An antigen polypeptide of peanut functional centromere histone cenh3 and application thereof

Abstract

The embodiment of the application discloses an antigen polypeptide of peanut functional centromere histone CENH3 and application thereof, relates to the technical field of cell molecules, and aims to solve the problems existing in the prior art. The antigen polypeptide of peanut functional centromere histone CENH3, the full-length sequence of peanut CENH3 protein is shown as SEQ ID NO. 1; by screening a segment specific to the N terminal and strong in immunogenicity, the antigen polypeptide with the amino acid sequence shown as SEQ ID NO. 2 is obtained.

Description

Technical Field

[0001] This application relates to the field of cell and molecular technology, specifically to an antigenic polypeptide of peanut functional centromere histone CENH3 and its application. Background Technology

[0002] Centromeres are key functional elements of eukaryotic chromosomes, composed of DNA and proteins, and are responsible for the proper segregation of chromosomes and the stable transfer of genetic material during mitosis and meiosis. Although centromere function is highly conserved, significant variations exist in centromere DNA sequences across different species, and these sequences are rich in repetitive sequences, posing challenges to sequence analysis and genome assembly.

[0003] Centromere-specific histone CENH3 is a hallmark protein of functional centromeres, and its specific distribution in the centromere region provides an important target for the identification and study of functional centromeres. By preparing CENH3 protein-specific antibodies and combining them with techniques such as immunofluorescence and chromatin immunoprecipitation sequencing (ChIP-seq), centromere structure, function, and evolution studies can be carried out efficiently.

[0004] As an important oilseed crop, peanut genome research is crucial for variety improvement and genetic breeding. Currently, research on peanut functional centromeres is incomplete, lacking specific antigenic peptides and antibody tools for recognizing peanut centromeres, which limits in-depth research in its molecular cytogenetics, genomics, and epigenomics. Therefore, developing specific antigenic peptides and antibodies for peanut CENH3 protein is of great value in advancing peanut centromere-related research. Summary of the Invention

[0005] The main objective of this application is to provide an antigenic polypeptide of peanut functional centromere histone CENH3 and its application, aiming to address the shortcomings of existing technologies.

[0006] To achieve the above objectives, the technical solutions adopted in the embodiments of this application are as follows: In a first aspect, embodiments of this application provide an antigenic polypeptide of peanut functional centromere histone CENH3, the full-length sequence of peanut CENH3 protein is shown in SEQ ID NO.1; by screening its N-terminal specific and immunogenic segment, an antigenic polypeptide with an amino acid sequence shown in SEQ ID NO.2 is obtained.

[0007] Secondly, embodiments of this application also provide the application of an antigenic polypeptide of peanut functional centromere histone CENH3 as described above, wherein the antigenic polypeptide is used as an immunogen to prepare an antibody that specifically recognizes peanut functional centromeres.

[0008] As some optional embodiments of this application, the antigenic polypeptide is used to prepare a detection reagent / kit that specifically recognizes the functional centromere of peanut.

[0009] As some optional embodiments of this application, the antibody is prepared by the following steps: Preparation and detection of immunoantigens; The immunoantigen and the detection antigen were diluted to 1 mg / mL with 1×PBS buffer and used for animal immunization experiments. After the animal immunization experiment is completed, whole blood samples are collected; the whole blood samples are centrifuged, and the supernatant is collected, which is the antiserum; After the antiserum was sterilized by filtration through a 0.45 μm filter membrane, it was purified by antigen affinity chromatography to obtain purified polyclonal antibody against peanut CENH3 protein.

[0010] As some optional embodiments of this application, the preparation of immunoantigens and the detection of antigens include: Using Sulfo-SMCC as a coupling agent, the synthesized antigenic peptide was coupled with the KLH carrier protein to obtain an immunogenic antigen. Glutaraldehyde was used as a coupling agent to conjugate the antigenic peptide with the BSA carrier protein to obtain the detection antigen.

[0011] As some optional embodiments of this application, the step of using Sulfo-SMCC as a coupling agent to couple the synthesized antigen peptide with the KLH carrier protein to obtain an immunoantigen includes: KLH carrier protein was dissolved in 1×PBS buffer and the concentration was adjusted to 10 mg / mL; an equal volume of 5 mg / mL Sulfo-SMCC was added and the mixture was reacted at room temperature for 30 minutes to activate KLH. The antigenic peptide was added to the activated KLH solution at a molar ratio of 10:1 to the KLH, and incubated overnight at 4°C by rotation. Uncoupled free peptides are removed by dialysis to obtain peptide-KLH conjugates, which are immune antigens.

