A snp molecular marker related to egg production traits of muscovy ducks and application thereof

Abstract

The present application relates to a SNP molecular marker related to the egg production trait of Muscovy duck, and an application thereof, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and a C>T mutation exists in the 62th base from the 5' end. The primer pair for amplifying and detecting the SNP molecular marker is a KASP primer group, and the sequences thereof are shown in SEQ ID NO: 2-6; the SNP molecular marker, the primer pair, the KASP primer group and the like are applied to the auxiliary identification and breeding of a high-yield egg Muscovy duck breed. The present application first discovers a CDC20 gene SNP molecular marker related to the egg production trait of Muscovy duck, provides a new molecular marker for molecular marker assisted selection breeding, and provides a scientific basis for the breeding of a new strain of Muscovy duck with excellent reproductive traits; the egg production of the CC genotype is higher than that of the CT genotype and the TT genotype, and high-yield egg Muscovy duck individuals can be quickly screened through early genotyping.

Description

Technical Field

[0001] This invention belongs to the field of animal genetics and breeding technology, specifically relating to a SNP molecular marker related to egg production traits in Muscovy ducks and its application. Background Technology

[0002] Muscovy duck ( Cairina moschata The Muscovy duck (also known as the Muscovy duck or muskrat), native to the tropical regions of Central and South America, is widely raised in Fujian, Zhejiang, Guangdong, and some provinces along the Yangtze River due to its rapid growth, strong resistance to disease, and high meat yield. However, Muscovy ducks suffer from problems such as low egg production, strong broodiness, and unstable fertilization rates of hatching eggs. Furthermore, egg production is a complex quantitative trait with low heritability, making it difficult to achieve significant progress using traditional breeding techniques.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level in an individual. It is the most abundant type of DNA molecular marker in the genome, with characteristics such as stable inheritance and easy detection. It can be used for molecular marker-assisted selection (MAS) to improve the accuracy and effectiveness of selection.

[0004] CDC20 (cell dibision cycle 20) is an activator of the E3 ubiquitin ligase APC / C, capable of ubiquitinizing securin and cyclin B1, and participating in the regulation of cell cycle and cell division. Studies have found that the CDC20 gene is closely related to the maturation and development of animal oocytes. Currently, there are no reports on SNP molecular markers of the CDC20 gene associated with egg production traits in Muscovy ducks. This invention, based on KASP technology to detect the CDC20 genotype, identifies SNP molecular markers associated with egg production traits in Muscovy ducks, providing a favorable theoretical basis for marker-assisted selection breeding of Muscovy ducks. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to the egg production trait of Muscovy ducks and its application, so as to solve the problems existing in the prior art. This molecular marker is significantly correlated with the egg production of Muscovy ducks at 300 days of age and 400 days of age, providing a scientific basis for the breeding of Muscovy duck egg production traits.

[0006] The objective of this invention is achieved through the following technical solution: A SNP molecular marker associated with egg production in Muscovy ducks, the SNP molecular marker being derived from the CDC20 gene, and the nucleotide sequence of the SNP molecular marker being shown in SEQ ID NO: 1, exhibits a C>T mutation at position 62 from the 5' end of the sequence shown in SEQ ID NO: 1. This mutation is located at 11345577 bp on chromosome 8 of the Muscovy duck genome (GWHBJBF00000000).

[0007] 5'-CAAGCCTGTGTTCCAAAGCCCCACAGCTCCAGCAACCCTTAGACAGCCCCTCTGGTTCCAC C GCACTCACCTGGACCTCAGCATTACTCGTACCAACAGCAAGGTAGTTTCCTTCTTTAATCCATGACACAGAGGACACGTAATCATCTGGATGCTCCATCTGCAGCAGATGGATGATTTCCCCAGAAGTACAATTCCACAGATAGACAGAGT TGTCCAGAGCCACCGCCAGGAAGTTCTGAGAGCTCCAGTCGATGAGATTCAGATCTGCAGTTTGGAAGAGAATGCAGGACACGCAGTGCTGACCCGCAGAGCCCTGCCTACACACAGGCTACACCTCAGAAGCAGTCAGTGCCA-3' (SEQ IDNO: 1).

[0008] The 62nd base from the 5' end in the nucleotide sequence of the SNP molecular marker is associated with the egg production trait of Muscovy ducks. The CC genotype of this SNP molecular marker has higher egg production at 300 days and 400 days of age than individuals with the CT and TT genotypes.

[0009] A primer pair for amplifying the SNP molecular marker, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0010] Upstream primer: 5'-CAAGCCTGTGTTCCAAAGCC-3' (SEQ ID NO:2) Downstream primer: 5'-TGGCACTGACTGCTTCTGAG-3' (SEQ ID NO:3).

