Application of RNA binding protein FXR1 as a target in preparation of products for preventing and treating metabolic related fatty liver disease and improving glucose and lipid metabolism disorder

Abstract

The application discloses application of RNA binding protein FXR1 as a target in preparation of products for preventing and treating metabolic related fatty liver disease and improving glycolipid metabolism disorder, and relates to the technical field of biological medicine.The application firstly discloses that RNA binding protein FXR1 is a key pathogenic factor of liver fatty degeneration and metabolic disorder by constructing liver specific knockout mice (HKO) and a high-fat high-sugar diet induced model, and finds that the absence of RNA binding protein FXR1 can significantly improve liver lipid deposition, reduce liver injury and fibrosis, and improve systemic glucose intolerance and insulin resistance, and inhibition of RNA binding protein FXR1 can be used as a new strategy for treating liver glycolipid metabolism and metabolic related fatty liver disease.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of RNA-binding protein FXR1 as a target in the preparation of products for the prevention and treatment of metabolic-related fatty liver disease and the improvement of glucose and lipid metabolism disorders. Background Technology

[0002] The liver is the center of biochemical reactions in the body, playing a vital role in maintaining the balance between glucose and lipid synthesis and breakdown. When these metabolic processes are abnormal, it can lead to various health problems, such as obesity, cardiovascular disease, and metabolic dysfunction-associated fatty liver disease (MAFLD / MASLD / formerly NAFLD). MAFLD encompasses a range of disease progressions, including metabolic dysfunction-associated fatty liver, metabolic dysfunction-associated steatohepatitis and its associated liver fibrosis (MASH / formerly NASH), cirrhosis, and hepatocellular carcinoma.

[0003] The pathogenesis of MAFLD is complex. Lipid deposition in the liver due to metabolic imbalance, leading to hepatocyte steatosis, is the initiating process of MAFLD, which then promotes disease progression. Enzymes and transcription factors control hepatic metabolic pathways, while RNA-binding proteins (RBPs) are important components of gene expression regulation in the liver under physiological and pathological conditions. RNA-binding proteins are a class of powerful and widely used regulatory factors that bind to RNA in a sequence- or structure-specific manner, participating in multiple post-transcriptional regulatory processes such as RNA synthesis, alternative splicing, modification, transport, translation, and intracellular localization.

[0004] The FXR1 gene (gene name: FXR1) encodes the protein FXR1, an RNA-binding protein with multiple RNA recognition motifs, including a KH domain and an RGG box. The FXR1 gene undergoes alternative splicing to produce multiple isoforms and exhibits tissue specificity. FXR1 is expressed in various tissues and cell lines, and as a broad and multifunctional regulator, it influences the stability and abundance of the bound RNA, regulates gene expression at the posttranscriptional level, and participates in various biological processes. However, the specific functions of FXR1 in hepatic glucose and lipid metabolism and its potential as a therapeutic target have not yet been elucidated. Summary of the Invention

[0005] (a) Technical problems to be solved Therefore, one of the main objectives of this invention is to provide the application of RNA-binding protein FXR1 (FXR1) as a target in the preparation of products for the prevention and treatment of metabolic-related fatty liver disease and the improvement of glucose and lipid metabolism disorders. This invention, through the construction of liver-specific knockout mice (HKO) and a high-fat, high-sugar diet-induced model, reveals for the first time that RNA-binding protein FXR1 is a key pathogenic factor of hepatic steatosis and metabolic disorders. It also finds that the absence of RNA-binding protein FXR1 can significantly improve hepatic lipid deposition, reduce liver damage and fibrosis, and improve systemic glucose tolerance and insulin resistance. Inhibiting RNA-binding protein FXR1 can serve as a novel strategy for the treatment of hepatic glucose and lipid metabolism and metabolic-related fatty liver disease.

[0006] (II) Technical Solution To achieve the above objectives, the present invention provides the use of reagents for detecting the expression levels of the RNA-binding protein FXR1 and / or the FXR1 gene in the preparation of any of the following: (A1) Products for evaluating or assisting in the evaluation of the degree of lipid deposition in the liver; (A2) Products for evaluating or assisting in the evaluation of the degree of steatosis in the liver; (A3) Products for monitoring or assessing the progression of metabolic-related fatty liver disease; (A4) Products for predicting the sensitivity of liver cells to insulin; (A5) Products for assessing the condition of the liver for inflammation, damage, and / or fibrosis; (A6) Products for evaluating the homeostasis of glucose and lipid metabolism in the body; (A7) Products that aid in assessing the risk of metabolic syndrome; (A8) Prepare products for evaluating or assisting in the evaluation of the degree of lipid deposition in liver cells; (A9) Prepare products for evaluating or assisting in the evaluation of the degree of hepatic steatosis; (A10) Prepare products for monitoring or evaluating the NAFLD / MASLD process; (A11) Prepare a product for predicting insulin sensitivity in liver cells; (A12) Prepare products for assessing liver inflammation, damage and / or fibrosis; (A13) Prepare products for evaluating the homeostasis of glucose and lipid metabolism in the body; (A14) Prepare products for the auxiliary assessment of the risk of metabolic syndrome.

[0007] This invention relates only to detection for non-diagnostic purposes.

[0008] In one embodiment, the product includes a testing reagent.

[0009] In one embodiment, the product includes a test kit.

