifications, each modified molecule serving as the "unmodified" starting molecule for subsequent modifications. Common modifications include converting cytidine (C) to 5-methylcytidine (m5C), uridine (U) to pseudouridine (Ψ), N1-methylpseudouridine (m1Ψ), 5-methoxyuridine (mo5U), or the integration of 5-methylcytidine and pseudouridine (m5C / Ψ). However, different modification methods have significantly different effects on the expression efficiency and biological function of different mRNA sequences. For mRNAs encoding leptin, a specific therapeutic protein, there is no clear guidance in current technologies on how to select the optimal modification method to achieve high expression and strong therapeutic effects. Furthermore, the optimal matching relationship between modification type and delivery method (such as intratumoral injection, intravenous injection, etc.) is also lacking in research.

[0023] During the research process, this invention revealed several challenges in selecting suitable modification schemes for leptin-encoding mRNA. First, the effects of different nucleotide modifications on leptin protein expression levels, protein folding, and biological activity are difficult to predict and require experimental verification. Second, the selection of modification type requires comprehensive consideration of multiple interdependent factors, including mRNA stability, immunogenicity, cellular uptake efficiency, and final therapeutic effect, making the optimization process complex. Third, the compatibility of the modified mRNA with the delivery system (lipid nanoparticles) and its matching with the route of administration also significantly affect the final therapeutic outcome; the interaction mechanisms between these factors are still unclear.

[0024] The inventors discovered that N1-methylpseudouridine (m1Ψ) modification has excellent effects on leptin mRNA. Compared with unmodified mRNA or other modifications (such as pseudouridine modification), N1-UTP modification not only significantly increases the expression level of leptin protein, but more importantly, experimental data show that this modification can maintain the biological activity of leptin protein, enabling it to effectively activate CD8. + The immunomodulatory function of T cells. Further research revealed that when N1-UTP-modified leptin mRNA was encapsulated in lipid nanoparticles and administered via intratumoral injection, efficient local leptin protein expression was achieved in the tumor microenvironment, significantly promoting tumor invasion of CD8. + T cell proliferation (Ki67) + This combination of increased cell proportion and enhanced effector function (enhanced IFNγ secretion) produces a potent antitumor effect. The synergistic therapeutic effect resulting from this specific modification and delivery pathway has not been revealed in the prior art and cannot be expected based on existing technologies.

[0025] In some embodiments of the present invention, the mRNA is obtained by transcription from the nucleotide sequence shown in SEQ ID NO: 5.

[0026] In some embodiments of the present invention, the mRNA is further modified in one or two of the following ways:

[0027] (1) N1-methyl-pseudouridine (m1Ψ)-modified UTP, wherein the modification is a partial or complete substitution; preferably, the modification is that the UTP is completely replaced by N1-methyl-pseudouridine (m1Ψ); and

[0028] (2) EZcap with cap modifier.

[0029] In a preferred embodiment, the mRNA is simultaneously modified with N1-methylpseuuridine (UTP complete replacement) and EZcap capping to achieve optimal protein expression efficiency and therapeutic effect.

[0030] In a preferred embodiment, the mRNA is simultaneously modified with N1-methylpseuuridine (complete UTP replacement) and EZcap capping. These two modifications act complementaryly at different positions on the mRNA, creating a synergistic effect: EZcap capping acts on the 5' end of the mRNA, protecting it from 5' exonuclease degradation and promoting translation initiation; N1-UTP modification acts on the full-length mRNA sequence, reducing immunogenicity, enhancing overall stability, and improving translation efficiency. The combined use of these two modifications, from 5' end protection to full-length optimization, achieves comprehensive enhancement of mRNA stability, translation efficiency, and immune escape capability, thereby achieving optimal leptin protein expression levels and therapeutic efficacy. It is noteworthy that while N1-UTP modification and EZcap capping techniques are known, the specific application of both to mRNA encoding leptin, combined with lipid nanoparticle encapsulation and intratumoral injection, to form a complete technical solution for tumor immunotherapy, and the resulting synergistic effect, have not been revealed in existing technologies.

[0031] A second aspect of the present invention provides a pharmaceutical composition comprising mRNA as described in the first aspect of the present invention, and a pharmaceutically acceptable carrier and / or excipients.

[0032] In some embodiments of the present invention, the carrier is a lipid nanoparticle, and the lipid nanoparticle comprises:

[0033] The packaged lipids are cationic lipids (SM102), cholesterol, distearate phosphatidylcholine (DSPC), and polyethylene glycol-modified lipid molecules (PEG2000-DMG); preferably, the mass ratio of SM102:DSPC:cholesterol:PEG2000-DMG is (4.4~4.5):1:(1.8~1.9):(0.4~0.5).

[0034] In some embodiments of the present invention, the mass ratio of the packaging lipid to mRNA is (15~30):1, preferably (20~25):1, more preferably 23:1, and the obtained lipid nanoparticles have a particle size of 100 nm.

[0035] In some embodiments of the present invention, the pharmaceutical composition is an intratumoral injection formulation. The present invention has found that: After the mRNA of the present invention is modified with N1-methylpseuuridine (m1Ψ) and EZcap capping, it can significantly improve the protein expression level and stability of the mRNA encoding leptin. Furthermore, when this modified mRNA is encapsulated in lipid nanoparticles and administered via intratumoral injection, it can achieve highly efficient local leptin protein expression in the tumor microenvironment, thereby significantly enhancing CD8 expression. +T cell proliferation and effector function. This route of administration can significantly reduce the dosage and side effects of systemic drug administration, such as intravenous, intramuscular, and subcutaneous administration.

[0036] In some embodiments of the present invention, the pharmaceutical composition further includes a tumor vaccine, such as MC38 tumor vaccine or B16-F10 tumor vaccine, as an active ingredient.

[0037] The third aspect of the present invention provides for the preparation of mRNA as described in the first aspect of the present invention or pharmaceutical compositions as described in the second aspect of the present invention that enhance CD8. + The application of CD8 in T-cell immune function and / or anti-tumor drugs, wherein CD8 + T cells are preferably located in the tumor microenvironment, and / or the tumor is preferably colon cancer or melanoma.

