Molecular marker of wheat MYB transcription factor family member tarve1-6b and application thereof

Abstract

The application discloses a molecular marker of a wheat MYB transcription factor family member TaRVE1-6B and application thereof, and belongs to the technical field of crop selection and cultivation. The molecular marker comprises RVE1-6B-527566461, RVE1-6B-527565157 and RVE1-6B-527561616, the genotypes of InDel2, InDel5 and InDel8 sites can be determined according to the sizes of amplified bands of the molecular marker, and the haplotype of TaRVE1-6B can be determined according to the genotypes of the InDel2, InDel5 and InDel8 sites. The application has the advantages that excellent alleles of TaRVE1-6B are discovered from a natural wheat population, and molecular markers for identifying the plant height, ear length and thousand-grain weight of wheat are developed, and gene resources and effective ways are provided for the genetic improvement of yield traits of wheat.

Description

Technical Field

[0001] This invention relates to molecular markers and their applications, specifically to molecular markers of TaRVE1-6B, members of the wheat MYB transcription factor family, and their applications in assisted breeding, belonging to the field of crop selection and breeding technology. Background Technology

[0002] Wheat is an important staple food crop in my country. Conventional breeding methods for wheat are time-consuming, making it imperative to shorten breeding cycles and accelerate the process. Molecular marker-assisted breeding, as one of the core technologies of the molecular breeding 3.0 era, together with transgenic breeding and molecular module breeding, constitutes the application system of modern molecular biology in breeding. Molecular marker-assisted breeding technology designs marker sites based on the sequence information of linkage polymorphic regions of the target trait, enabling precise and efficient identification of this trait during the breeding process, thereby accelerating the wheat breeding process and improving efficiency.

[0003] The biological clock is an endogenous genetic timing mechanism developed by plants through long-term evolution. It senses and predicts environmental rhythms such as light, temperature, humidity, and nutrients, synchronously regulating plant growth, development, movement, gene and protein expression, and metabolism. Biological clock regulation includes key agronomic traits such as photosynthetic efficiency, latitudinal adaptability, symbiotic nitrogen fixation, and stress resistance, and is closely related to yield (biomass) and quality. The core oscillator of the biological clock consists of a negative-negative transcriptional regulatory loop composed of a series of transcriptional repressors. The REVEILLE (RVE) family is a key component of the biological clock system, belonging to the MYB transcription factor subfamily. This family also includes the core components of the biological clock, CCA1 and LHY. To date, the functions of TaRVE1-6B, members of the MYB transcription factor subfamily in the wheat biological clock system, and the development and utilization of their molecular markers have not been reported. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for TaRVE1-6B, a member of the wheat MYB transcription factor family, and its application, thereby providing genetic resources and an effective approach for the genetic improvement of wheat yield traits.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] Molecular markers for TaRVE1-6B, a member of the wheat MYB transcription factor family, comprising four haplotypes: TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl b, TaRVE1-6B-Hapl c, and TaRVE1-6B-Hapl d. The molecular markers include RVE1-6B-527566461, RVE1-6B-527565157, and RVE1-6B-527561616, wherein:

[0007] RVE1-6B-527566461 was amplified using the two primers shown in SEQ ID NO: 19 and SEQ ID NO: 20. When the amplified band size of RVE1-6B-527566461 was 274 bp, the genotype at the InDel2 locus was TGCATGTTGCCAG. When the amplified band size of RVE1-6B-527566461 was 262 bp, the genotype at the InDel2 locus was T.

[0008] RVE1-6B-527565157 was amplified using the two primers shown in SEQ ID NO: 21 and SEQ ID NO: 22. When the amplified band size of RVE1-6B-527565157 was 293 bp, the genotype at the InDel5 locus was CCCACGGCGGGCGGCATCAGCG. When the amplified band size of RVE1-6B-527565157 was 272 bp, the genotype at the InDel5 locus was C.