[0010] In another aspect, the present invention also provides the use of the RNA-binding protein FXR1 and / or the FXR1 gene as biomarkers in any of the following: (A1) To evaluate or assist in the evaluation of the degree of lipid deposition in the liver; (A2) To evaluate or assist in the evaluation of the degree of steatosis in the liver; (A3) Monitor or assess the progression of metabolic-related fatty liver disease; (A4) Predicting the sensitivity of liver cells to insulin; (A5) Assess the condition of liver inflammation, damage, and / or fibrosis; (A6) Evaluate the body's glucose and lipid metabolism homeostasis; (A7) To aid in the assessment of the risk of metabolic syndrome.

[0011] In another aspect, the present invention also provides an inhibitor of the FXR1 protein or its encoded nucleic acid molecule for the preparation of a medicament for any of the following applications: (B1) Prevention, improvement and / or treatment of metabolic-associated fatty liver disease (MAFLD); (B2) Reduces lipid deposition in the liver and lowers the levels of triglycerides (TG) and / or total cholesterol (TC) in the liver; (B3) Improves systemic glucose tolerance and / or insulin tolerance; (B4) Reduces liver inflammation and lowers serum transaminase (ALT / AST) levels; (B5) Inhibits the process of liver fibrosis; (B6) Regulates the expression or stability of genes related to glucose and lipid metabolism; (B7) Resist obesity induced by a high-fat, high-sugar diet; (B8) Protects hepatocytes from lipotoxic damage.

[0012] In one embodiment, the inhibitor includes antibodies, siRNA, shRNA, miRNA, gRNA, sgRNA, antagonists, blockers, and / or antisense oligonucleotides.

[0013] In one embodiment, the inhibitor comprises gRNA.

[0014] In one embodiment, the target sequences of the gRNA include CCTTCTAGGATAGATAGGAAGGCTTGTCCTAATAACTCAGGCTGCACTAAACTG and GCAAACCTGGGCTGATAGTAGAGTAACATGACACCATTCAGTACAGCACT.

[0015] In another aspect, the present invention provides a pharmaceutical composition comprising: (1) A therapeutically effective amount of an inhibitor of FXR1 protein or its encoded nucleic acid molecule; (2) Pharmaceutically or immunologically acceptable carriers or excipients.

[0016] In another aspect, the present invention provides a pharmaceutical preparation comprising the above-described pharmaceutical composition.

[0017] In another aspect, the present invention also provides a pharmaceutical product comprising the above-described pharmaceutical preparation.

[0018] In one embodiment, the pharmaceutical product is a vial or box.

[0019] In another aspect, the present invention also provides the above-described pharmaceutical compositions, pharmaceutical formulations, and / or pharmaceutical products for use in the preparation of any of the following applications: (B1) Prevention, improvement and / or treatment of metabolic-associated fatty liver disease (MAFLD); (B2) Reduces lipid deposition in the liver and lowers the levels of triglycerides (TG) and / or total cholesterol (TC) in the liver; (B3) Improves systemic glucose tolerance and / or insulin tolerance; (B4) Reduces liver inflammation and lowers serum transaminase (ALT / AST) levels; (B5) Inhibits the process of liver fibrosis; (B6) Regulates the expression or stability of genes related to glucose and lipid metabolism; (B7) Resist obesity induced by a high-fat, high-sugar diet; (B8) Protects hepatocytes from lipotoxic damage.

[0020] (III) Beneficial Effects This invention provides the application of the RNA-binding protein FXR1 as a target in the preparation of products for the prevention and treatment of metabolic-related fatty liver disease and the improvement of glucose and lipid metabolism disorders. Compared with the prior art, it has the following beneficial effects: 1. The expression differences were clarified: Under the induction of a high-fat and high-sugar diet, the protein expression of RNA-binding protein FXR1 in mouse liver was significantly increased, suggesting that it is positively correlated with disease progression.

[0021] 2. Confirmed therapeutic potential: Studies using liver-specific knockout mice (HKO) of the FXR1 gene revealed that the deletion of the FXR1 gene significantly resisted diet-induced weight gain, improved liver lipid deposition (liver TG / TC, H&E / Oil Red O staining, serum TG / TC), liver injury and inflammation (ALT / AST), liver fibrosis (Sirius red staining), and glucose tolerance and systemic insulin resistance (GTT / ITT / fasting insulin).

[0022] 3. The molecular mechanism was elucidated: RT-qPCR experiments confirmed that the FXR1 gene may affect the liver glucose and lipid metabolism network by binding to and regulating the RNA levels of metabolism-related genes. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a graph analyzing the changes in FXR1 in the liver of mice under metabolic stress. Figure 2 This is a diagram showing the verification results of FXR1 knockout in mouse livers; Figure 3 This is a graph showing the results of glucose metabolism tests in each group of mice; Figure 4 This is a graph showing the effect of FXR1 on body weight and liver-to-body ratio; Figure 5 This is a graph showing the effects of FXR1 on serum biochemical indicators and liver lipid content; Figure 6 The images show the results of H&E staining, Oil Red O staining, and Sirius Red staining of liver tissue from each group of mice. Figure 7 This is an RT-qPCR validation diagram of genes related to liver lipid metabolism in mice from each group. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Terms and Definitions As used in this article, the terms "FXR1" and "FXR1 protein" are used interchangeably and refer to the RNA-binding protein FXR1.

[0027] As used herein, the terms “FXR1 gene,” “FXR1 encoding gene,” “FXR1 protein encoding gene,” or “nucleic acid molecule encoding FXR1 protein” are used interchangeably and all refer to a nucleotide sequence encoding the FXR1 protein disclosed in this invention.