[0038] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0039] The reagents and raw materials used in this invention are all commercially available.

[0040] The significant advantages of this invention are as follows: This invention designs and synthesizes codon-optimized leptin mRNA and its fusion proteins (leptin-albumin and leptin-Fc monomers). Optimized design improves expression levels, and the fusion protein form significantly prolongs its half-life, thus enhancing therapeutic efficacy. Lipid nanoparticles are used as the delivery system; these nanoparticles have uniform particle size (approximately 100 nm), high encapsulation efficiency, and all lipid components used have been FDA approved, demonstrating good biocompatibility and safety. Experimental results show that the leptin mRNA lipid nanoparticles of this invention, administered via intratumoral injection, significantly inhibit tumor growth in mice and increase CD8 levels. + The anti-tumor function of T cells provides a new treatment strategy for tumor therapy. At the same time, when the leptin mRNA lipid nanoparticles of this invention are used in combination with tumor vaccines, they can significantly improve the therapeutic effect of tumor vaccines, have a good synergistic effect, and expand the application scope of existing tumor immunotherapy. Attached Figure Description

[0041] Figure 1 The effect of different mRNA modifications on leptin protein expression levels.

[0042] Figure 2 The expression of leptin mRNA in cells (AML12: mouse cells).

[0043] Figure 3 This is for the encapsulation of lipid nanoparticles.

[0044] Figure 4The particle size distribution of lipid nanoparticles.

[0045] Figure 5 To influence CD8 by transfecting tumor cells with Leptin-LNP and causing them to secrete leptin into the supernatant. + T cell proliferation and cytokine secretion.

[0046] Figure 6 Growth curves of subcutaneous tumors in mice and CD8 + T cell proliferation and cytokine secretion.

[0047] Figure 7 Growth curves of subcutaneous tumors in mice and CD8 + T cell proliferation and cytokine secretion.

[0048] Figure 8 The graphs show the growth curves of subcutaneous tumors in mice, the survival curves of mice, the T cell exhaustion (%), the CD45 cell proliferation, and the CD8 cell proliferation in mice under the combined use of leptin-LNP and tumor vaccines. + T cell proliferation and cytokine secretion.

[0049] Figure 9 A schematic diagram of the fusion design of two fusion proteins, Leptin-SA and Leptin-Fc.

[0050] Figure 10 The expression persistence of Leptin-SA mRNA and Leptin-Fc mRNA in cells (AML12: mouse cells).

[0051] Figure 11 To investigate the effect of different injection methods on the antitumor efficacy of Leptin-LNP. Detailed Implementation

[0052] the term

[0053] Unless otherwise specified, the terminology of this invention is defined below.

[0054] The term "sequence optimization" refers to a process or series of processes in which bases in a reference nucleic acid sequence are replaced with alternative bases to produce a nucleic acid sequence with improved properties, such as improved protein expression or reduced immunogenicity. Generally, the goal of sequence optimization is to produce a synonymous nucleotide sequence that is identical to the polypeptide sequence encoded by the reference nucleotide sequence. Therefore, in a polypeptide encoded by a codon-optimized nucleotide sequence, there are no amino acid substitutions relative to the polypeptide encoded by the reference nucleotide sequence.

[0055] In the context of sequence optimization, the term "codon substitution" refers to replacing a codon in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, by chemical peptide synthesis or by recombination methods known in the art. Therefore, referring to "substitution" or "replacement" at a position in a nucleic acid sequence (such as mRNA) or in a region or subsequence of a nucleic acid sequence (such as mRNA) means that the codon at that position or region is replaced.

[0056] As used in this article, the term “coding region” or “CDS” refers to a segment of DNA sequence that directly encodes a polypeptide or protein in the genome.

[0057] The term "nucleotide sequence" refers to the coding sequence of a nucleic acid (e.g., mRNA or DNA molecule) that encodes a polypeptide. The coding sequence may further include initiation and termination signals operatively linked to regulatory elements, including promoters and polyadenylation signals, capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may further include a sequence encoding a signal peptide.

[0058] In addition, there are untranslated regions at both ends of the open reading frame (ORF) of mRNA, called the 5' UTR and 3' UTR, respectively. The 5' UTR is the mRNA region directly upstream (5') of the start codon (the first codon in the mRNA transcript translated by the ribosome), and it does not encode a polypeptide. The 3' UTR is the mRNA region directly downstream (3') of the stop codon (the codon that signals the end of translation in the mRNA transcript), and it also does not encode a polypeptide. The open reading frame is a continuous DNA segment that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a polypeptide. Untranslated regions cannot translate amino acids, but they can bind RNA-binding proteins, thereby regulating the degradation and translation efficiency of mRNA products. The 5' UTR or 3' UTR can be homologous or heterologous to open reading frames in polynucleotides. Multiple 5' UTRs or 3' UTRs may be included in the flank region and may be the same or different sequences.

[0059] A "polyA" or "poly(A)" is a region of mRNA located downstream of the 3' UTR, for example, directly downstream (i.e., 3'), containing a plurality of consecutive adenylate residues. A polyA tail can contain 10 to 300 adenylate residues. For example, a polyA tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenylate residues. In some embodiments, a poly(A) tail contains 50 to 150 adenylate residues. In a preferred embodiment, the poly(A) tail contains 100 adenylate residues. In relevant biological environments (e.g., in cells, in vivo), the poly(A) tail functions to protect mRNA from enzymatic degradation, such as in the cytoplasm, and to aid in transcription termination, mRNA export from the nucleus, and translation.

[0060] The term "cationic lipid" has a common meaning in the art and can refer to a lipid comprising one or more positively charged groups. As used herein, "positively charged group" means a chemical group carrying a positive electron charge, such as monovalent (+1), divalent (+2), trivalent (+3), etc. Examples of positively charged groups include amino, ammonium, pyridyl, guanidinyl, and imidazole groups. In some embodiments, an ionizable lipid molecule may include an amino group and may be referred to as an ionizable amino lipid.