[0012] As some optional embodiments of this application, the step of using glutaraldehyde as a coupling agent to couple the antigen peptide with the BSA carrier protein to obtain the detection antigen includes: BSA was dissolved in 1×PBS buffer and the concentration was adjusted to 10 mg / mL; 25% glutaraldehyde solution was added to make the final concentration of glutaraldehyde 0.5%, and the reaction was carried out at room temperature for 1 hour; the antigen peptide was added at 10 times the molar ratio of the BSA and incubated overnight at 4°C by rotation; the uncoupled free peptide and glutaraldehyde were removed by dialysis to obtain the peptide-BSA conjugate, which is the detection antigen.

[0013] As some optional embodiments of this application, the purification process includes the following steps: purifying specific antibodies in rabbit immune serum using antigen affinity chromatography.

[0014] As some optional embodiments of this application, the step of purifying specific antibodies in rabbit immune serum using antigen affinity chromatography includes: The antigenic peptide was covalently coupled to activated Sulfolink Resin to prepare an antigen affinity column with 1 mL of resin coupled to 1 mg of peptide, and equilibrated with 10 column volumes of PBS buffer. Rabbit serum filtered through a 0.45 μm filter membrane was passed through a column, and the target antibody was captured by the specific binding between the peptide and the antibody. The flow-through was then collected. Wash the affinity column with 10 column volumes of 1×PBS buffer to remove unbound contaminating proteins until the absorbance of the eluent at 280 nm is close to the baseline. Add 5 mL of antibody eluent and collect the eluent in 1 mL tubes. Measure the absorbance of each tube at 280 nm and collect the fraction with antibody peaks as the antibody fraction. The collected antibody fraction was placed in a dialysis bag and dialyzed at 4°C for 24 hours using 1×PBS buffer as the dialysate, with the dialysate being changed 3 times during the process to remove glycine from the eluent. After dialysis, the antibody concentration was adjusted by ultrafiltration or lyophilization to obtain purified polyclonal antibody against peanut CENH3 protein.

[0015] Compared with existing technologies, this application describes an antigenic polypeptide of peanut functional centromere histone CENH3, the full-length sequence of which is shown in SEQ NO.1. By screening for its N-terminal specific and highly immunogenic region, an antigenic polypeptide with the amino acid sequence shown in SEQ NO.2 was obtained. In other words, this application provides a highly immunogenic antigenic polypeptide based on the N-terminal specific region of peanut CENH3 protein and establishes a corresponding method for preparing polyclonal antibodies. The obtained antibody exhibits high specificity, specifically recognizing peanut functional centromeres, with no signal observed in the astragalus control; it also has high titer, with an antibody concentration reaching 1.6 mg / mL, meeting detection standards even after 80,000-fold dilution by ELISA. This antibody is suitable for immunofluorescence localization, ChIP-seq enrichment analysis, and the development of accompanying reagent kits, providing a stable, efficient, and multi-dimensional research tool for peanut centromere function studies. Its technical process is mature and highly reproducible. Attached Figure Description

[0016] Figure 1 This is a sequence alignment diagram showing the amino acid sequences of CENH3 proteins from peanuts and other species involved in the embodiments of this application; Ahy: Cultivated peanuts ( Arachis hypogaea ); Aip: Arachis ipaensis Adu: Arachis duranensis ;Gma: soybean ( Glycine max ); Ath: Arabidopsis thaliana ( Arabidopsis thaliana Zma: Corn ( Zea mays Osa: rice ( Oryza sativa ).

[0017] Figure 2 This is an immunofluorescence experiment diagram of the peanut CENH3 protein antibody involved in the embodiments of this application; a1-a3: mitotic chromosomes of peanut root tip cells, b1-b3: mitotic chromosomes of astragalus root tip cells. a1 and b1 are the results of DAPI staining, a2 and b2 are the fluorescence signals of CENH3 antibody, and a3 and b3 are the signals after the combination of DAPI and CENH3 antibody, respectively; as can be seen from the figure, the antibody obtained in this application has strong specificity and can specifically recognize the functional centromere of peanut, while the astragalus control shows no signal.