[0009] RVE1-6B-527561616 was amplified using two forward primers shown in SEQ ID NO: 23 and SEQ ID NO: 24 and one reverse primer shown in SEQ ID NO: 25. When the amplified band size of RVE1-6B-527561616-F1w / R1c is 608bp and there is no amplified band in RVE1-6B-527561616-F1m / R1c, the genotype at the InDel8 locus is CA. When the amplified band size of RVE1-6B-527561616-F1m / R1c is 610bp and there is no amplified band in RVE1-6B-527561616-F1w / R1c, the genotype at the InDel8 locus is CAAA.

[0010] The haplotype of TaRVE1-6B was determined based on the genotypes at the InDel2, InDel5, and InDel8 loci identified by RVE1-6B-527566461, RVE1-6B-527565157, and RVE1-6B-527561616. Specifically:

[0011] When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG, and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl a.

[0012] When the genotype at InDel2 is T, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG, and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl b.

[0013] When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is C, and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl c.

[0014] When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG, and the genotype at InDel8 is CAAA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl d.

[0015] The application of the molecular marker TaRVE1-6B, a member of the aforementioned wheat MYB transcription factor family, in the selection of the wheat TaRVE1-6B-Hapl d haplotype resulted in the TaRVE1-6B-Hapl d haplotype exhibiting shorter plant height and higher thousand-grain weight compared to the TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl b, and TaRVE1-6B-Hapl c haplotypes.

[0016] The aforementioned molecular marker of wheat MYB transcription factor family member TaRVE1-6B was used in the selection of wheat haplotype TaRVE1-6B-Hapl b. Compared with haplotypes TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl c and TaRVE1-6B-Hapl d, haplotype TaRVE1-6B-Hapl b has a longer spike length.

[0017] The advantages of this invention are as follows: This invention has discovered the superior alleles of TaRVE1-6B from natural wheat populations (the superior haplotypes for plant height and thousand-grain weight are TaRVE1-6B-Hapl d, and the superior haplotype for spike length is TaRVE1-6B-Hapl b), and developed relevant functional molecular markers (RVE1-6B-527566461, RVE1-6B-527565157, and RVE1-6B-527561616) for identifying wheat plant height, spike length, and thousand-grain weight, providing genetic resources and effective methods for the genetic improvement of wheat yield traits. Attached Figure Description

[0018] Figure 1 This is a diagram showing the TaRVE1-6B gene mutation sites and haplotype classification;

[0019] Figure 2 This is a partial detection result of the molecular marker RVE1-6B-527566461 on polyacrylamide gel;

[0020] Figure 3 This is a partial detection result of the molecular marker RVE1-6B-527565157 on polyacrylamide gel;

[0021] Figure 4 This is a partial detection result of the molecular marker RVE1-6B-527561616 on an agarose gel. Detailed Implementation

[0022] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0023] I. Identification of the TaRVE1-6B polymorphic site, a member of the wheat MYB transcription factor family

[0024] 1. Design specific primers

[0025] Specific primers were designed based on the TaRVE1-6B genome sequence (SEQ ID NO: 26) for PCR amplification and sequencing. The designed specific primers are TaRVE1-6B-1F / 1R, TaRVE1-6B-2F / 2R, TaRVE1-6B-3F / 3R, TaRVE1-6B-4F / 4R, TaRVE1-6B-5F / 5R, TaRVE1-6B-6F / 6R, TaRVE1-6B-7F / 7R, TaRVE1-6B-8F / 8R, and TaRVE1-6B-9F / 9R. The nucleotide sequences of each specific primer are as follows:

[0026] TaRVE1-6B-1F:

[0027] GTCCCGTCTTGTCATGCTCC(SEQ ID NO:1);

[0028] TaRVE1-6B-1R:

[0029] CCAACACACTGCCTGGAACT(SEQ ID NO:2);

[0030] TaRVE1-6B-2F:

[0031] GCCGATACATCTGATAGCATTT(SEQ ID NO:3);

[0032] TaRVE1-6B-2R:

[0033] TATTAAGATCATTGCTTGTG(SEQ ID NO:4);

[0034] TaRVE1-6B-3F:

[0035] GAAATCAGGACTTGGCTGTG(SEQ ID NO:5);