[0028] As used herein, the terms "inhibitor" or "inhibitor of FXR1 protein or its encoding nucleic acid molecule" are used interchangeably and refer to a substance that can reduce the level or activity of FXR1 protein or its encoding nucleic acid molecule. Inhibitors that can be used in this disclosure include, but are not limited to, antibodies against FXR1 protein or nucleic acid molecules encoding the protein, siRNA, miRNA, antisense oligonucleotides, antagonists, and blocking agents.

[0029] The inhibitor disclosed in this invention can inhibit the FXR1 protein, thereby enabling its further use in the prevention or treatment of diseases and / or related symptoms associated with metabolic-associated fatty liver disease.

[0030] As used herein, the term "pharmaceutical composition" refers to a composition comprising an inhibitor of the FXR1 protein or its encoding nucleic acid molecule formulated with one or more pharmaceutically acceptable carriers.

[0031] The formulation of the pharmaceutical composition can be tailored to the application. In particular, pharmaceutical compositions can be formulated using methods known in the art to provide rapid, continuous, or delayed release of the active ingredient upon administration to mammals. For example, the formulation can be selected from any of the following: plasters, granules, lotions, liniments, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, tablets, suppositories, injections, alcoholic preparations, capsules, creams, lozenges, tinctures, pastes, pills, and soft or hard gelatin capsules.

[0032] As used herein, the term "pharmaceuticalally acceptable" refers to a substance that is suitable for use in humans and / or animals without excessive adverse effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio.

[0033] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a carrier used for the administration of therapeutic agents, encompassing a variety of excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity upon administration. Suitable carriers are well known to those skilled in the art, and a thorough discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0034] Pharmaceutically acceptable carriers in a composition include any and all solvents, dispersion media, preservatives, antioxidants, coatings, isotonic and absorption-delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, flow aids, pH adjusters, buffers, enhancers, wetting agents, solubilizers, surfactants, antioxidants, etc., compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide complementary, additional, or enhanced therapeutic functions. Solid carriers or excipients, such as lactose, starch, or talc, or liquid carriers, such as water, fatty oils, or liquid paraffin, are possible. Other examples of carriers include culture media, such as DMEM or RPMI; and cryogenic storage media containing components that scavenge free radicals, provide pH buffering, osmotic / osmotic support, energy substrates, and ion concentrations to balance intracellular states at low temperatures; and mixtures of organic solvents with water.

[0035] The active substance in the product disclosed in this invention accounts for 0.001-99.9 wt% of the total weight of the composition, with the remainder being pharmaceutically acceptable carriers and other additives.

[0036] The pharmaceutical compositions of the present invention can be administered using any known method. One of a variety of methods known to those skilled in the art can be used to administer the substance, compound, or agent to a subject using the terms "give" or "apply".

[0037] For example, compounds or agents can be administered intranasally (e.g., by inhalation), intrathecally (into the spinal canal or subarachnoid space), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, ocularly, sublingually, orally (by ingestion), intracerebrally, and transdermally (by absorption, e.g., through a skin catheter). Compounds or agents can also be suitably introduced via rechargeable or biodegradable polymeric devices or other devices (e.g., patches and pumps or formulations) that provide prolonged, slowed, or controlled release of the compound or agent. Administration can also be performed, for example, once, multiple times, and / or over one or more prolonged periods.

[0038] As used herein, the term “therapeutic effective dose” refers to a dose sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment, and the effective dose level includes subject type and severity, age, sex, drug activity, drug sensitivity, time of administration, route of administration and excretion rate, duration of treatment, factors including concomitant drugs, and other factors known in the medical field.

[0039] As used herein, the term “treatment” for a symptom or patient refers to steps taken to achieve a beneficial or desired outcome, including clinical outcomes. Beneficial or desired clinical outcomes include, but are not limited to, eliminating, substantially inhibiting, slowing, or reversing the progression of a disease, symptom, or condition; substantially improving or alleviating the clinical or aesthetic symptoms of a symptom; substantially preventing the clinical or aesthetic symptoms of a disease, symptom, or condition; and avoiding harmful or unpleasant symptoms. Treatment also refers to achieving one or more of the following: (a) reducing the severity of the symptom; (b) limiting the development of characteristic symptoms of the symptom being treated; (c) limiting the exacerbation of characteristic symptoms of the symptom being treated; (d) limiting the recurrence of the symptom in patients who previously had the symptom; and / or (e) limiting the recurrence of symptoms in patients who previously did not have symptoms of the symptom.

[0040] As used in this article, the term "prevention" refers to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptoms.

[0041] As used herein, the terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of a biomarker in a biological sample. “Expression” generally refers to the process of converting information (e.g., gene-encoded and / or epigenetic information) into structures that are present and function in the cell. Therefore, as used herein, “expression” can refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and / or polypeptide modification (e.g., post-translational modification of a polypeptide). Fragments of transcribed polynucleotides, translated polypeptides, or polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of a polypeptide) should also be considered expressed, regardless of whether they originate from transcripts generated by alternative splicing or degradation, or from post-translational processing of polypeptides (e.g., by proteolysis). “Expressed genes” include those transcribed into polynucleotides such as mRNA and then translated into polypeptides, as well as those transcribed into RNA but not translated into polypeptides (e.g., transfer RNA and ribosomal RNA). The “amount” or “level” of a biomarker (e.g., expression level) can be measured by methods known to those skilled in the art and disclosed herein. The “amount” or “level” of a biomarker that is associated with improved clinical benefit for an individual can, for example, be at a detectable level in a biological sample. In some respects, the expression level or amount of a biomarker can be used to identify / characterize cancer patients who may respond to or benefit from a particular therapy.