[0061] As used herein, the terms "polyethylene glycol-modified lipids" or "PEGylated lipids" refer to lipids modified with polyethylene glycol (PEG) (PEG-lipids). Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (such as PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-dicyanoxypropane-3amine. For example, PEG-lipids can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipids.

[0062] In this document, "lipid nanoparticles" or "LNPs" are used for mRNA delivery. In some embodiments, LNPs generally comprise (i) at least one cationic lipid; (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid, such as PEG2000-DMG.

[0063] In this invention, "pharmaceutically acceptable carrier" refers to a non-toxic carrier substance that can be used in pharmaceutical manufacturing and does not interfere with the active ingredient. Examples include aqueous carriers (such as water for injection, physiological saline), non-aqueous carriers (such as vegetable oil, glycerin), and organic solvents (such as ethanol, propylene glycol). "Pharmaceutically acceptable excipients" refers to auxiliary substances added to the formulation to improve the performance of the formulation, including but not limited to: stabilizers (such as mannitol, sucrose), isotonic adjusters (such as sodium chloride), pH adjusters (such as citrate, phosphate), preservatives (such as benzyl alcohol), and surfactants (such as Tween-80).

[0064] As used herein, the term "immune response" refers to the action of, for example, lymphocytes, antigen-presenting cells, phagocytes, granulocytes, and soluble macromolecules (including antibodies, cytokines, and complement) produced by these cells or the liver, resulting in selective damage, destruction, or elimination from the body of invading pathogens, pathogen-infecting cells or tissues, cancer cells, or, in cases of autoimmunity or pathological inflammation, cells or tissues of a healthy person. In some cases, ingestion of nanoparticles consisting of a lipid component and an encapsulated therapeutic agent can trigger an immune response, which can be caused by (i) the encapsulated therapeutic agent (e.g., mRNA), (ii) the expression product of such encapsulated therapeutic agent (e.g., a polypeptide encoded by mRNA), (iii) the lipid component of the nanoparticle, or (iv) a combination thereof.

[0065] In this invention, the term "Fc monomer" refers to an immunoglobulin (usually IgG1) Fc fragment that has been genetically engineered to break the natural homodimer structure, thereby enabling it to exist stably as a single polypeptide chain. It prevents aggregation by mutating the CH3 domain, halving the molecular weight (approximately 25 kDa) and achieving better tissue penetration while retaining its core function of binding to FcRn to prolong its in vivo half-life. This makes it particularly suitable for constructing small-molecule fusion protein drugs that require a long-acting mechanism but need to avoid the side effects of receptor dimerization.

[0066] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0067] Example 1: Synthesis and Expression Verification of Leptin mRNA

[0068] The original coding sequence (CDS) of the mouse leptin gene (with the stop codon removed, (SEQ ID NO: 1)) was sequence optimized (by codon substitution) (SEQ ID NO: 2). The DNA sequence of the coding region was synthesized in vitro, and an HA tag (SEQ ID NO: 10) was added to the 3' end and cloned downstream of the T7 promoter (SEQ ID NO: 11) on the pcDNA3.1 vector. The linearized leptin DNA template was amplified by PCR, and 100 repeats of thymine T were introduced into the downstream end of the DNA template through PCR amplification using primers pcDNA3.1-T7-5' UTR-F (SEQ ID NO: 12) and TL-3' UTR-100T-R (SEQ ID NO: 13). This resulted in the synthesis of 100 poly A tails in the mRNA product during subsequent in vitro transcription.

[0069] The linear leptin DNA sequence obtained by PCR was used as a template for in vitro transcription using T7 RNA polymerase (K1083, APExBIO). EZcap (B8177, APExBIO) was added during transcription to cap the mRNA product. Unmodified uridine triphosphate (UTP) (K1048, APExBIO), pseudo-modified uridine triphosphate (Pseudo-UTP) (B7972, APExBIO), 5-methoxy-modified uridine triphosphate (5mo-UTP) (B8061, APExBIO), and N1-methyl-pseudouridine 5'-triphosphate (N1-UTP) (B8049, APExBIO) were used in the transcription reaction. After digesting the DNA template in the reaction system with DNase I (EN0521, ThermoScientific), the product was further purified to obtain leptin mRNA. mRNA synthesized from different UTP precursors was transfected into human kidney cell line 293T (ATCC, Cat# CRL-3216) and normal mouse hepatocyte cell line AML12 (ATCC, Cat# CRL-2254). Cell supernatant was collected 24 hours after transfection. 10 μL of Anti-HA magnetic beads (Thermo, 88836) were added to 1 mL of cell supernatant for incubation and HA tag enrichment. After incubation, the magnetic bead samples were eluted by high-temperature boiling to remove HA-tagged proteins. Leptin protein expression was detected by Western blotting. Leptin mRNA synthesized using N1-UTP as a precursor showed more stable and higher expression in both cell lines. The results are as follows: Figure 1As shown. Therefore, subsequent examples used N1-UTP-modified mRNA (hereinafter referred to as "Leptin-N1-UTP-mRNA"). Following the method for synthesizing leptin mRNA, a mouse leptin isoleucine deletion mutant, Leptin-I14Del-mRNA (SEQ ID NO: 7), was designed and synthesized. Transfection of Leptin-N1-UTP-mRNA and Leptin-I14Del mRNA into the normal mouse hepatocyte line AML12 resulted in successful expression of leptin and Leptin-I14Del in the cells and in the cell culture supernatant. The results are as follows. Figure 2 As shown.

[0070] Example 2: Obtaining lipid nanoparticles (LNPs) by encapsulating mRNA with lipids

[0071] To achieve efficient in vivo delivery of mRNA, lipid nanoparticles Leptin-N1-UTP-mRNA from Example 1 were selected for encapsulation using lipids to form Leptin-LNP. Figure 3 As shown, all lipid molecules used have been approved by the FDA and have good safety profiles. The lipid molecules used include four types: cationic lipid SM102 (C1042, APE×BIO), cholesterol (B1702, APE×BIO), distearate phosphatidylcholine DSPC (850365, Avanti), and polyethylene glycol-modified lipid molecule PEG2000-DMG (880151, Avanti). The four lipid components were formulated into ethanol stock solutions at the following concentrations: SM102 (20 mg / mL); DSPC (10 mg / mL); cholesterol (10 mg / mL); DMG-PEG2000 (5 mg / mL). The stock solutions of the four lipid components were mixed with ethanol at the volume ratios shown in Table 1 to prepare 1 ml of packaged lipids.