[0036] TaRVE1-6B-3R:

[0037] CTTCTGCTATTTCTATGCA(SEQ ID NO:6);

[0038] TaRVE1-6B-4F:

[0039] CCCTGTCACCGGCAAATTTC(SEQ ID NO:7);

[0040] TaRVE1-6B-4R:

[0041] CCCGCTCAACTAGTACAAAGC(SEQ ID NO:8);

[0042] TaRVE1-6B-5F:

[0043] ACTAGTTGAGCGGGAGTAGGT(SEQ ID NO:9);

[0044] TaRVE1-6B-5R:

[0045] ACCGCAGACCACAAGTTCAT(SEQ ID NO:10);

[0046] TaRVE1-6B-6F:

[0047] CGCCTCAGTTGTCCTACTCC (SEQ ID NO: 11);

[0048] TaRVE1-6B-6R:

[0049] GGAGTGGAAGGCAGCATATCA (SEQ ID NO: 12);

[0050] TaRVE1-6B-7F:

[0051] GCTACTCTCGTTGTTTGCAGTG (SEQ ID NO: 13);

[0052] TaRVE1-6B-7R:

[0053] TTTTCCTGATGCCGATTCGC (SEQ ID NO: 14);

[0054] TaRVE1-6B-8F:

[0055] TGGAGTTGTTGGAGAAGCGG (SEQ ID NO: 15);

[0056] TaRVE1-6B-8R:

[0057] TTGGACGAGAGAGCATGCAG (SEQ ID NO: 16);

[0058] TaRVE1-6B-9F:

[0059] ACCACACCAGGGAAAAGACC (SEQ ID NO: 17);

[0060] TaRVE1-6B-9R:

[0061] CGAGCGTAACTTTGTGGGTG (SEQ ID NO: 18).

[0062] 2. PCR amplification

[0063] The DNA from the 40 wheat materials (all from the National Germplasm Bank) in Table 1 was amplified by PCR using the specific primers TaRVE1-6B-1F / 1R, TaRVE1-6B-2F / 2R, TaRVE1-6B-3F / 3R, TaRVE1-6B-4F / 4R, TaRVE1-6B-5F / 5R, TaRVE1-6B-6F / 6R, TaRVE1-6B-7F / 7R, TaRVE1-6B-8F / 8R, and TaRVE1-6B-9F / 9R, respectively.

[0064] The PCR amplification system was 50 mL and consisted of: 2.0 μL DNA template, 2.0 μL upstream primer, 2.0 μL downstream primer, 25 μL 2×Phanta mixing buffer, 1.0 μL dNTP mixture (each at a concentration of 2.5 μM), 1.0 mL PhantaMax ultra-fidelity DNA polymerase, and 17.0 μL ddH2O.

[0065] Amplification was performed using a standard amplification procedure, with the following steps:

[0066] (1) Denaturation at 95℃ for 3 min;

[0067] (2) 34 cycles of conventional PCR program: denaturation at 95℃ for 40s, annealing at 58℃ for 40s, extension at 72℃ for 3min;

[0068] (3) Extend at 72℃ for 10 min; stop amplification and store at 4℃.

[0069] Table 1. 40 common wheat varieties

[0070]

[0071] 3. Sequence Analysis

[0072] The target fragment was recovered by gel excision, and the recovered product was subjected to bidirectional first-generation sequencing using specific primers TaRVE1-6B-1F / 1R, TaRVE1-6B-2F / 2R, TaRVE1-6B-3F / 3R, TaRVE1-6B-4F / 4R, TaRVE1-6B-5F / 5R, TaRVE1-6B-6F / 6R, TaRVE1-6B-7F / 7R, TaRVE1-6B-8F / 8R, and TaRVE1-6B-9F / 9R.

[0073] Sequence analysis revealed 58 variant sites in the TaRVE1-6B gene, including 49 SNP sites and 9 InDel sites. Of these, 49 variant sites are located upstream of the start codon, 3 downstream of the stop codon, 2 in exons, and 4 in introns. Due to co-segregation at some variant sites, four haplotypes were identified: TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl b, TaRVE1-6B-Hapl c, and TaRVE1-6B-Hapl d. See details below. Figure 1 And Tables 2-1, 2-2, and 2-3.