[0042] As used herein, the terms “increased expression,” “increased expression level,” “increased level,” “elevated expression,” “elevated expression level,” or “elevated level” refer to an increase in the expression or level of a biomarker in an individual relative to one or more individuals or internal controls such as those without a disease or condition (e.g., cancer) or a housekeeping biomarker.

[0043] As used herein, the terms “reduced expression,” “reduced expression level,” “reduced level,” “decreased expression,” “reduced expression level,” or “decreased level” refer to a reduced expression or level of a biomarker in an individual relative to one or more individuals or internal controls (e.g., housekeeping biomarkers) that do not have a disease or condition (e.g., cancer). In some respects, reduced expression means little or no expression.

[0044] As used herein, the presence and / or expression level / amount of the biomarkers can be analyzed by a variety of methods, many of which are known in the art and understood by those skilled in the art, including but not limited to immunohistochemistry (“IHC”), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, flow cytometry, fluorescence activated cell sorting (“FACS”), MassARRAY, proteomics, blood-based quantitative assays (e.g., serum ELISA), biochemical enzyme activity assays, in situ hybridization (ISH), fluorescence in situ hybridization (FISH), DNA blot analysis, RNA blot analysis, whole genome sequencing, massively parallel DNA sequencing (e.g., next-generation sequencing), polymerase chain reaction (PCR) (including quantitative real-time PCR (qRT-PCR) and other amplification-type detection methods, such as branched DNA, SISBA, TMA, etc.), RNA-seq, microarray analysis, gene expression profiling and / or serial analysis of gene expression (“SAGE”), and any of a variety of assays that can be performed by protein, gene and / or tissue array analysis. Typical protocols for evaluating the status of genes and gene products can be found, for example, in *Current Protocols in Molecular Biology*, edited by Ausubel et al., 1995, Units 2 (RNA blotting), 4 (DNA blotting), 15 (immunoblotting), and 18 (PCR analysis). Multiplex immunoassays, such as those available from Rules Based Medicine or Meso Scale Discovery (“MSD”), can also be used.

[0045] As used herein, the terms "significantly reduced" or "significantly different" mean that there is a sufficiently high difference between two values ​​(typically one value associated with a molecule and the other with a reference / comparison molecule) such that a person skilled in the art would consider the difference between the two values ​​to be statistically significant in the context of the biological characteristic measured by the value (e.g., the KD value). Depending on the value of the reference / comparison molecule, for example, the difference between the two values ​​is greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, and / or greater than about 50%.

[0046] As used in this article, “containing,” “having,” or “including” includes “containing,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents, methods and equipment used are conventional reagents, methods and equipment in this technical field.

[0048] Example 1: Analysis of FXR1 protein expression levels in an in vivo model: 1. Laboratory animals and their housing environment: Wild-type C57BL / 6J mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (China). All mice were housed in an SPF-grade barrier environment at the Experimental Animal Center of Hefei University of Technology. Householding conditions were: temperature 22–24°C, relative humidity 50% ± 10%, 12-hour light / 12-hour dark cycle, and free access to food and water.

[0049] 2. Animal Model Construction 2.1 Grouping of animals: After the adaptation period, the mice were randomly divided into two groups (n=5 in each group): NCD group: wild-type mice + normal diet and WD group: wild-type mice + high-fat and high-sugar diet.

[0050] Modeling methods and dietary components: • NCD group (normal diet group): fed normal maintenance feed (Jiangsu Xiehe Pharmaceutical Biotechnology Co., Ltd. (China), product number 1010088) and drank ordinary purified water.

[0051] • WD Group (High-Fat, High-Sugar Diet Model Group): Fed a high-fat, high-sugar diet. This diet (Research Diets, D12079B) mimics the MAFLD diet structure, with specific parameters: 40% kcal fat, 43% kcal carbohydrates, 17% kcal protein, and 0.21% cholesterol. The diet was provided with ordinary purified water. The modeling period lasted approximately 16 weeks.

[0052] FXR1 protein expression level analysis: Total protein was extracted from the liver using lysis buffer, and the concentration was determined by the BCA method and adjusted before being mixed with loading buffer and boiled for denaturation. SDS-PAGE gel electrophoresis was then performed: equal volumes of protein sample and protein marker were added to the gel wells, and electrophoresis was performed at constant voltage in Tris-glycine-SDS buffer. After electrophoresis, the gel was transferred to an NC membrane using a wet transfer method and incubated at 100V on ice for 1 hour. Afterward, the membrane was blocked with 5% skim milk, incubated overnight at 4°C with a specific primary antibody, washed, and then incubated at room temperature with HRP-labeled secondary antibody. Finally, ECL luminescent reagent was added.

[0053] All data were derived from at least three independent experiments, and results are expressed as mean ± standard deviation (mean ± SD). Two-tailed Student's t-tests were used for comparisons between two groups; one-way ANOVA was used for comparisons among multiple groups, supplemented by Tukey or Dunnett's multiple comparison tests; two-way ANOVA was used for cases involving two variables, combined with Tukey's multiple comparison tests. Statistical analysis was performed using GraphPad Prism 9 software. p < 0.05 ( ) and p<0.01 ( () is considered statistically significant.

[0054] The results are as follows Figure 1 As shown in Figure A, compared with the normal diet group, the gray value of the RNA-binding protein FXR1 in the liver of WD group mice was significantly higher than that in the control group. Furthermore, the intensity and width of the internal control band were similar, indicating that the sample loading amount per well was consistent and the total protein amount was equal, ensuring that the variation in the intensity of the FXR1 band was caused by the treatment. Quantitative statistical analysis showed the following results: Figure 1 As shown in B, the expression level of FXR1 was indeed significantly upregulated, with an expression level approximately 1.4 times that of the normal diet group (n=4, p<0.01), suggesting that the FXR1 protein is closely related to the occurrence and development of MAFLD.