[0072] Table 1

[0073]

[0074] The concentration of the mRNA solution used for packaging lipid nanoparticles was 111.11 μg / mL. At a volume ratio of 1:3, 1 mL of packaging lipid and 3 mL of mRNA solution containing 333.33 μg of mRNA were rapidly mixed using a microfluidic chip (RM1002, APE×BIO) to self-package LNP samples with a diameter of approximately 100 nm. The LNP samples were diluted with 1×PBS, added to the corresponding measuring cups, and the measurement parameters were set. The particle size distribution and uniformity were measured using Zetasizer Pro. Figure 4As shown in the figure. The results indicate that the particle size distribution of the Leptin-LNP sample was stable and uniform in all three tests, making it suitable for subsequent examples.

[0075] Similarly, the Leptin-I14Del-mRNA in Example 1 was encapsulated with the same lipids to form lipid nanoparticles Leptin-I14Del-LNP (also known as Leptin-MUT-LNP) for use in subsequent examples.

[0076] Example 3: Validation of leptin mRNA LNPs increasing CD8 in mice + The effect of T-cell anti-tumor function

[0077] Leptin-LNP and Leptin-I14Del-LNP, prepared in Example 2, were transfected into the mouse melanoma cell line B16-F10 (ATCC, Cat# CRL-6475; RRID: CVL_0159). The supernatant was collected and then lysed into CD8 cells isolated from 6-week-old male C57BL / 6 mice. + T cells were co-cultured. CD8 cells were collected after 72 hours. + After 50% of T cells were perforated, they were stained with anti-mouse-Ki-67-PE flow cytometry antibody (12-5698-82, eBioscience) and their proliferation capacity was detected by flow cytometry. The remaining 50% of cells were added to 24-well plates and replenished with RPMI 1640 medium containing 10% FBS to a volume of 1 mL per well. PMA (Phorbol 12-myristate 13-acetate) (P8139, Sigma-Aldrich) and ionomycin (I3909, Sigma-Aldrich) were added at a 1:1000 ratio to stimulate rapid T cell activation and cytokine secretion. Monensin (65-4505-51, eBioscience), a protein transport inhibitor, was then added at a 1:1000 ratio to block the transport of cytokines to the extracellular space. The 24-well plates were then placed in cell culture and incubated for 5 hours. Following the aforementioned intracellular flow cytometry staining method, cells were stained using the anti-mouse-IFNγ-PE (12-7311-82, eBioscience) flow cytometry antibody. After staining, IFNγ expression in cells was detected using a flow cytometry analyzer to assess cytokine secretion capacity.

[0078] like Figure 5As shown, compared with the control group LNP and the mutated Leptin-I14Del-LNP (i14mutLeptin-LNP) which mutates the receptor-binding site, at increasing concentrations (2 μg or 3 μg of Leptin-LNP), Leptin-LNP can enter tumor cells and be translated into leptin protein and secreted extracellularly, thereby affecting CD8. + T cell proliferation and cytokine secretion capacity.

[0079] Specifically, compared with the control group, Leptin-LNP promoted T cell proliferation: Ki67-positive CD8 + The proportion of T cells increased from 20% to 30% (2 μg group) and 40% (3 μg group), showing a dose-dependent increase. Figure 5 **p<0.01); Compared with the Leptin-I14Del-LNP (3 μg) group, Leptin-LNP (3 μg) also promoted T cell proliferation: Ki67-positive CD8 + The proportion of T cells increased from 30% to 40% (**p<0.01), indicating that Leptin-LNP can effectively promote T cell proliferation.

[0080] Compared with the control group, Leptin-LNP has an enhancing effect: IFNγ secretory CD8 + The proportion of T cells increased from 20% to 28% (2 μg group) and 34% (3 μg group), showing a dose-dependent increase. Figure 5 **p<0.01); Compared with the Leptin-I14Del-LNP group, Leptin-LNP also had an enhancing effect: IFNγ secretory CD8 + The proportion of T cells increased from 23% to 30% (**p<0.01), indicating that the newly proliferated T cells have strong effector functions.

[0081] Six-week-old male C57BL / 6 mice were divided into four groups, and each mouse was subcutaneously injected with 5 × 10⁻⁶ mg / L of iodine solution. 5 One B16-F10 melanoma cell, when the tumor size reaches 20 mm 3 Subsequently, every three days, mice were injected subcutaneously into tumors with 25 μL PBS / 5 μg LNP / 5 μg Leptin-LNP / 5 μg Leptin-I14Del-LNP. The size of the tumors was measured and recorded each time.

[0082] like Figure 6As shown, compared with the control group PBS, unencapsulated mRNA LNP (LNP), and Leptin-I14Del-LNP with a mutated receptor binding site, intratumoral injection of Leptin-LNP significantly inhibited tumor growth in mice and increased CD8+ in the tumor microenvironment. + T-cell anti-tumor function.

[0083] Specifically, compared with the control group, Leptin-LNP inhibited tumor growth: after 10 days of intratumoral administration, the tumor size decreased from 125 mm. 2 Reduced to 40 mm 2 The tumor weight decreased from 0.8 g to 0.1 g. Figure 6 **p<0.01); compared with the Leptin-I14Del-LNP group, Leptin-LNP also inhibited tumor growth: tumor size decreased from 100 mm. 2 Reduced to 40 mm 2 The tumor weight decreased from 0.5 g to 0.1 g. Figure 6 (*p<0.05), indicating that Leptin-LNP can effectively inhibit tumor growth.