[0074] Table 2-1 TaRVE1-6B gene variant site information (I)

[0075]

[0076] Table 2-2 TaRVE1-6B gene variant site information (II)

[0077]

[0078] Table 2-3 TaRVE1-6B gene variant site information (Part III)

[0079]

[0080] II. Development and Haplotype Identification of TaRVE1-6B Molecular Markers

[0081] 1. Develop InDel markers targeting the InDel2 site.

[0082] An InDel marker was developed targeting the InDel2 site (TGCATGTTGCCAG / T, located 1726 bp upstream of the start codon) in the upstream region of the TaRVE1-6B gene. This InDel marker is denoted as RVE1-6B-527566461, and its specific primer is denoted as RVE1-6B-527566461-F1 / R1. The nucleotide sequence of the specific primer RVE1-6B-527566461-F1 / R1 is as follows:

[0083] RVE1-6B-527566461-F1:

[0084] TCTCCTAATCTCCCACCGGT (SEQ ID NO: 19);

[0085] RVE1-6B-527566461-R1:

[0086] TGGCTCCCGTACACTCGTA (SEQ ID NO: 20).

[0087] 2. Develop InDel markers targeting the InDel5 site.

[0088] An InDel marker was developed targeting the InDel5 site (CCCACGGCGGGCGGCATCAGCG / C, located 422 bp upstream of the start codon) in the upstream region of the TaRVE1-6B gene. This InDel marker is denoted as RVE1-6B-527565157, and its specific primer is denoted as RVE1-6B-527565157-F1 / R1. The nucleotide sequence of the specific primer RVE1-6B-527565157-F1 / R1 is as follows:

[0089] RVE1-6B-527565157-F1:

[0090] CGGGATTTTTCCATTTCCGCG (SEQ ID NO: 21);

[0091] RVE1-6B-527565157-R1:

[0092] TGAGCAGCCCTATGGTTAAGG (SEQ ID NO: 22).

[0093] 3. Develop AS-PCR markers targeting the InDel8 site

[0094] An AS-PCR (allele-specific PCR) marker was developed targeting the InDel8 site (CA / CAAA, located 597 bp downstream of the stop codon) in the upstream region of the TaRVE1-6B gene. This AS-PCR marker is denoted as RVE1-6B-527561616, and its specific primers are denoted as RVE1-6B-527561616-F1w / F1m / R1c. RVE1-6B-527561616-F1w specifically recognizes the CA allelic variant, RVE1-6B-527561616-F1m specifically recognizes the CAAA allelic variant, and RVE1-6B-527561616-R1c is a reverse universal primer. The nucleotide sequence of the specific primer RVE1-6B-527561616-F1w / F1m / R1c is as follows:

[0095] RVE1-6B-527561616-F1w:

[0096] CAAGTTTCCAGGCAAAAAAAAAGTG (SEQ ID NO: 23);

[0097] RVE1-6B-527561616-F1m:

[0098] CAAGTTTCCAGGCAAAAAAAAAGAA (SEQ ID NO: 24);

[0099] RVE1-6B-527561616-R1c:

[0100] AGCTGAGAAGATTCGACCGCG (SEQ ID NO: 25).

[0101] 4. Genotyping

[0102] A natural population of 267 common hexaploid wheat accessions was selected (Table 3). The genotypes of the natural population were identified using the molecular markers RVE1-6B-527566461, RVE1-6B-527565157, and RVE1-6B-527561616.

[0103] (1) Genotyping of natural populations using molecular marker RVE1-6B-527566461

[0104] Using the wheat genomic DNA to be tested as a template, PCR amplification of the wheat DNA to be tested was performed using specific primers RVE1-6B-527566461-F1 / R1.