[0018] Figure 3 The image shows the signal distribution on peanut chromosomes using the peanut CENH3 antibody in the embodiments of this application. It can be seen that significant CENH3 binding sites were identified on each chromosome, and they were all located near the central region of the chromosome, which is consistent with typical centromere characteristics. This proves that the peanut CENH3 antibody can identify centromere signals on all peanut chromosomes. Detailed Implementation

[0019] It should be made clear that the specific implementation examples described herein are for illustrative purposes only and are not intended to limit this application.

[0020] To address the shortcomings of existing technologies, the embodiments of this application propose the following solutions: (I) Antigen polypeptide design and synthesis Peptide sequence determination: The full-length sequence of peanut CENH3 protein was analyzed using bioinformatics. Artificial synthesis: The peptide was synthesized by a professional institution using solid-phase synthesis. After synthesis, it was purified by high-performance liquid chromatography (HPLC) to ensure that the peptide purity was ≥90%. The molecular weight of the peptide was verified by mass spectrometry to be consistent with the theoretical value. After aliquoting, it was sealed and stored at -20℃ for later use.

[0021] (II) Antibody Preparation Methods 1. Experimental Materials and Reagents Main reagents: Sulfo-SMCC (coupling agent), KLH (keyhole hemocyanin, carrier protein), and Sulfolink Resin (affinity purification resin) are all products of Pierce Laboratories, USA; Freund's complete adjuvant and Freund's incomplete adjuvant are products of Sigma-Aldrich, USA; NaCl, KCl, Na2HPO4·12H2O, KH2PO4, Tris, glycine, EDTA, TMB (chromogenic substrate), DMSO, glutaraldehyde, skim milk powder, etc. are all domestically produced analytical grade reagents; fluorescently labeled secondary antibody (enzyme-labeled goat anti-rabbit IgG) is a commercially available product.

[0022] Experimental consumables: dialysis bags (Viskase, USA, molecular weight cutoff 14kD), P-10 column (BioRad, USA).

[0023] Experimental instruments: magnetic stirrer (Shanghai Meiyingpu), rotary mixer (Shanghai Qiangyun), UV / Vis spectrophotometer (Shanghai Opler), high-speed refrigerated centrifuge (Hitachi), microplate reader (Thermo), fluorescence microscope (Olympus), etc.

[0024] 2. Solution preparation PBS buffer (phosphate buffered saline): ① 10× stock solution: Weigh 8.5g NaCl, 0.2g KCl, 2.85g Na2HPO4·12H2O (or 1.13g Na2HPO4·2H2O), and 0.27g KH2PO4, dissolve in 100mL deionized water, adjust the pH to 7.2 with hydrochloric acid or sodium hydroxide, and store at room temperature; ② 1× working solution: Take 50mL of 10× stock solution, dilute with 450mL deionized water, prepare fresh before use or store at 4℃.

[0025] Antigen coating solution (CBS, 1×): Weigh 1.59g of Na2CO3 and 2.93g of NaHCO3, add 950mL of deionized water, stir to dissolve, adjust the pH to 9.6, add deionized water to make up to 1000mL, and store in a sealed container at 4℃ for later use.

[0026] Blocking solution: Weigh 5g of skim milk powder, dissolve it in 100mL of 1×PBS buffer, mix thoroughly, and store at 4℃ for no more than 3 days.

[0027] TMB chromogenic solution: ① TMB stock solution: Weigh an appropriate amount of TMB powder and prepare a 1.5 mg / mL stock solution with DMSO. Aliquot and store at -20℃; ② NaAc buffer solution: Prepare a 200 mM NaAc solution and adjust the pH to 5.3 with HAc; ③ H2O2 solution: Prepare a 0.03% H2O2 solution. When using, prepare fresh solution according to the ratio of TMB stock solution: NaAc buffer solution: H2O2 solution = 1:4:5.

[0028] Termination solution (2M sulfuric acid): Slowly add 100mL of concentrated sulfuric acid to 900mL of deionized water (be careful to add it slowly along the wall of the beaker while stirring), cool to room temperature, and then seal and store.

[0029] Antibody elution buffer: Weigh 7.5g of glycine, dissolve it in 100mL of deionized water, adjust the pH to 2.7 with concentrated hydrochloric acid, and store in a sealed container at 4℃ for later use.

[0030] 3. Core Experimental Procedure (1) Peptide conjugation Immunogen preparation: Sulfo-SMCC was used as the coupling agent to conjugate the synthesized antigenic peptide with the KLH carrier protein. Specific steps: ① Dissolve KLH in 1×PBS buffer and adjust the concentration to 10 mg / mL; ② Add an appropriate amount of Sulfo-SMCC and react at room temperature for 30 minutes to activate KLH; ③ Add the antigenic peptide to the activated KLH solution at a molar ratio of 10:1, and incubate overnight at 4°C by rotation; ④ Remove unconjugated free peptides by dialysis to obtain the peptide-KLH conjugate, i.e., the immunoantigen.