[0011] A kit A for detecting the SNP molecular markers described above, said kit A comprising the primer pair of claim 3.

[0012] A KASP primer set for detecting the SNP molecular marker described above includes a first forward primer with a nucleotide sequence as shown in SEQ ID NO:4, a second forward primer with a nucleotide sequence as shown in SEQ ID NO:5, and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:6.

[0013] The first and second forward primers are labeled with FAM and VIC fluorescent groups, respectively, corresponding to the two fluorescent signals FAM and VIC.

[0014] First forward primer: 5'- GAAGGTGACCAAGTTCATGCT CTTAGACAGCCCCTCTGGTTCCACC-3' (underlined part is the specific fluorescent sequence FAM) (SEQ ID NO:4). Second forward primer: 5'- GAAGGTCGGAGTCAACGGATT CTTAGACAGCCCCTCTGGTTCCACT-3' (underlined part is the specific fluorescent sequence VIC) (SEQ ID NO:5). Reverse primer: 5'-GTTGGTACGAGTAATGCTGAGGTCCAGGT-3' (SEQ ID NO:6).

[0015] A kit B for detecting the SNP molecular marker, wherein the kit B contains the KASP primer set as described in claim 5.

[0016] The application of SNP molecular markers related to Muscovy duck egg production traits, primer pairs for amplifying the SNP molecular markers, kit A containing the primer pairs, and KASP primer sets for detecting the SNP molecular markers or kit B containing the KASP primer sets in assisting the identification and breeding of high-egg-producing Muscovy duck breeds, and / or in early prediction of Muscovy duck egg production traits, and / or in marker-assisted breeding related to Muscovy duck egg production traits.

[0017] A method for assisting in the identification or breeding of high-egg-producing Muscovy duck breeds includes the following steps: (1) Extract genomic DNA from the Muscovy duck to be tested; (2) Using the primer pair of SEQ ID NO:2 and SEQ ID NO:3 as described in claim 3, the obtained DNA is specifically amplified to obtain the amplified product; (3) Sequencing analysis of the amplification products to determine the genotype of the SNP molecular marker; when breeding high-egg-producing Muscovy ducks, Muscovy ducks with the genotype CC are selected as high-egg-producing Muscovy ducks.

[0018] This invention also provides another method for assisting in the identification or breeding of high-egg-producing Muscovy duck breeds, comprising the following steps: (1) Extract genomic DNA from the Muscovy duck to be tested; (2) Using the KASP primer set SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 described in claim 5, the obtained DNA is subjected to PCR reaction, wherein SEQ ID NO:4 and SEQ ID NO:5 are respectively labeled with FAM and VIC fluorescent groups, that is, corresponding to two fluorescent signals, FAM and VIC. Finally, the fluorescence values ​​of the two fluorescent signals are detected to determine the genotyping status of the sample to be tested. (3) Genotype determination: Determine the genotype of the SNP molecular marker. When only FAM fluorescence is detected, it is the CC genotype; when only VIC fluorescence is detected, it is the TT genotype; when both FAM and VIC fluorescence are detected, it is the CT genotype. When breeding high-egg-producing Muscovy ducks, Muscovy ducks with the CC genotype are selected as high-egg-producing Muscovy ducks.

[0019] Compared with the prior art, the advantages of the present invention are as follows: This invention is the first to discover a SNP molecular marker in the CDC20 gene associated with egg production in Muscovy ducks, providing a new molecular marker for marker-assisted selection breeding and a scientific basis for the selection of new strains with superior reproductive traits. The nucleotide sequence of this molecular marker is shown in SEQ ID NO: 1, with a C / T mutation at nucleotide 62. This mutation is located at 11345577 bp on chromosome 8 of the Muscovy duck genome (GWHBJBF00000000). Primers designed for this SNP site effectively distinguished allelic variant sites, and detection was completed through DNA extraction, PCR-specific amplification, and KASP genotyping. This invention found that the CC genotype at this site had higher egg production at 300 and 400 days of age than the CT and TT genotypes. Early genotyping allows for rapid screening of high-producing Muscovy duck individuals. Attached Figure Description

[0020] Figure 1 This is a gel electrophoresis image of Example 1 of the present invention; wherein lane 1 is DNA Marker (DL2000), lanes 2, 3, 5, and 6 are samples 1, 2, 3, and 4 respectively, and lane 4 is a blank control.

[0021] Figure 2 This is a polymorphic sequencing diagram of the Muscovy duck CDC20 gene locus of the present invention.