[0105] The PCR amplification system consisted of 10 mL of the following components: 0.4 μL DNA template, 0.4 μL forward primer, 0.4 μL reverse primer, 5.0 μL 2×Phanta mixed buffer, 0.2 μL dNTP mixture (each at a concentration of 2.5 μM), 0.2 mL PhantaMax high-fidelity DNA polymerase, and 3.4 μL ddH2O.

[0106] Amplification was performed using a standard amplification program. The specific PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 40 s, 60℃ annealing for 40 s, 72℃ extension for 40 s, for 34 cycles; 72℃ extension for 10 min, amplification ended, and the sample was stored at 4℃.

[0107] The PCR products were electrophoresed using a 6.0% non-denaturing polyacrylamide gel, and the genotype of the wheat to be tested was determined based on the electrophoresis results. Specifically:

[0108] If the amplified band size of RVE1-6B-527566461 is 274bp, then the genotype at the InDel2 locus is TGCATGTTGCCAG.

[0109] If the amplified band size of RVE1-6B-527566461 is 262bp, then the genotype of the InDel2 locus is T.

[0110] Electrophoretic detection results of wheat RVE1-6B-527566461 marker in a natural population are as follows: Figure 2 As shown.

[0111] (2) Genotyping of natural populations using molecular marker RVE1-6B-527565157

[0112] Using the wheat genomic DNA to be tested as a template, PCR amplification of the wheat DNA to be tested was performed using specific primers RVE1-6B-527565157-F1 / R1.

[0113] The PCR amplification system consisted of 10 mL of the following components: 0.4 μL DNA template, 0.4 μL forward primer, 0.4 μL reverse primer, 5.0 μL 2×Phanta mixed buffer, 0.2 μL dNTP mixture (each at a concentration of 2.5 μM), 0.2 mL PhantaMax high-fidelity DNA polymerase, and 3.4 μL ddH2O.

[0114] Amplification was performed using a standard amplification program. The specific PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 40 s, 60℃ annealing for 40 s, 72℃ extension for 40 s, for 34 cycles; 72℃ extension for 10 min, amplification ended, and the sample was stored at 4℃.

[0115] The PCR products were electrophoresed using a 6.0% non-denaturing polyacrylamide gel, and the genotype of the wheat to be tested was determined based on the electrophoresis results. Specifically:

[0116] If the amplified band size of RVE1-6B-527565157 is 293bp, then the genotype at the InDel5 locus is CCCACGGCGGGCGGCATCAGCG.

[0117] If the amplified band size of RVE1-6B-527565157 is 272bp, then the genotype at the InDel5 locus is C.

[0118] Electrophoretic detection results of wheat RVE1-6B-527565157 marker in a natural population are as follows: Figure 3 As shown.

[0119] (3) Genotyping of natural populations using molecular marker RVE1-6B-527561616

[0120] Using the wheat genomic DNA to be tested as a template, PCR amplification of the wheat DNA to be tested was performed using specific primers RVE1-6B-527561616-F1w / R1c and RVE1-6B-527561616-F1m / R1c.

[0121] The PCR amplification system consisted of 10 mL of the following components: 0.4 μL DNA template, 0.4 μL forward primer, 0.4 μL reverse primer, 5.0 μL 2×Phanta mixed buffer, 0.2 μL dNTP mixture (each at a concentration of 2.5 μM), 0.2 mL PhantaMax high-fidelity DNA polymerase, and 3.4 μL ddH2O.

[0122] Amplification was performed using a standard amplification program. The specific PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 40 s, 62℃ annealing for 40 s, 72℃ extension for 1 min, for 34 cycles; 72℃ extension for 10 min, amplification ended, and the sample was stored at 4℃.

[0123] The PCR products were electrophoresed on a 1.5% agarose gel, and the genotype of the wheat to be tested was determined based on the electrophoresis results. Specifically:

[0124] If the amplified band size of RVE1-6B-527561616-F1w / R1c is 608bp, and there is no amplified band of RVE1-6B-527561616-F1m / R1c, then the genotype at the InDel8 locus is CA.