[0055] Example 2: Construction of liver FXR1 knockout mice: 1. Laboratory animals and their housing environment: Liver RNA-binding protein FXR1-specific knockout mice (HKO) were constructed using the Cre-LoxP system.

[0056] 1.1 The FXR1 flox / flox mouse was constructed by Jiangsu Jicui Pharmaceutical Technology Co., Ltd. (China) using the following strategy: 1.1.1 The FXR1 gene has 9 transcripts. Based on the structure of the FXR1 gene, exon 4 to exon 9 of the ENSMUST00000001620.13 transcript is designated as the knockout region. This region contains a 682-base-pair coding sequence; knocking out this region will lead to the disruption of protein function. The target sequences for the gRNA include CCTTCTAGGATAGATAGGAAGGCTTGTCCTAATAACTCAGGCTGCACTAAACTG and GCAAACCTGGGCTGATAGTAGAGTAACATGACACCATTCAGTACAGCACT.

[0057] 1.1.2 The FXR1 gene was modified using CRISPR-Cas9 technology. The CRISPR-Cas9 system and donor sequence were microinjected into the fertilized eggs of C57BL / 6JGpt mice. Positive F0 generation mice were obtained by transplanting the fertilized eggs and verified by PCR and sequencing.

[0058] 1.1.3. A stable F1 generation mouse model was obtained by mating positive F0 generation mice with C57BL / 6J mice.

[0059] 1.2 The transgenic mouse strain expressing liver-specific Cre recombinase (C57BL / 6J, ALB-Cre) was purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. (China). This Cre strain was maintained and used in a heterozygous (Alb-Cre / +) state. Alb-Cre mice were mated with FXR1-flox / flox mice to obtain Alb-Cre;FXR1-flox / + heterozygous mice, which were then backcrossed with FXR1-flox / flox mice. After genotyping, the desired Alb-Cre;FXR1-flox / flox (hereinafter referred to as "HKO") mice and their littermate controls, Alb-Cre-;FXR1-flox / flox (hereinafter referred to as "FLOX") mice, were finally obtained. All experimental mice were housed in SPF-grade animal facilities, and the experimental protocol was approved by the institution's animal ethics committee.

[0060] All mice were housed in an SPF-grade barrier environment at the Experimental Animal Center of Hefei University of Technology. The housing conditions were: temperature 22–24°C, relative humidity 50% ± 10%, and a 12-hour light / 12-hour dark cycle. Mice were allowed one week of acclimatization, during which they had free access to standard food and water.

[0061] 2. Knockout verification: Liver-specific knockout mice (HKO) were validated using RT-qPCR to confirm whether the knockout of FXR1 in the liver was successful.

[0062] RT-qPCR procedure steps: Total RNA was extracted from the liver using TRIzol reagent. After measuring the concentration, the RNA was converted into cDNA for subsequent qPCR using reverse transcriptase. The qPCR reaction system was then prepared: cDNA template, specific primers, qPCR Master Mix (containing DNA polymerase, dNTPs, fluorescent dye or probe), and enzyme-free water were mixed on ice under sterile conditions. For each experiment, β-actin was used as an internal control for RNA analysis, and the relative expression level of RNA was calculated using the ΔΔCt method.

[0063] The results are as follows Figure 2 As shown, the mRNA level in the HKO group was successfully suppressed, and its expression level was approximately 7% of that in the FLOX group (n=5, p<0.0001).

[0064] 3. Animal model construction: 3.1 Grouping of animals: After the adaptation period, the mice were randomly divided into 4 groups (n=7 per group) according to genotype and diet: (1) FLOX-NCD group: control mice + normal diet; (2) FLOX-WD group: control mice + high-fat, high-sugar diet; (3) HKO-NCD group: knockout mice + normal diet; (4) HKO-WD group: knockout mice + high-fat and high-sugar diet.

[0065] 3.2 Modeling Methods and Dietary Components: • NCD group (normal diet group): fed maintenance feed (Jiangsu Xiehe Pharmaceutical Biotechnology Co., Ltd. (China), product number 1010088) and drank ordinary purified water.

[0066] • WD Group (High-Fat, High-Sugar Diet Model Group): Feeded a high-fat, high-sugar diet. The diet (Research Diets, D12079B) formula simulates the human MAFLD diet structure. The specific parameters of the diet are: 40% kcal fat, 43% kcal carbohydrates, 17% kcal protein, and 0.21% cholesterol. They drank ordinary purified water.

[0067] The modeling process lasted approximately 16 weeks. Mouse weight and feed consumption were recorded weekly to monitor growth and energy intake.

[0068] 4. Sample collection: Mice were fasted overnight (12 hours) before the modeling process was completed. On the second day, after weighing, the mice were anesthetized with isoflurane.

[0069] 4.1 Serum preparation: Blood was collected from the eyeballs and allowed to stand at room temperature for 2 hours. Then, the blood was centrifuged at 3000 rpm for 15 minutes at 4°C. The supernatant serum was collected, aliquoted, and stored at -80°C for the detection of biochemical indicators such as ALT and AST.