[0031] Preparation of the detection antigen: Glutaraldehyde was used as the coupling agent to conjugate the antigen peptide to the BSA carrier protein. Specific steps: ① Dissolve BSA in 1×PBS buffer and adjust the concentration to 10 mg / mL; ② Add 25% glutaraldehyde solution to a final concentration of 0.5%, and react at room temperature for 1 hour; ③ Add the antigen peptide (peptide to BSA molar ratio 10:1), and incubate overnight at 4°C by rotation; ④ Dialyze to remove unconjugated free peptide and glutaraldehyde to obtain the peptide-BSA conjugate, which is the detection antigen.

[0032] (2) Antigen dilution and preservation The prepared immunoantigen and detection antigen were diluted to 1 mg / mL with 1×PBS buffer, aliquoted into 1 mL tubes, and stored at -20°C for later use, avoiding repeated freeze-thaw cycles.

[0033] (3) Animal immunization Two healthy adult New Zealand White rabbits (weighing 2.0kg-2.5kg, purchased from a reputable laboratory animal farm) were selected as immunization animals. They were given a one-week acclimatization period with free access to food and water. The specific immunization procedure is as follows: Day 1 (First Immunization): Take 1 mL of the immunogen solution, add 1 mL of Freund's complete adjuvant, place in a centrifuge tube, and emulsify thoroughly using a vortex mixer. Emulsification test: Take a drop of the emulsified antigen solution and add it to physiological saline. If the drop does not disperse, the emulsification is successful. Immunize using a multi-point subcutaneous injection method on the back of the neck, with at least 8 injection points per rabbit to ensure even antigen distribution.

[0034] Day 15 (First booster immunization): Take 1 mL of immunogen solution, add 1 mL of Freund's incomplete adjuvant, emulsify thoroughly (testing standards are the same as before), and administer immunization using the same injection method and site as the first immunization.

[0035] Day 29 (Second booster immunization): The immunization procedure is the same as the first booster immunization, using Freund's incomplete adjuvant + emulsified immunoantigen before injection.

[0036] Day 43 (Third booster immunization): The immunization procedure is the same as the previous two booster immunizations, ensuring that the antigen dosage and emulsification effect are consistent.

[0037] Day 53 (Blood Collection): After immunization, whole blood was collected using the carotid artery method. The collected whole blood was placed in sterile centrifuge tubes and incubated overnight at 4°C. The tubes were then centrifuged (4°C, 10,000 rpm) for 30 minutes, and the supernatant was collected as antiserum. The antiserum was sterilized by filtration through a 0.45 μm filter membrane, aliquoted, and stored at -20°C for later use.

[0038] (4) Antibody purification Specific antibodies in rabbit immune serum were purified using antigen affinity chromatography.

[0039] The core steps include: First, the synthesized antigenic peptide was covalently coupled to activated Sulfolink Resin to prepare an antigen affinity column with 1 mg of peptide coupled to 1 mL of resin, and equilibrated with 10 column volumes of PBS buffer. Next, rabbit serum filtered through a 0.45 μm filter was passed through the column to capture the target antibody using the specific binding between the peptide and the antibody, and the flow-through was collected. The affinity column was then washed with 10 column volumes of 1×PBS buffer to remove unbound contaminants until the absorbance of the eluent at 280 nm was close to the baseline. 5 mL of antibody elution buffer was added, and the eluent was collected in 1 mL tubes. The absorbance of each tube of eluent at 280 nm was measured, and the fraction with the antibody peak was collected. The collected antibody fraction was placed in a dialysis bag and dialyzed at 4°C for 24 hours using 1×PBS buffer as the dialysate, with the dialysate being changed 3 times during the process to remove glycine from the eluent. After dialysis, the antibody concentration was adjusted by ultrafiltration or lyophilization to obtain purified polyclonal antibody against peanut CENH3 protein.

[0040] Antibody concentration was determined using ultraviolet absorption spectrometry. The absorbance of the antibody at 280 nm was measured using a UV / Vis spectrophotometer. The antibody concentration was calculated using the formula: Antibody concentration (mg / mL) = A280 × dilution factor × 1.45 - A260 × dilution factor × 0.74. The final antibody concentration obtained was 1.6 mg / mL (obtained by averaging the two antibody stock solutions and rounding).