[0125] If the amplified band size of RVE1-6B-527561616-F1m / R1c is 610bp, and there is no amplified band of RVE1-6B-527561616-F1w / R1c, then the genotype at the InDel8 locus is CAAA.

[0126] Electrophoretic detection results of wheat RVE1-6B-527561616 marker in a natural population are as follows: Figure 4 As shown.

[0127] 5. TaRVE1-6B Haplotype Classification

[0128] Based on the segregation of 58 variant sites in the TaRVE1-6B gene, four haplotypes can be identified using molecular markers for the InDel2 variant site (RVE1-6B-527566461), the InDel5 variant site (RVE1-6B-527565157), and the InDel8 variant site (RVE1-6B-527561616). The haplotype classification criteria are as follows: Figure 1 As shown, specifically:

[0129] (1) When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG, and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl a (hereinafter referred to as Hapl a).

[0130] (2) When the genotype at InDel2 is T, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl b (hereinafter referred to as Hapl b).

[0131] (3) When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is C and the genotype at InDel8 is CA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl c (hereinafter referred to as Hapl c).

[0132] (4) When the genotype at InDel2 is TGCATGTTGCCAG, the genotype at InDel5 is CCCACGGCGGGCGGCATCAGCG, and the genotype at InDel8 is CAAA, the haplotype of the TaRVE1-6B gene is TaRVE1-6B-Hapl d (hereinafter referred to as Hapl d).

[0133] according to Figure 1 The haplotype classification shown is combined with the genotype detection results of the SNP2, SNP5, and SNP8 molecular markers of the natural population materials to classify the haplotypes of the above natural population materials. The classification results are shown in Tables 3-1, 3-2, 3-3, 3-4, 3-5, 3-6, and 3-7.

[0134] Table 3-1 Haplotype typing results of TaRVE1-6B in natural populations (I)

[0135]

[0136] Table 3-2 Haplotype typing results of TaRVE1-6B in natural populations (II)

[0137]

[0138] Table 3-3 Haplotype typing results of TaRVE1-6B in natural populations (Part III)

[0139]

[0140] Table 3-4 Haplotype typing results of TaRVE1-6B in natural populations (IV)

[0141]

[0142] Table 3-5 Haplotype typing results of TaRVE1-6B in natural populations (V)

[0143]

[0144] Table 3-6 Haplotype typing results of TaRVE1-6B in natural populations (VI)

[0145]

[0146] Table 3-7 Haplotype typing results of TaRVE1-6B in natural populations (VII)

[0147]

[0148] III. Association Analysis between TaRVE1-6B Haplotype and Yield Traits

[0149] Phenotypic data of four haplotypes of the TaRVE1-6B gene and natural populations under four environmental conditions (E1: Pulau Valley, Laishan County, Yantai, Shandong Province, 2019; E2: Shijiazhuang, Hebei Province, 2020; E3: Muyu Village, Laishan County, Yantai, Shandong Province, 2022; E4: Pulau Valley, Laishan County, Yantai, Shandong Province, 2022) were analyzed using the general linear model of the GAPIT package in R. The best linear unbiased estimate (BLUE) of each trait under the four environmental conditions was calculated using the lme4 package in R.

[0150] The association analysis results of wheat TaRVE1-6B gene haplotypes with yield traits (plant height, spike length, and thousand-grain weight) are shown in Tables 4, 5, and 6.

[0151] Table 4. Results of association analysis between wheat TaRVE1-6B genotypes and plant height

[0152]

[0153] Note: Different lowercase letters indicate that the difference is statistically significant (P < 0.05).

[0154] Table 5. Results of association analysis between wheat TaRVE1-6B genotypes and spike length

[0155]

[0156] Note: Different lowercase letters indicate that the difference is statistically significant (P < 0.05).

[0157] Table 6. Results of association analysis between wheat TaRVE1-6B genotypes and thousand-grain weight

[0158]

[0159] Note: Different lowercase letters indicate that the difference is statistically significant (P < 0.05).