[0070] 4.2 Tissue Collection: Mice were euthanized by cervical dislocation, and the intact liver was quickly dissected and weighed. The liver index (liver weight / body weight × 100%) was calculated. A portion of the left lobe of the liver was fixed in 4% paraformaldehyde for H&E and Oil Red O staining; the remaining liver tissue was flash-frozen in liquid nitrogen and then stored at -80°C for RNA and protein extraction for subsequent analysis.

[0071] All data were derived from at least three independent experiments, and results are expressed as mean ± standard deviation (mean ± SD). Two-tailed Student's t-tests were used for comparisons between two groups; one-way ANOVA was used for comparisons among multiple groups, supplemented by Tukey or Dunnett's multiple comparison tests; two-way ANOVA was used for cases involving two variables, combined with Tukey's multiple comparison tests. Statistical analysis was performed using GraphPad Prism 9 software. p < 0.05 ( ) and p<0.01 ( () is considered statistically significant.

[0072] Example 3: Effects of FXR1 deficiency on diet-induced glucose tolerance and insulin resistance: 1. Glucose metabolism capacity test: At about 10-11 weeks after modeling, mice were subjected to glucose tolerance test (GTT) and insulin tolerance test (ITT), and fasting blood glucose was measured to evaluate the effects of glucose clearance capacity and insulin-mediated glucose utilization efficiency on the four groups of mice.

[0073] 2. Procedure for the Glucose Tolerance Test (GTT): Before the experiment, a 20% glucose solution with a mass-volume concentration (CLC50) needs to be prepared using physiological saline. Mice should be fasted overnight but allowed normal water intake. On the day of the experiment, mice are weighed and marked, and the required volume of the 20% glucose solution is calculated based on a dosage of 2 g / kg body weight. Blood is collected from the tail tip; the first drop is discarded, and the second drop is used for measurement. First, the fasting basal blood glucose level at 0 minutes is measured. Subsequently, the corresponding volume of glucose solution is administered via intraperitoneal injection. Timing begins when the first mouse is injected, and tail tip blood glucose is measured at 15, 30, 60, 90, and 120 minutes after administration. After the experiment, mice are immediately given food and water.

[0074] 3. Insulin Tolerance Test (ITT) Procedure: Before the experiment, the insulin stock solution was diluted with physiological saline to a working solution of 0.075 U / mL and stored on ice. Mice were fasted for 6-8 hours, but allowed normal water intake during this period. On the day of the experiment, mice were weighed and marked, and the required volume was calculated based on the commonly used dose of 0.75 U / kg body weight. Fasting basal blood glucose was measured at 0 minutes. Insulin was administered via intraperitoneal injection. Timing began after the first mouse was injected, and blood glucose was measured at 15, 30, 60, 90, and 120 minutes. The insulin solution was kept at a low temperature throughout the experiment. After the experiment, mice were immediately given food and water.

[0075] 4. Fasting insulin test: Before the experiment, equilibrate all reagent components and serum samples to room temperature. Prepare washing buffer and serially dilute the lyophilized standards with diluent to prepare a series of concentration gradient standards for establishing a standard curve (for specific detection methods, refer to the instruction manual for the Ruixin Biotech Mouse Insulin (INS) Kit (ELISA), catalog number: RX202485M). When adding samples, prepare blank wells, standard wells, and sample wells. Add the corresponding standard or sample to each well, except for the blank wells. Seal the plate with sealing film and incubate at 37°C. After incubation, remove the sealing film, discard the liquid in the wells, add washing buffer to each well, allow to stand, and pat dry. Repeat washing 3-5 times. After washing, add enzyme-labeled conjugate to each well, seal the plate again, and incubate at 37°C. Repeat the washing steps 3-5 times after incubation. Then add chromogenic substrate to each well and incubate at 37°C in the dark. After color development, add stop solution to each well. Finally, the wavelength was set on the microplate reader and the optical density (OD) value of each well was measured. A standard curve was plotted based on the concentration of the standard and its corresponding OD value, and the concentration of insulin in the sample was calculated using a regression equation.

[0076] The results are as follows Figure 3 As shown: After intraperitoneal injection of glucose, severe glucose tolerance impairment occurred, and the GTT curve remained at the highest level throughout the entire process. Figure 3A and B in the text); after insulin injection, the blood sugar level drops slowly ( Figure 3 (C and D in the text) confirm that a high-fat, high-sugar diet successfully induced significant systemic insulin resistance.

[0077] Following intraperitoneal injection of glucose, the glucose tolerance impairment in the HKO-WD group was significantly less than that in the FLOX-WD group, and its GTT curve was significantly lower at all time points than that of the FLOX-WD group (n=5, p<0.05). The area under the curve (GTT-AUC) in the HKO-WD group was significantly reduced. Figure 3 The result (B,n=5, p<0.0001) indicates that the body's ability to regulate glucose was enhanced at this time.

[0078] Consistent with the glucose tolerance test results, after intraperitoneal injection of insulin, mice in the HKO-WD group showed superior insulin sensitivity compared to the FLOX-WD group, with significantly smaller decreases in ITT curve and area under the curve (AUC) at all time points compared to the FLOX-NCD group. Figure 3 The results (C and D in the table, n=5, p<0.05) indicate that insulin resistance in peripheral tissues such as muscle and fat was improved at this time. At the same time, the area under the ITT curve (AUC) of the HKO-WD group was not statistically different from that of the FLOX-NCD group, indicating that liver FXR1 knockout can reverse peripheral insulin resistance induced by high-fat and high-sugar diet to normal levels.

[0079] Furthermore, there were no statistically significant differences in these indicators between FLOX-NCD and HKO-NCD. Figure 3 The results (AG) confirmed that the loss of liver FXR1 protein under basal metabolic conditions does not affect glucose homeostasis or insulin sensitivity, proving that knocking out liver FXR1 does not affect normal physiological state.