[0041] 4. Antibody storage conditions The purified polyclonal antibody against peanut CENH3 protein is glycerol-free and should be aliquoted into small volumes (50 μL / tube or 100 μL / tube) and stored below -20°C. For long-term storage, it is recommended to store at -80°C. Avoid repeated freeze-thaw cycles during storage to prevent loss of antibody activity.

[0042] (III) Core Applications Applications of the antigenic peptide: This antigenic peptide can be used as an immunogen to prepare antibodies that specifically recognize peanut functional centromeres, and then applied to peanut centromere-related research and the development of detection reagents / kits.

[0043] Applications of cellular localization: By using immunofluorescence technology and antibody-specific identification of functional centromeres on peanut chromosomes, the cellular localization of centromeres is achieved, providing a tool for peanut chromosome karyotype analysis and cellular characterization studies.

[0044] Applications in genomics research: By using ChIP-seq technology and the specific binding of antibodies to peanut CENH3 protein, characteristic DNA sequences of peanut centromeres are enriched, the location of centromeres on chromosomes is determined, and key data are provided for the assembly of centromere regions of the peanut genome and the analysis of centromere sequence characteristics.

[0045] Application of detection reagents / kits: Using this antibody as the core component, combined with relevant reagents (such as fluorescently labeled secondary antibodies, chromogenic substrates, etc.), detection reagents or kits that specifically identify peanut centromeres can be prepared. These kits are suitable for research institutions, agricultural colleges and related enterprises to carry out peanut genetic breeding, genome research and other work.

[0046] In the immunofluorescence verification experiment, a specific and bright fluorescent signal appeared in the centromere region of peanut chromosomes, with uniform signal intensity and accurate localization; while as a negative control, no specific fluorescent signal appeared on the chromosome of milkvetch, indicating that the prepared antibody can specifically recognize peanut functional centromeres without cross-reactivity, and the specificity meets the experimental requirements.

[0047] ELISA results showed that the antibody remained positive (S / N > 2.1) even when diluted 80,000 times, indicating high antibody titer and strong sensitivity.

[0048] In the ChIP-seq experiment, the antibody successfully identified the characteristic DNA sequence of peanut centromeres (signal peak in the middle of the chromosome). Through sequencing analysis, the position of peanut centromeres on the chromosome was accurately determined, providing key support for the sequence assembly of the centromere region of the peanut genome and solving the technical problem of difficult resolution of peanut centromere sequences.

[0049] This antigenic peptide and antibody fill the gap in specific tools for the study of peanut functional centromeres, providing reliable technical means for the study of peanut molecular cytogenetics, genomics and epigenomics, and can promote in-depth research on the formation and evolution mechanism of peanut centromeres, the construction of genetic maps and other related research.

[0050] This antibody is applicable to both cellular localization and genomics research, and can be used as a core component in the development of diagnostic kits. Its applications cover multiple fields such as scientific research and breeding, demonstrating significant practical value and market potential.

[0051] The technical solution described in this application will now be explained in detail with reference to specific embodiments: Example 1: Selection and Synthesis of Antigenic Polypeptides This application found a gene homologous to the Arabidopsis thaliana CENH3 protein-coding gene in a genome database, namely the peanut CENH3 gene, whose sequence is shown in SEQ ID NO.3 below, and whose encoded CENH3 protein sequence is shown in SEQ ID NO.1.

[0052] SEQ ID NO.1: MARVKHIPTPSQKGKKKVRPSQSPSPSQASGSRRREDGEEEQEPEAGRRSAAPKKRRNKPGTVALREIRKFQKSFNLLIPAAPFMRCVKQITNQLSTEVNRWTAEAMVALQEAAEDHLVRLFEDGmLCAIHAKRVTLMKKDIELARRLGVIGRPW, length 155 amino acids; SEQ ID NO.2: RVKHIPTPSQKGKKK.