[0084] Compared with the control group, Leptin-LNP enhanced T cell proliferation: Ki-67 + Proliferating CD8 + The proportion of T cells increased from 45% to 62%, Ki-67 + Proliferating CD4 + The proportion of T cells increased from 35% to 40%. Figure 6 **p<0.01); Compared with the Leptin-I14Del-LNP group, Leptin-LNP also enhanced T cell proliferation: Ki-67 + Proliferating CD8 + The proportion of T cells increased from 46% to 62%, Ki-67 + Proliferating CD4 + The proportion of T cells increased from 44% to 62%. Figure 6 (p<0.01), indicating that Leptin-LNP can enhance T cell proliferation.

[0085] Compared with the control group, Leptin-LNP enhanced T cell effector function: IFNγ-secreting CD8 + The proportion of T cells increased from 40% to 56%. Figure 6**p<0.01); Compared with the Leptin-I14Del-LNP group, Leptin-LNP also enhanced T cell effector function: IFNγ-secreting CD8 + The proportion of T cells increased from 49% to 56%. Figure 6 (*p<0.01), indicating that Leptin-LNP can enhance T cell proliferation.

[0086] Example 4: Comparison of antitumor function of leptin protein and leptin mRNA LNPs in mice

[0087] Six-week-old male C57BL / 6 mice were divided into four groups, and each mouse was subcutaneously injected with 5 × 10⁻⁶ mg / L of iodine solution. 5 B16-F10 tumor cells. When the tumor size reaches 20 mm. 2 Subsequently, every three days, mice were injected subcutaneously with 8 μg of recombinant leptin (rmLeptin, R&D, 498-OB) or intratumorally with 5 μg of leptin-LNP. Tumor size was measured and recorded each time. At the end of the experiment, mice were euthanized, tumors were removed, lymphocytes in the tumor microenvironment were isolated, and anti-mouse CD8a (48-0081-82, eBioscience), anti-mouse CD45 (11-0451-82, eBioscience), and Fixed Viability Dye (65-0865-14, eBioscience) were added at a 1:100 ratio to inhibit CD45. + CD8 + Live cells were stained. Additional anti-mouse PD1 (135213, Biolegend) and anti-mouse TIM3 (119715, Biolegend) were added at a 1:100 ratio to target depleted CD8+ cells. + T cells were stained; Ki-67 cells were stained as described above. + Proliferating CD8 + T cells, IFNγ-secreting CD8 + T-cell staining is a method for staining cells.

[0088] like Figure 7 As shown, compared with the PBS control group and the 8 μg recombinant leptin group, intratumoral injection of 5 μg Leptin-LNP can significantly improve the efficacy of tumor vaccines and inhibit tumor growth in mice.

[0089] Specifically, compared with the control group, Leptin-LNP inhibited tumor growth: after 9 days of intratumoral administration, the tumor size decreased from 210 mm.2 Reduced to 110 mm 2 ( Figure 7 (A and B, *p<0.05); compared with the rmLeptin group, leptin-LNP also inhibited tumor growth: tumor size decreased from 160 mm. 2 Reduced to 110 mm 2 ( Figure 7 (A and B, *p<0.05), indicating that Leptin-LNP has a better tumor growth inhibition ability than rmLeptin.

[0090] Compared with the control group, Leptin-LNP can inhibit CD8 + T cell depletion promotes lymphocyte infiltration into the tumor microenvironment, and CD8+ cells in the tumor microenvironment... + T cells have stronger proliferation and effector capacity: PD1 + TIM3 + Positive depletion CD8 + The proportion of T cells decreased from 38% to 28%. Figure 7 C, *p<0.05); CD45 + The proportion of T cells increased from 5% to 13%. Figure 7 C, **p<0.01); Ki-67 + Proliferating CD8 + The proportion of T cells increased from 23% to 53%. Figure 7 C, **p<0.01); IFNγ secretory CD8 + The proportion of T cells increased from 7% to 21%. Figure 7 (C, **p<0.01). Compared with the recombinant protein rmLeptin group, leptin-LNP promoted lymphocyte infiltration into the tumor microenvironment, and CD8+ in the tumor microenvironment... + T cells have stronger proliferation and effector capabilities: CD45 + The proportion of T cells increased from 7% to 13%. Figure 7 C, *p<0.05); Ki-67 + Proliferating CD8 + The proportion of T cells increased from 41% to 53%. Figure 7 C, *p<0.01); IFNγ secretory CD8 + The proportion of T cells increased from 15% to 21%. Figure 7 C, *p<0.05).

[0091] Example 5: Validating the efficacy of leptin mRNA LNPs in combination with MC38 and B16-F10 tumor vaccines in mice.

[0092] Six-week-old male C57BL / 6 mice were divided into four groups, and each mouse was subcutaneously injected with 5 × 10⁻⁶ mg / L of iodine solution. 5 One MC38 colon cancer tumor cell or 5 × 10 5 B16-F10 cells. Mice were intramuscularly injected with 8 μg of MC38 tumor vaccine (APExBIO) / B16-F10 tumor vaccine (APExBIO) / 25 μL of PBS at 3 / 7 / 10 / 17 days after tumor injection. When the tumor size reached 20 mm... 2 Subsequently, 5 μg Leptin-LNP / 5 μg Leptin-I14Del-LNP were injected intratumorally into the subcutaneous tumors of mice every three days. The size of the mouse tumors was measured and recorded each time.

[0093] like Figure 8 As shown, compared with the PBS control group (PBS, without injection of MC38 tumor vaccine and leptin mRNA LNPs), the tumor vaccine-only group (MC38TAV), and the group with mutated Leptin-I14Del-LNP binding to the receptor (MC38TAV+Leptin-MUT-LNP), intratumoral injection of Leptin-LNP (MC38TAV+Leptin-LNP) significantly improved the efficacy of the tumor vaccine and inhibited tumor growth in mice.

[0094] Specifically, in the MC38 tumor model, compared with the PBS control group, the MC38TAV+Leptin-LNP group significantly inhibited tumor growth, and the tumor size in the MC38TAV+Leptin-LNP group was approximately 90 mm 9 days after administration. 2 It was superior to the PBS-treated group (tumor size approximately 171 mm). 2 () Figure 8 The A, **p<0.01) and the MC38TAV+Leptin-MUT-LNP group (tumor size approximately 131 mm) 2 () Figure 8 The A value was *p<0.05; meanwhile, MC38TAV+Leptin-LNP treatment significantly prolonged the survival of tumor-bearing mice: compared with the PBS group (survival time 23 days) and the MC38TAV group (survival time 23 days), the survival time of the MC38TAV+Leptin-LNP group was significantly improved and superior to that of the MC38TAV+Leptin-MUT-LNP group (*p<0.05); Figure 8 B, *p<0.05).