[0160] From Tables 4, 5, and 6, we can see that:

[0161] (1) In the plant height phenotype, compared with the Hapl d haplotype, the plant height of the Hapl a, Hapl b and Hapl c haplotypes increased significantly by 14.95%, 11.55% and 12.64%, respectively;

[0162] (2) In the thousand-grain weight phenotype, compared with the Hapl d haplotype, the thousand-grain weight of the Hapl a, Hapl b and Hapl c haplotypes was significantly reduced by 4.80%, 9.43% and 6.23%, respectively;

[0163] (3) In the spike length phenotype, the spike length of haplotype Hapl b was significantly increased by 11.53%, 12.00% and 14.78% compared with haplotypes Hapl a, Hapl c and Hapl d, respectively.

[0164] The above results indicate that the TaRVE1-6B-Hapl d haplotype is the superior haplotype in plant height and thousand-grain weight phenotypes, and the TaRVE1-6B-Hapl b haplotype is the superior haplotype in panicle length phenotype.

[0165] In summary, the molecular markers RVE1-6B-527566461, RVE1-6B-527565157, and RVE1-6B-527561616 of the wheat TaRVE1-6B gene have important application value in screening wheat plant height, spike length, and thousand-grain weight and yield traits.

[0166] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. The application of primers with nucleotide sequences as shown in SEQ ID NO: 19 to SEQ ID NO: 25 in the selection of wheat plant height, spike length, and thousand-grain weight yield traits, characterized in that: Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the two primers shown in SEQ ID NO: 19 and SEQ ID NO:

20. When the product size was 274 bp, the genotype of the InDel2 site was TGCATGTTGCCAG, and when the product size was 262 bp, the genotype of the InDel2 site was T. Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the two primers shown in SEQ ID NO: 21 and SEQ ID NO:

22. When the product size was 293 bp, the genotype at the InDel5 site was CCCACGGCGGGCGGCATCAGCG, and when the product size was 272 bp, the genotype at the InDel5 site was C. Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the two forward primers shown in SEQ ID NO: 23 and SEQ ID NO: 24 and the reverse primer shown in SEQ ID NO:

25. When the product size obtained by the two primers shown in SEQ ID NO: 23 and SEQ ID NO: 25 is 608 bp and no product is amplified by the two primers shown in SEQ ID NO: 24 and SEQ ID NO: 25, the genotype at the InDel8 locus is CA. When the product size obtained by the two primers shown in SEQ ID NO: 24 and SEQ ID NO: 25 is 610 bp and no product is amplified by the two primers shown in SEQ ID NO: 23 and SEQ ID NO: 25, the genotype at the InDel8 locus is CAAA. The physical locations of InDel2, InDel5, and InDel8 in IWGSC RefSeqv2.1 are 527566461, 527565157, and 527561616, respectively. When the genotypes at InDel2, InDel5, and InDel8 are TGCATGTTGCCAG, CCCACGGCGGGCGGCATCAGCG, and CA, respectively, the haplotype of the wheat TaRVE1-6B gene is TaRVE1-6B-Hapl a. When the genotypes at InDel2, InDel5, and InDel8 are T, CCCACGGCGGGCGGCATCAGCG, and CA, respectively, the haplotype of the wheat TaRVE1-6B gene is TaRVE1-6B-Hapl b. When the genotypes at the InDel2, InDel5, and InDel8 sites are TGCATGTTGCCAG, C, and CA, respectively, the haplotype of the wheat TaRVE1-6B gene is TaRVE1-6B-Hapl c. When the genotypes at the InDel2, InDel5, and InDel8 sites are TGCATGTTGCCAG, CCCACGGCGGGCGGCATCAGCG, and CAAA, respectively, the haplotype of the wheat TaRVE1-6B gene is TaRVE1-6B-Hapl d. The TaRVE1-6B-Hapl d haplotype has a shorter plant height and a heavier thousand-grain weight compared to the TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl b and TaRVE1-6B-Hapl c haplotypes. Haplotype TaRVE1-6B-Hapl b has a longer spike length compared to haplotypes TaRVE1-6B-Hapl a, TaRVE1-6B-Hapl c, and TaRVE1-6B-Hapl d.

Images