[0053] SEQ ID NO.3: ATGGCAAGAGTGAAGCATATTCCAACACCTAGTCAAAAAGGTAAGAAAAAAGTAAGACCATCACAATCTCCATCGCCATCGCAAGCGTCTGGTAGCAGAAGGAGGGAAGATGGAGAAGAGGAGCAGGAACCAGAAGCAGGACGACGATCAGCAGCACCTAAGAAAAGGCGTAATAAGCCAGGAACAGTAGCTCTTCGTGAGATTCGTAAATTTCAGAAGAGTTTCAACCTACTC ATCCCAGCTGCCCCTCATGAGATGTGTCAAACAGATTACAAACCAACTATCTACGGAGGTCAATCGCTGGACAGCTGAAGCACTGGTAAGCAGCTGAGGATCATCTGGTTCGTTTGTTTGAAGATGGAATGTTGTGTGCTATCCATGCAAAGCGTGTTACTCTAATGAAAAAGGACATAGAGTTGGCCCGGAGACTCGGAGTGATAGGAAGACCTTGGTGA Bioinformatics analysis was performed on the amino acid sequences of CENH3 proteins from different species, including peanuts, etc. Arachis ipaensis , Arachis duranensis Soybeans, Arabidopsis thaliana, maize, and rice; results are shown in […]. Figure 1It was found that the amino acid sequence of CENH3 protein varies greatly at the N-terminus but is relatively conserved at the C-terminus among different species. Based on a specific sequence at the N-terminus of the peanut CENH3 protein amino acid sequence (positions 3-17 of Seq1), an antigenic polypeptide targeting peanut functional centromere histone CENH3 was designed, and the specific amino acid sequence is shown in SEQ ID NO.2.

[0054] Following the antibody preparation process outlined in the above technical solution, artificial peptides were synthesized (contracted to Shanghai Youke Biotechnology Co., Ltd.), and peptide conjugation, animal immunization, antiserum collection, and antibody purification were completed. Finally, a polyclonal antibody against peanut CENH3 protein was obtained, aliquoted, and stored at -20℃ for later use.

[0055] Example 2 Enzyme-Linked Immunosorbent Assay (ELISA) The antibody titer was detected using the ELISA method. The specific steps are as follows: Coating: Dilute the detection antigen to 1 μg / mL with antigen coating buffer (CBS), add 100 μL to each well of a 96-well microplate, and incubate overnight at 4°C.

[0056] Blocking: Discard the coating solution, add 200 μL of blocking solution (5% skim milk powder) to each well, and incubate at 37°C for 1.5 hours to block the non-specific binding sites on the microplate.

[0057] Sample addition: Discard the blocking solution, rinse the ELISA plate 10 times with tap water, and pat dry; serially dilute the purified antibody with blocking solution at volume ratios of 1:1250, 1:2500, 1:5000, 1:10000, 1:20000, 1:40000, and 1:80000, and set up normal rabbit IgG as a negative control; add 100 μL of diluted antibody sample or control solution to each well and incubate at 37°C for 1 hour.

[0058] Add secondary antibody: Discard the sample solution, rinse 10 times with tap water, and pat dry; dilute enzyme-labeled goat anti-rabbit IgG with blocking buffer to the working concentration (1:5000), add 100μL to each well, and incubate at 37℃ for 30 minutes.

[0059] Color development: Discard the secondary antibody solution, rinse 10 times with tap water, and pat dry; add 100 μL of freshly prepared TMB color development solution to each well and incubate at 37°C in the dark for 15 minutes.

[0060] Termination and reading: Add 50 μL of 2M sulfuric acid stop solution to each well and gently shake to mix; read the absorbance value of each well at OD450 nm using an ELISA reader.

[0061] Result interpretation: A positive result is defined as a ratio (S / N) of OD450nm value of the antibody sample to that of normal rabbit IgG OD450nm value > 2.1. The test results showed that the antibody remained positive even after a dilution of 80,000 times, indicating that the titer met the standard.

[0062] Antibody ELISA titer:

[0063] *Judgment criteria: S / N > 2.1 (S: antibody detection OD value, N: normal rabbit IgG OD450nm value) Conclusion: The antibody titers obtained all met the standards, and the ELISA test results were qualified.

[0064] Example 3: Antibody-specific immunofluorescence verification 1. Experimental Materials (1) Sample Young root tips of peanut (variety: Fuhua peanut); young root tips of milkvetch (as negative control).

[0065] (2) Reagents Polyclonal antibody against peanut CENH3 protein (prepared in Example 2); fluorescently labeled secondary antibody (Alexa Fluor 594 labeled goat anti-rabbit IgG, Invitrogen); 4% paraformaldehyde fixative; 1×PBS buffer; mounting medium containing DAPI (Vector Labs, H-1200); ethanol (gradient concentrations: 70%, 90%, 100%).

[0066] (3) Instruments Fluorescence microscope (Olympus BX51); dissecting needles, slides, coverslips; centrifuge, incubator.