[0095] In the B16 tumor model, compared with the PBS control group and the B16TAV group, the B16TAV+Leptin-LNP group also significantly inhibited tumor growth: 6 days after administration, the tumor size in the B16TAV+Leptin-LNP group was approximately 89 mm. 2 The tumor size was significantly lower than that in the PBS group (approximately 164 mm). 2 B16TAV group (tumor size approximately 149 mm) 2 (**p<0.01), and superior to the B16TAV+Leptin-MUT-LNP group (tumor size approximately 154 mm). 2 () Figure 8 (C).

[0096] Compared with the control group, MC38TAV+Leptin-LNP can inhibit CD8 + T cell depletion promotes lymphocyte infiltration into the tumor microenvironment, and CD8+ cells in the tumor microenvironment... + T cells have stronger proliferation and effector capacity: PD1 + TIM3 + Positive depletion CD8 + The proportion of T cells decreased from 42% to 28%. Figure 8 (D); CD45 + The proportion of T cells increased from 3% to 7%. Figure 8 D, *p<0.05); Ki-67 + Proliferating CD8 + The proportion of T cells increased from 22% to 39%. Figure 8 D, **p<0.01); IFNγ secretory CD8 + The proportion of T cells increased from 6% to 15%. Figure 8 D, *p<0.05).

[0097] Compared with the MC38TAV group, MC38TAV+Leptin-LNP promoted lymphocyte infiltration into the tumor microenvironment, and CD8+ in the tumor microenvironment increased. + T cells have stronger proliferation and effector capabilities: CD45 + The proportion of T cells increased from 3% to 7%. Figure 8 D, *p<0.05); Ki-67 + Proliferating CD8 + The proportion of T cells increased from 25% to 39%. Figure 8 D, **p<0.01); IFNγ secretory CD8 + The proportion of T cells increased from 7% to 15%. Figure 8D, *p<0.05).

[0098] Example 6: Synthesis and expression verification of fusion proteins leptin-albumin (leptin-SA) and leptin-Fc monomer (leptin-Fc)

[0099] To enhance the stability of leptin mRNA LNPs in vivo and prolong their half-life, two fusion proteins, leptin-albumin and leptin-Fc monomer, were designed. Figure 9 As shown, the leptin-albumin fusion design is as follows: the mouse albumin Glu 25-Ala 608 sequence (SEQ ID NO: 8) is linked to the C-terminus of the synthesized mouse leptin coding region; the leptin-Fc monomer fusion design is as follows: the mouse leptin coding region is linked to the mouse IgG1 Fc monomer region: Val 98-Lys 324 sequence (SEQ ID NO: 9). Following the in vitro transcription synthesis method for mRNA in Example 1, leptin-SA mRNA (its corresponding encoding nucleotide sequence is shown in SEQ ID NO: 3) and leptin-Fc mRNA (its corresponding encoding nucleotide sequence is shown in SEQ ID NO: 4) were synthesized and purified.

[0100] The same amount of leptin-mRNA (i.e., ...) was transfected into the mouse cell line AML12. Figure 10 Leptin), leptin-SA mRNA, and leptin-Fc mRNA were detected. Cell culture supernatant was collected at 24 h, 48 h, and 72 h post-transfection to detect the expression and secretion of the three mRNAs. Figure 10 As shown, compared with leptin protein secreted by leptin-mRNA expression, the protein secretion levels of fusion proteins leptin-SA and leptin-Fc were significantly increased, and remained at a high level 72 h after transfection.

[0101] Example 7: Validating the effect of different injection methods on the antitumor effect of Leptin-LNP in a mouse subcutaneous tumor model.

[0102] Six-week-old male C57BL / 6 mice were divided into four groups, and each mouse was subcutaneously injected with 5 × 10⁻⁶ mg / L of iodine solution. 5 B16-F10 tumor cells. When the tumor size reaches 20 mm. 3 Subsequently, mice were injected with 5 μg of Leptin-LNP or unencapsulated mRNA LNP via muscle, vein, or tumor every three days, and the size of the mouse tumor was measured and recorded every three days.

[0103] like Figure 11 As shown, compared with the intramuscular and intravenous injection groups, intratumoral injection of 5 μg Leptin-LNP significantly enhanced the effect of Leptin-LNP, inhibited tumor growth in mice, and promoted CD8. + T cells infiltrate the tumor microenvironment.

[0104] Specifically, the intratumoral-Leptin-LNP group significantly inhibited tumor growth in mice: the intratumoral-Leptin-LNP group (tumor size approximately 42 mm) 2 The tumor size was approximately 184 mm compared to the muscle-Leptin-LNP group. 2 ), the intravenous-Leptin-LNP group (tumor size approximately 144 mm) 2 Smaller.

[0105] Intratumoral-Leptin-LNP group promotes CD8 + T cell infiltration into the tumor microenvironment: Compared with the muscle-Leptin-LNP group, the intratumoral-Leptin-LNP group showed increased tumor infiltration CD8. + The proportion of T cells increased from 8% to 15%. Figure 11 **p<0.01); Compared with the intravenous-Leptin-LNP group, the intratumoral-Leptin-LNP group showed significantly higher tumor infiltration CD85 activity. + The proportion of T cells increased from 10% to 15%. Figure 11 , **p<0.01).

[0106] Intratumoral-Leptin-LNP group promotes CD8 + T cell proliferation: Compared with the muscle-Leptin-LNP group, the intratumoral-Leptin-LNP group showed increased CD8 proliferation. + The proportion of T cells increased from 12% to 29%. Figure 11 **p<0.01); Compared with the intravenous-Leptin-LNP group, the intratumoral-Leptin-LNP group showed significantly higher tumor infiltration CD85 activity. + The proportion of T cells increased from 20% to 15%. Figure 11 , **p<0.01).