[0080] Furthermore, compared to the FLOX-NCD group, the FLOX-WD group mice showed a significantly higher fasting blood glucose level ( Figure 3 The E (n=5, p=0.0157) indicates the presence of significant hyperglycemia. Compared with the metabolically disordered FLOX-WD group, the fasting blood glucose of mice in the HKO-WD group was significantly reduced (n=5, p=0.0246). Notably, there was no statistically significant difference in fasting blood glucose between the HKO-WD group and the FLOX-NCD group, indicating that FXR1 knockout can eliminate WD diet-induced basal hyperglycemia and even restore it to healthy control levels.

[0081] The fasting insulin test results showed ( Figure 3In the F group, the values ​​of fasting insulin in the FLOX-WD group were significantly higher than those in the FLOX-NCD group (n=5, p<0.0001), indicating significant hyperinsulinemia and insulin resistance. In contrast, the fasting insulin level in the HKO-WD group was decreased (n=5, p=0.0017).

[0082] Simultaneously, the Homeostasis Model of Insulin Resistance (HOMA-IR) index is calculated based on fasting blood glucose and fasting insulin levels. This is a classic indicator widely used in clinical practice to assess insulin resistance. This value reflects hepatic insulin sensitivity and complements the GTT / ITT ratio: the HOMA-IR reflects insulin resistance, the ITT reflects peripheral insulin resistance, and the GTT assesses overall glucose metabolism.

[0083] The results show that ( Figure 3 In the HKO-WD group, compared to the FLOX-WD group, the HOMA-IR was significantly lower (n=5, p=0.0006), directly demonstrating improved hepatic insulin resistance. In conclusion, FXR1 knockout improves glucose metabolism disorders and enhances insulin sensitivity.

[0084] Example 4: FXR1 deficiency improves diet-induced fat deposition, liver damage, and liver fibrosis: 1. Body weight to liver-to-body weight ratio: After 16 weeks of feeding, under normal dietary conditions, FXR1 knockout in the liver did not cause abnormal changes in body weight, food intake, or liver weight ratio under normal physiological conditions, indicating that FXR1 protein is not essential for basal metabolism. Figure 4 (A, B, C in the original text). Figure 4 As shown in A, the weight gain of mice in the HKO-WD group at 16 weeks was significantly lower than that in the FLOX-WD group (n=5, p<0.0001), indicating a significantly superior metabolic phenotype compared to the FLOX-WD group; however, there was no statistically significant difference in average daily food intake between the two groups. Figure 4 (as in B), therefore, the difference in weight gain may not stem from changes in food intake, but rather from differences in energy metabolism; from Figure 4 According to the C-value, the liver wet weight / body weight ratio of the HKO-WD group mice was significantly lower than that of the FLOX model group (n=5, p<0.0001), indicating that the loss of FXR1 protein can effectively alleviate the pathological enlargement of the liver caused by a high-fat and high-sugar diet.

[0085] 2. Serum and Liver Biochemistry: Liver transaminases ALT and AST are the most routine serum biochemical markers for assessing liver damage and inflammation. Serum triglycerides (TG) and total cholesterol (TC) reflect the state of systemic lipid metabolism; while the liver TG / TC ratio reflects lipid deposition in hepatocytes.

[0086] The FLOX-WD group showed significantly worse results than the FLOX-NCD group in serum (ALT, AST, TG, TC) and liver (TG, TC) levels, comprehensively confirming that a 16-week high-fat, high-sugar diet successfully induced hepatic steatosis and liver injury (n=5, p<0.0001). Serum ALT and AST levels revealed significantly reduced liver injury in the HKO-WD group (n=5, p<0.0001). Figure 5 (A and B in the text); serum TC and TG levels, these lipid indicators, were all significantly reduced (n=5, p<0.0001) Figure 5 (C and D in the text).

[0087] In addition to serum lipid analysis, we also focused on detecting TG and TC levels in liver tissue to investigate the initiation events of abnormal lipid deposition in the liver in MAFLD. The results showed that their levels were also significantly reduced in the HKO-WD group (n=5, p<0.0001), further demonstrating that FXR1 protein deficiency can significantly alleviate lipid accumulation and liver damage induced by a high-fat, high-sugar diet. Figure 5 (E and F in the text).

[0088] 3. Pathological evaluation: 3.1 H&E staining: Procedure: Take out the prepared paraffin sections and dewax them: Xylene I (10 min) → Xylene II (10 min) → Anhydrous ethanol I (5 min) → Anhydrous ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → Tap water (5 min) → Distilled water (5 min). After dewaxing, stain the nuclear cells with hematoxylin for 1 min, then rinse with tap water to turn blue. Stain with eosin for 3 min. After staining, dehydrate and mount the sections: 80% ethanol (5 min) → 90% ethanol (5 min) → 95% ethanol (5 min) → Anhydrous ethanol (5 min) → Anhydrous ethanol (5 min) → Xylene (5 min) → Xylene (5 min) → Neutral resin. After air-drying, photograph the sections using a Zeiss upright microscope and save the images.

[0089] like Figure 6 As shown in Figure A, the FLOX-WD group exhibited typical severe steatosis and inflammatory damage. Microscopically, numerous lipid droplets of varying sizes occupied the hepatocyte cytoplasm, pushing the cell nucleus to one side, resulting in macrovesicular steatosis. In contrast, the HKO-WD group showed significantly reduced pathological structural changes in the liver, with a relatively intact liver structure and fewer lipid droplets.