[0067] 2. Experimental Procedure (1) Root apex fixation and slide preparation Take tender root tips (1-2cm in length) from peanuts and milkvetch, rinse them with clean water, and place them in 4% paraformaldehyde fixative solution to fix for 15 minutes at room temperature.

[0068] After fixation, the root tips were rinsed three times with 1×PBS buffer for 5 minutes each time to remove residual fixative.

[0069] Cut a root tip meristem (about 2 mm long), place it in the center of a glass slide, add 10 μL of 1×PBS buffer, gently cover with a coverslip, and gently tap the coverslip with a dissecting needle to allow the meristematic cells to spread out fully.

[0070] Place the slide in liquid nitrogen to freeze for 30 seconds, quickly remove it and peel off the coverslip, then immediately immerse it in 70% ethanol for 5 minutes to dehydrate, followed by 5 minutes each in 90% ethanol and 100% ethanol. Let it air dry at room temperature for later use.

[0071] (2) Primary antibody incubation Add 100 μL of primary antibody incubation solution (97 μL 1×PBS buffer + 3 μL anti-peanut CENH3 protein antibody, antibody stock solution diluted 1:100) to each slide, cover with a coverslip, and incubate overnight in a humidified chamber at 37°C in the dark.

[0072] (3) Secondary antibody incubation The next day, remove the coverslip and rinse the slide three times with 1×PBS buffer for 5 minutes each time; add 50 μL of secondary antibody incubation solution (Alexa Fluor 594-labeled goat anti-rabbit IgG diluted 1:1000 with 1×PBS buffer), and incubate at 37°C for 1 hour, avoiding light during incubation.

[0073] (4) Covering and microscopic examination After the secondary antibody incubation, the slides were rinsed three times with 1×PBS buffer for 5 minutes each time. After air-drying at room temperature, 20 μL of mounting medium containing DAPI was added, a coverslip was placed on top, and the slides were observed under a fluorescence microscope. The mitotic phases with well-dispersed chromosomes and clear fluorescence signals were selected for photographing and recording.

[0074] 3. Results Fluorescence microscopy revealed specific, bright red fluorescent signals in the centromere region of peanut chromosomes. The number of signal points matched the number of peanut chromosomes, and the signals were accurately located with no obvious background signal. Figure 2 a1-a3); however, no specific red fluorescent signal was observed on the chromosomes of *Astragalus membranaceus*, only the outline of the chromosomes stained with DAPI was visible (a1-a3). Figure 2 (b1-b3). The results confirm that the prepared antibodies can specifically recognize peanut functional centromeres, with no cross-reactivity, and the specificity meets the requirements.

[0075] Example 4: Application of Antibodies in Chromatin Immunoprecipitation Sequencing (ChIP-seq) Technology 1. Experimental Materials (1) Sample Peanut seedlings (variety: Fuhua peanut), 14 days old, 2g of leaf tissue was taken.

[0076] (2) Reagents Polyclonal antibody against peanut CENH3 protein (Preparation in Example 2); Protein A agarose beads (Sigma, catalog number 16-201); Crosslinking buffer (0.4M sucrose, 10mM Tris-HCl pH 8.0, 1mM PMSF, 1mM EDTA, 1% formaldehyde); Nuclear separation buffer (0.25M sucrose, 15mM PIPES pH 6.8, 5mM MgCl2, 60mM KCl, 15mM NaCl, 1mM CaCl2, 0.9% Tween X-100, 2mg / mL aprotinin, 2mg / mL protease); Nuclear buffer (50mM HEPES pH 7.5, 150mM NaCl, 1mM EDTA, 1mM PMSF, 1% SDS, 0.1% sodium deoxycholate, 1% Tween X-100, 1mg / mL aprotinin, 1mg / mL... Inhibitors of proteases); elution buffer (0.5% SDS, 0.1M NaHCO3); low-salt wash buffer, high-salt wash buffer, LiCl wash buffer, TE buffer (all prepared according to standard formulations); proteinase K (20 mg / mL); phenol / chloroform / isoamyl alcohol (25:24:1); anhydrous ethanol, 70% ethanol; glycogen (20 mg / mL).

[0077] (3) Instruments Ultrasonic disruptor; high-speed refrigerated centrifuge; high-throughput sequencer (Illumina NovaSeq); bioinformatics analysis software (BWA, SAMtools, IGV, etc.).