[0107] appendix:

[0108] mus leptin original CDS sequence (after removing the stop codon):

[0109] ATGTGCTGGAGACCCCTGTGGCTTTGGTCCTATCTGTCTTATGTTCAAGCAGTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGCAGTCGGTATCCGCCAAGCAGAGGGTCACTGGCTTGGACTTCATTCCTGGGCTTCACCCCATTCTGAGTTTGTCCAAGATGGACCAGACTCTGGCAGTCTATCAACAG GTCCTCACCAGCCTGCCTTCCCAAAATGTGCTGCAGATAGCCAATGACCTGGAGAATCTCCGAGACCTCCTCCATCTGCTGGCCTTCTCCAAGAGCTGCTCCCTGCCTCAGACCAGTGGCCTGCAG AAGCCAGAGAGCCTGGATGGCGTCCTGGAAGCCTCACTCTACTCCACAGAGGTGGAGGCTTTGAGCAGGCTGCAGGGCTCTGCAGGACATTCTTCAACAGTTGGATGTTAGCCCTGAATGC (SEQ ID NO: 1)

[0110] The codon-optimized mouse leptin CDS sequence: This sequence is based on the original mouse leptin CDS sequence and was obtained by codon optimization to improve expression efficiency. Therefore, it differs from the original sequence, but the translation results are the same and the encoded amino acid sequence remains consistent.

[0111] ATGTGTTGGAGGCCTCTGTGCAGGTTCCTGTGGCTGTGGAGCTACCTGAGCTATGTGCAGGCCGTGCCCATCCAGAAGGTGCAGGATGACACCAAGACCCTGATCAAGACCATCGTGACAAGGATCAACGACATCTCTCACACACAGAGCGTGTCTGCTAAACAGCGGGTGACCGGCCTGGATTTTATCCCTGGCCTGCATCCTATCCTGAGCCTGAGCAAGATGGACCAGACCCTGGCCGTGTACCAGCAGGTGCTGACAAGCCTGCCTAGCCAGAACGTGCTGCAGATCGCTAATGACCTGGAGAATCTGAGAGATCTGCTGCACTTGCTGGCTTTCTCTAAGAGCTGTTCTCTGCCCCAGACAAGTGGCCTGCAGAAGCCTGAAAGCCTGGATGGCGTGCTGGAGGCTTCTCTGTATTCTACCGAGGTGGAGGCCCTGTCTAGGCTGCAGGGATCTCTGCAGGACATCCTGCAGCAGCTGGACGTGAGCCCTGAGTGC (SEQ ID NO: 2)

[0112] Leptin-SA coding region sequence:

[0113]

[0114] Leptin-Fc coding region sequence:

[0115]

[0116] Leptin DNA:

[0117] CTTACGCCGTAATACGACTCACTATAAGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGTGTTGGAGGCCTCTGTGCAGGTTCCTGTGGCTGTGGAGCTACCTGAGCTATGTGCAGGCCGTGCCCATCCAGAAGGTGCAGGATGACACCAAGACCCTGATCAAGACCATCGTGACAAGGATCAACGACATCTCTCACACACAGAGCGTGTCTGCTAAACAGCGGGTGACCGGCCTGGATTTTATCCCTGGCCTGCATCCTATCCTGAGCCTGAGCAAGATGGACCAGACCCTGGCCGTGTACCAGCAGGTGCTGACAAGCCTGCCTAGCCAGAACGTGCTGCAGATCGCTAATGACCTGGAGAATCTGAGAGATCTGCTGCACTTGCTGGCTTTCTCTAAGAGCTGTTCTCTGCCCCAGACAAGTGGCCTGCAGAAGCCTGAAAGCCTGGATGGCGTGCTGGAGGCTTCTCTGTATTCTACCGAGGTGGAGGCCCTGTCTAGGCTGCAGGGATCTCTGCAGGACATCCTGCAGCAGCTGGACGTGAGCCCTGAGTGCTACCCGTATGATGTGCCAGACTATGCATGATAGGCGGCCGCTTAATTAAGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG(SEQ ID NO: 5)

[0118] Leptin ORF mRNA:

[0119] AUGUGUUGGAGGCCUCUGUGCAGGUUCCUGUGGCUGUGGAGCUACCUGAGCUAUGUGCAGGCCGUGCCCAUCCAGAAGGUGCAGGAUGACACCAAGACCCUGAUCAAGACCAUCGUGACAAGGAUCAACGACAUCUCUCACACACAGAGCGUGUCUGCUAAACAGCGGGUGACCGGCCUGGAUUUUAUCCCUGGCCUGCAUCCUAUCCUGAGCCUGAGCAAGAUGGACCAGACCCUGGCCGUGUACCAGCAGGUGCUGACAAGCCUGCCUAGCCAGAACGUGCUGCAGAUCGCUAAUGACCUGGAGAAUCUGAGAGAUCUGCUGCACUUGCUGGCUUUCUCUAAGAGCUGUUCUCUGCCCCAGACAAGUGGCCUGCAGAAGCCUGAAAGCCUGGAUGGCGUGCUGGAGGCUUCUCUGUAUUCUACCGAGGUGGAGGCCCUGUCUAGGCUGCAGGGAUCUCUGCAGGACAUCCUGCAGCAGCUGGACGUGAGCCCUGAGUGC (SEQ ID NO: 6)

[0120] Deletion mutant Leptin-I14Del mRNA of mouse Leptin with deletion of isoleucine at position 14:

[0121] AUGUGUUGGAGGCCUCUGUGCAGGUUCCUGUGGCUGUGGAGCUACCUGAGCUAUGUGCAGGCCGUGCCCAUCCAGAAGGUGCAGGAUGACACCAAGACCCUGAAGACCAUCGUGACAAGGAUCAACGACAUCUCUCACACACAGAGCGUGUCUGCUAAACAGCGGGUGACCGGCCUGGAUUUUAUCCCUGGCCUGCAUCCUAUCCUGAGCCUGAGCAAGAUGGACCAGACCCUGGCCGUGUACCAGCAGGUGCUGACAAGCCUGCCUAGCCAGAACGUGCUGCAGAUCGCUAAUGACCUGGAGAAUCUGAGAGAUCUGCUGCACUUGCUGGCUUUCUCUAAGAGCUGUUCUCUGCCCCAGACAAGUGGCCUGCAGAAGCCUGAAAGCCUGGAUGGCGUGCUGGAGGCUUCUCUGUAUUCUACCGAGGUGGAGGCCCUGUCUAGGCUGCAGGGAUCUCUGCAGGACAUCCUGCAGCAGCUGGACGUGAGCCCUGAGUGC (SEQ ID NO: 7)

[0122] Sequence of mouse albumin Glu 25-Ala 608:

[0123]

[0124] Mouse IgG1 Fc monomer region: Val 98-Lys 324 sequence:

[0125] (SEQ ID NO: 9)

[0126] Appendix: This invention relates to a sequence list of related components.

[0127]

[0128] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. An isolated mRNA, characterized in that, It is an mRNA sequence encoding leptin or a leptin fusion protein CDS, wherein the mRNA sequence encoding the leptin CDS is transcribed from the nucleotide sequence shown in SEQ ID NO: 2, i.e., as shown in SEQ ID NO: 6; the mRNA is modified in the following two ways: (1) N1-methyl-pseudouridine (m1Ψ) modification of UTP, wherein the modification is that the entire UTP is replaced by N1-methyl-pseudouridine (m1Ψ); and, (2) EZcap with capping; The leptin fusion protein is a leptin-albumin fusion protein or a leptin-Fc monomer fusion protein, wherein the leptin fusion protein has albumin or Fc monomer linked to the C-terminus of the leptin coding region.

2. The mRNA as described in claim 1, characterized in that, The Fc monomer is an IgG1 Fc monomer.

3. The mRNA as described in claim 2, characterized in that, The leptin fusion protein is connected from the C-terminus of the leptin coding region to the N-terminus of albumin or Fc monomer via linker 1.

4. The mRNA as described in claim 3, characterized in that, The C-terminus of the albumin or Fc monomer is linked to the tag protein via linker 2.

5. The mRNA as described in claim 3, characterized in that, The nucleotide sequence encoding albumin is shown in SEQ ID NO:

8.

6. The mRNA as described in claim 3, characterized in that, The nucleotide sequence encoding the IgG1 Fc monomer is shown in SEQ ID NO:

9.

7. The mRNA as described in claim 3, characterized in that, The nucleotide sequence encoding linker 1 is shown in SEQ ID NO:

16.

8. The mRNA as described in claim 4, characterized in that, The nucleotide sequence encoding linker 2 is shown in SEQ ID NO:

17.

9. The mRNA as described in claim 3, characterized in that, The mRNA sequence encoding the leptin fusion protein CDS is selected from the following sequences: (1) The mRNA sequence encoding the leptin-albumin fusion protein obtained by transcription from the nucleotide sequence shown in SEQ ID NO: 3; and, (2) The mRNA sequence encoding the leptin-Fc monomer fusion protein obtained by transcription from the nucleotide sequence shown in SEQ ID NO:

4.

10. An mRNA, characterized in that, It comprises the mRNA sequence encoding leptin or leptin fusion protein CDS as described in claim 1, and the mRNA sequence obtained by transcription of one or more of the following DNA sequences: (1) The encoded sequence of the 5' UTR; (2) The encoded sequence of the 3' UTR; (3) A polyA tail coding sequence, wherein the polyA tail coding sequence consists of 50-150 repeating thymines; (4) HA tag; and, (5) T7 promoter, the sequence of which is shown in SEQ ID NO:

11.

11. The mRNA as described in claim 10, characterized in that, The encoded sequence of the 5' UTR is shown in SEQ ID NO:

14.

12. The mRNA as described in claim 10, characterized in that, The encoded sequence of the 3' UTR is shown in SEQ ID NO:

15.

13. The mRNA as described in claim 10, characterized in that, The coding sequence of the polyA tail consists of 100 repeating thymine.

14. The mRNA as described in claim 10, characterized in that, The sequence of the HA tag is shown in SEQ ID NO:

10.

15. The mRNA as described in claim 10, characterized in that, The mRNA was obtained by transcription from the nucleotide sequence shown in SEQ ID NO:

5.

16. A pharmaceutical composition, characterized in that, It comprises the mRNA as described in any one of claims 1-15, and a pharmaceutically acceptable carrier and / or excipient.

17. The pharmaceutical composition of claim 16, characterized in that, The carrier is a lipid nanoparticle, and the lipid nanoparticle comprises: Packaging lipids of cationic lipid SM102, cholesterol, distearate phosphatidylcholine DSPC, and polyethylene glycol-modified lipid molecule PEG2000-DMG.

18. The pharmaceutical composition of claim 17, characterized in that, The mass ratio of SM102:DSPC:cholesterol:PEG2000-DMG is (4.4~4.5):1:(1.8~1.9):(0.4~0.5).

19. The pharmaceutical composition of claim 17, characterized in that, The mass ratio of the packaging lipid to mRNA is (15~30):

1.

20. The pharmaceutical composition of claim 19, characterized in that, The mass ratio of the packaging lipid to mRNA is (20~25):

1.

21. The pharmaceutical composition of claim 20, characterized in that, The mass ratio of the packaging lipid to mRNA was 23:1, and the resulting lipid nanoparticles had a particle size of 100 nm.

22. The pharmaceutical composition according to any one of claims 16 to 21, characterized in that, The drug composition is an intratumoral injection formulation.

23. The pharmaceutical composition according to any one of claims 16 to 21, characterized in that, The pharmaceutical composition also includes a tumor vaccine as an active ingredient.

24. The pharmaceutical composition according to claim 23, characterized in that, The vaccine in question is either the MC38 tumor vaccine or the B16-F10 tumor vaccine.

25. The use of the mRNA as described in any one of claims 1 to 15 or the pharmaceutical composition as described in any one of claims 16 to 24 in the preparation of an antitumor drug, wherein the tumor is colon cancer or melanoma.

Images