[0090] 3.2 Oil Red O staining: Procedure: Remove the frozen sections and let them stand at room temperature for 30 minutes, then soak them in PBS for 5 minutes. Stain with Oil Red O for 1 hour. Decolorize with 60% isopropanol, wash the sections three times, and then soak them in distilled water. Stain with hematoxylin for 10 minutes, then rinse with tap water to restore blue color. Mount with glycerol gelatin. After the sections have air-dried, photograph them using a Zeiss upright microscope and save the images.

[0091] like Figure 6 As shown in Figure B, the liver in the FLOX-WD group exhibited dense, orange-red, strong positive staining signals, while the area and intensity of Oil Red O staining in the HKO-WD group were significantly lower than those in the FLOX-WD group. The orange-red lipid droplets were predominantly small to medium-sized and sparsely distributed.

[0092] 3.3 Sirius Red Staining: Procedure: Take paraffin sections of liver tissue, 4–6 μm thick, and mount them on anti-detachment glass slides. First, dewax and hydrate the sections: immerse the sections sequentially in xylene I and II for 10 min each to completely dewax them, then sequentially pass them through anhydrous ethanol, 95% ethanol, 85% ethanol, and 75% ethanol for 2 min each, followed by a gradient immersion in water. Finally, gently wash twice with distilled water for 2 min each time. Next, perform Sirius red staining: immerse the sections in a pre-prepared Sirius red-picric acid staining solution (0.1% Sirius red dissolved in saturated picric acid solution) and stain at room temperature in the dark. After staining, quickly wash 1–2 times with distilled water to gently remove excess stain. Then, dehydrate and clear the sections: quickly pass the sections sequentially through 75% ethanol, 85% ethanol, 95% ethanol, and anhydrous ethanol, holding for about 2–3 seconds, and finally immerse them in xylene I and II for 2–5 min each for clearing. Mount the sections with neutral resin.

[0093] Collagen fibers are bright red to dark red, with a pale yellow background (bitter acid background).

[0094] like Figure 6 As shown in C, the Sirius red staining results show that more bright red collagen fibers were deposited in the liver tissue of the FLOX-WD group, indicating that the liver was fibrotic at this time; while the proportion of bright red collagen fibers in the HKO-WD group was significantly reduced, indicating an improvement in the degree of liver fibrosis.

[0095] Example 5: Molecular mechanism by which FXR1 deficiency improves diet-induced liver metabolic disorders: RT-qPCR analysis of liver RNA revealed downregulation of lipid synthesis genes such as ACACA, FASN, and SREBF in the HKO-WD group (n=5, p<0.05). The mRNA level of SREBF (sterol regulatory element-binding protein) was significantly lower in the HKO-WD group than in the FLOX-WD group, suggesting that upstream signaling in lipid synthesis was inhibited. Figure 7 (A in the middle) The expression of fatty acid oxidation genes, such as CPT1α (carnitine palmitoyltransferase 1α), the rate-limiting enzyme responsible for fatty acid entry into mitochondria, and EHHADH (enoyl-CoA hydratase / 3-hydroxyacyl-CoA dehydrogenase), which is involved in peroxisome β-oxidation, was significantly upregulated (n=5, p<0.0001); upregulated expression of CD36 (fatty acid translocase) suggests that the liver's ability or tendency to take up peripheral fatty acids may be altered (n=5, p<0.05); simultaneously, the expression of UCP2 (uncoupling protein 2), which is associated with thermogenesis and energy expenditure, was also increased (n=5, p<0.0001), which may help improve metabolic efficiency and reduce lipid accumulation. This indicates that under the pressure of a high-fat, high-sugar diet, the loss of FXR1 protein can specifically downregulate the liposynthesis pathway while upregulating the fatty acid oxidation pathway, thereby improving metabolic disorders. Figure 7 (C in the middle).

[0096] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0097] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of an inhibitor of the FXR1 protein or its encoded nucleic acid molecule in the preparation of a drug for the prevention and / or treatment of metabolic-related fatty liver disease and / or the improvement of glucose and lipid metabolism disorders; said inhibitor is gRNA.

2. The application according to claim 1, characterized in that, The target sequence of the gRNA includes: CCTTCTAGGATAGATAGGAAGGCTTGTCCTAATAACTCAGGCTGCACTAAACTG; and GCAAACCTGGGCTGATAGTAGAGTAACATGACACCATTCAGTACAGCACT.

3. Use of the pharmaceutical composition in the preparation of drugs for the prevention and / or treatment of metabolic-related fatty liver disease and / or for improving disorders of glucose and lipid metabolism; The pharmaceutical composition comprises: (1) A therapeutically effective amount of an inhibitor of FXR1 protein or its encoded nucleic acid molecule; said inhibitor is gRNA; (2) A pharmaceutically or immunologically acceptable carrier.

4. The use of pharmaceutical preparations in the preparation of drugs for the prevention and / or treatment of metabolic-related fatty liver disease and / or for improving glucose and lipid metabolism disorders; The pharmaceutical preparation comprises the pharmaceutical composition according to claim 3; The dosage forms of the pharmaceutical preparations include injections, infusions, and / or lyophilized preparations.

5. The application according to claim 4, characterized in that, The dosage form of the pharmaceutical preparation is an injection.

6. Use of the pharmaceutical product in the preparation of drugs for the prevention and / or treatment of metabolic-related fatty liver disease and / or for improving disorders of glucose and lipid metabolism; The pharmaceutical product includes the pharmaceutical formulation as described in claim 4 or 5.

Images