[0022] Figure 3This is a gel electrophoresis image of Example 2 of the present invention; wherein lane 1 is DNA Marker (DL2000), lanes 2 and 4 are blank controls, and lanes 3 and 5 are samples 1 and 2.

[0023] Figure 4 This is a Muscovy duck CDC20 genotyping diagram obtained by KASP genotyping according to the present invention. Detailed Implementation

[0024] The present invention will now be described in detail with reference to the accompanying drawings and embodiments: Example 1: Identification of SNPs in the Muscovy Duck CDC20 Gene 1. Test materials Forty-eighty healthy Muscovy ducks were selected, and 5 mL of venous blood was collected from each duck for genomic DNA extraction. All experimental ducks were raised at Zhangzhou Changlong Agricultural and Animal Husbandry Co., Ltd., under the same feeding and management conditions. Reproductive trait data, such as egg production at 300 days of age and egg production at 400 days of age, were recorded.

[0025] 2. Test methods 2.1 Primer Design Based on the Muscovy duck reference genome (GWHBJBF00000000), specific primers were designed using Premier 5.0 software. The primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd. The sequences are shown in SEQ ID NO: 2–3.

[0026] 2.2 Blood DNA Extraction Genomic DNA was extracted from blood samples using the Tiangen Blood Genomic DNA Extraction Kit (DP304).

[0027] 2.3 PCR amplification DNA from 60 randomly selected Muscovy ducks was used as a template for PCR amplification using primers SEQ ID NO: 2-3. The amplification program was: 98℃, 10 min, 30 cycles (98℃, 10 s, 55℃, 30 s, 72℃, 30 s), 72℃, 10 min, and storage at 4℃. The amplification mixture consisted of 12.5 μl 2 × Taq Plus Master Mix II (Dye Plus), 0.5 μl each of forward and reverse primers, 0.5 μl DNA template, and finally, ddH2O to a final volume of 25 μl.

[0028] After amplification, the amplification products of four randomly selected samples (sample numbers labeled 1, 2, 3, and 4) were analyzed by electrophoresis on a 1.5% agarose gel. The target fragment size was 357 bp. The electrophoresis image is shown below. Figure 1 .

[0029] 3. Results Using the SeqMan tool in DNAstar software, the Sanger sequencing results of the PCR products were analyzed to determine the SNP sites. A C>T mutation was found at position 62 of the amplified fragment (see the polymorphic sequencing diagram of this site, e.g.). Figure 2 (As shown).

[0030] Example 2: Association Analysis between KASP Genotyping and Egg Production 1. Test materials: Same as in Example 1.

[0031] 2. Test methods 2.1 Primer Design Three primers were designed for the SNP site (sequences are shown in SEQ ID NO: 4-6): two forward specific primers and one reverse universal primer. The two forward primers correspond to the two fluorescence signals FAM and VIC, respectively. After PCR reaction, the fluorescence values ​​of the two fluorescence signals were finally detected to determine the genotyping of the sample.

[0032] 2.2 KASP Genotyping Procedure Amplification was performed using KASP Master Mix (HiGeno 2× Probe Mix, catalog number AQP-001 L) from Beijing Jiacheng Biotechnology Co., Ltd. The KASP genotyping premix consisted of 5 μl HiGeno 2× Probe Mix A, 0.14 μl Primer Mix, and 1 μl DNA template (DNA concentration 10 ng / μl), with ddH2O added to a final volume of 10 μl. The amplification program was: 95℃, 10 min, 10 cycles (95℃, 20 s, 61-55℃ (-0.6℃ / cycle), 40 s), 10 cycles (95℃, 20 s, 55℃, 40 s), stored at 25℃. If clear genotypic clusters were not obtained, PCR amplification could continue. The amplification program was: 94℃ denaturation for 20 s, 57℃ annealing and extension for 40 s, for a total of 3-6 cycles, followed by endpoint fluorescence reading at 35℃ / 60 s. Amplification was performed using a QuantStudio 5 Flext real-time PCR system (Applied Biosystems, Thermo Fisher Scientific™, USA). After amplification, the amplification products from two randomly selected samples (sample numbers 1 and 2) were analyzed by electrophoresis on a 1.5% agarose gel. The target fragment size was 81 bp. The electrophoresis images are shown below. Figure 3 .

[0033] 2.3 Correlation Analysis Association analysis between genotype and egg production at 300 days and 400 days of age was performed using the GLM program in the SAS 9.4 statistical software package.

[0034] 3 Results 3.1 Genotype determination Detection of only FAM fluorescence (near the Y-axis, blue image) indicates the CC genotype; detection of only VIC fluorescence (near the X-axis, red image) indicates the TT genotype; and detection of both FAM and VIC fluorescence (green image) indicates the CT genotype. Five individuals were randomly selected for each genotype for Sanger sequencing verification, achieving 100% concordance. The Muscovy duck CDC20 genotyping map obtained from KASP genotyping is shown below. Figure 4 As shown in Table 1, the genotype frequency distribution in this population is presented in Table 1.

[0035] Table 1. Frequency distribution of each genotype

[0036] 3.2 Association analysis between SNP sites and egg production traits GLM linear analysis showed that SNP loci were significantly correlated with egg production at 300 days and 400 days of age in this population of Muscovy ducks. P <0.05), compared to the CT and TT genotypes, the CC genotype at this locus has a higher egg production (see Table 2). Therefore, when breeding high-egg-producing Muscovy ducks, individuals with the CC genotype can be selected and retained.

[0037] The GLM linear model is: Y ijkl =μ+ G i +P k +e ijkl , where Y ijkl Here, μ represents the observed trait value, and G represents the mean. i For genotype effect, P k Due to batch effect, e ijkl The results are random errors; the analysis results were validated using Bonferroni multiple comparisons, and the results are expressed as mean ± standard deviation.

[0038] Table 2. Correlation analysis between SNPs and egg production

[0039] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The KASP primer set for detecting SNP molecular markers associated with Muscovy duck egg production traits, or the kit B containing the KASP primer set, for the auxiliary identification and breeding of high-egg-producing Muscovy duck breeds, and / or for the early prediction of Muscovy duck egg production traits, and / or for the application of molecular marker-assisted breeding associated with Muscovy duck egg production traits. The KASP primer set includes a first forward primer with a nucleotide sequence as shown in SEQ ID NO: 4, a second forward primer with a nucleotide sequence as shown in SEQ ID NO: 5, and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 6; The SNP molecular marker is derived from the CDC20 gene. The nucleotide sequence of the SNP molecular marker is shown below. A C>T mutation exists at the 62nd base from the 5' end in the sequence shown. 5'-CAAGCCTGTGTTCCAAAGCCCCACAGCTCCAGCAACCCTTAGACAGCCCCTCTGGTTCCAC C GCACTCACCTGGACCTCAGCATTACTCGTACCAACAGCAAGGTAGTTTCCTTCTTTAATCCATGACACAGAGGACACGTAATCATCTGGATGCTCCATCTGCAGCAGATGGATGATTTCCCCAGAAGTACAATTCCACAGATAGACAGAGTTGTCCAGAGCCACCGCCAGGAAGTTCTGAGAGCTCCAGTCGATGAGATTCAGATCTGCAGTTTGGAAGAGAATGCAGGACACGCAGTGCTGACCCGCAGAGCCCTGCCTACACACAGGCTACACCTCAGAAGCAGTCAGTGCCA-3'; The 62nd base from the 5' end in the nucleotide sequence of the SNP molecular marker is associated with the egg production trait of Muscovy ducks. The CC genotype of this SNP molecular marker has higher egg production at 300 days and 400 days of age than individuals with the CT and TT genotypes.

2. A method for assisting in the identification or breeding of high-egg-producing Muscovy duck breeds, characterized in that, Includes the following steps: (1) Extract genomic DNA from the Muscovy duck to be tested; (2) Using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, the obtained DNA is specifically amplified to obtain amplified products; (3) Sequencing analysis of the amplification products to determine the genotype of the SNP molecular marker as described in claim 1; when breeding high-egg-producing Muscovy ducks, Muscovy ducks with the genotype CC are selected as high-egg-producing Muscovy ducks.

3. A method for assisting in the identification or breeding of high-egg-producing Muscovy duck breeds, characterized in that, Includes the following steps: (1) Extract genomic DNA from the Muscovy duck to be tested; (2) Using the KASP primer set SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 described in claim 1, the obtained DNA is subjected to PCR reaction, wherein SEQ ID NO:4 and SEQ ID NO:5 are labeled with FAM and VIC fluorescent groups respectively, that is, corresponding to two fluorescent signals, FAM and VIC. Finally, the fluorescence values ​​of the two fluorescent signals are detected to determine the genotyping status of the sample to be tested. (3) Genotype determination: Determine the genotype of the SNP molecular marker. When only FAM fluorescence is detected, it is the CC genotype; when only VIC fluorescence is detected, it is the TT genotype; when both FAM and VIC fluorescence are detected, it is the CT genotype. When breeding high-egg-producing Muscovy ducks, Muscovy ducks with the CC genotype are selected as high-egg-producing Muscovy ducks.

Images