[0078] 2. Experimental Procedure (1) Chromatin preparation and cross-linking Take peanut leaf tissue, rinse it with clean water, dry the surface moisture, put it into a pre-cooled mortar, add liquid nitrogen and grind it quickly into a fine powder.

[0079] Transfer the powder to a centrifuge tube, add 37 mL of crosslinking buffer, and crosslink under vacuum at room temperature for 10 minutes; add 2.5 mL of 2 M glycine solution to a final concentration of 100 mM, and incubate under vacuum at room temperature for 5 minutes to terminate the crosslinking reaction.

[0080] Wash the tissue three times with sterile deionized water, blot dry, then grind it into a fine powder with liquid nitrogen. Add 25 mL of nuclear separation buffer and incubate on ice for 15-30 minutes to fully resuspend the tissue.

[0081] After homogenization, the mixture was filtered through four layers of coarse cotton cloth. The filtrate was centrifuged at 11000g for 20 minutes at 4℃, and the precipitate (cell nuclei) was collected. The precipitate was resuspended in 2mL of nuclear buffer to obtain a cell nucleus suspension.

[0082] (2) Chromatin sonication Divide the cell nuclear suspension into four 500 μL portions and place each portion into a 1.5 mL centrifuge tube. Use an ultrasonic homogenizer to sonicate the chromatin five times at 6x power, for 15 seconds each time, with a 1-minute interval (the sample was placed on ice), breaking the chromatin into fragments of 200-1000 bp. After sonication, centrifuge at 13800 g for 10 minutes at 4°C, and collect the supernatant, which is the sonicated chromatin sample.

[0083] (3) Immunoprecipitation Take 100 μL of chromatin sample, dilute it 10 times with lysis buffer, add 50 μL of pre-equilibrated salmon sperm DNA / protein A agarose beads, and gently rotate at 4°C for 1 hour to pre-clarify the chromatin.

[0084] Add 5 μL of anti-peanut CENH3 protein antibody to the pre-clarified supernatant and incubate overnight at 4°C with slow rotation to allow the antibody to bind to the chromatin complex.

[0085] Add 60-75 μL of salmon sperm DNA / protein A agarose beads and incubate at 4°C for 2 hours to capture immune complexes; centrifuge at 3800g for 2 minutes at 4°C and collect the agarose bead precipitate.

[0086] (4) Washing and elution Wash the agarose bead precipitate sequentially with the following buffers, gently rotating for 5 minutes at 4°C after each wash, followed by centrifugation at 3800g for 2 minutes at 4°C, and discarding the supernatant: ① Low-salt wash buffer once; ② High-salt wash buffer once; ③ LiCl wash buffer once; ④ TE buffer twice.

[0087] After washing, add 250 μL of freshly prepared elution buffer, incubate at room temperature for 15 minutes, shake gently to elute the immune complex; centrifuge at 3800g for 2 minutes at 4°C, collect the supernatant; add another 250 μL of elution buffer, incubate at room temperature for 30 minutes, repeat the elution once, and combine the two eluents (total 500 μL).

[0088] (5) DNA extraction and purification Add 20 μL of 5M NaCl solution to the eluent and incubate overnight at 65°C to reverse the crosslinking reaction.

[0089] Add 10 μL of 0.5M EDTA, 20 μL of 1M Tris-HCl (pH 6.5), and 1 μL of proteinase K (20 mg / mL), and incubate at 45°C for 1.5 hours to digest the protein.

[0090] Add an equal volume (550 μL) of phenol / chloroform / isoamyl alcohol, vortex briefly, centrifuge at 13800 g for 15 minutes at 4 °C, and collect the supernatant.

[0091] Add 2.5 volumes of anhydrous ethanol, 1 / 10 volume of 3M sodium acetate solution (pH 5.2), and 4 μL of glycogen (20 mg / mL) to the supernatant, and incubate at -80°C for 1 hour to precipitate DNA.

[0092] Centrifuge at 13800g for 15 minutes at 4℃ and discard the supernatant; wash the precipitate with 500μL of 70% ethanol, centrifuge at 13800g for 10 minutes at 4℃ and discard the supernatant; air dry the precipitate at room temperature, add 50μL of TE buffer to dissolve the DNA, and store at -80℃ for later use.

[0093] (6) High-throughput sequencing and data analysis The extracted DNA samples were entrusted to Shanghai Meiji Biomedical Technology Co., Ltd. for library construction and high-throughput sequencing. After quality control, the sequencing data were aligned to the peanut reference genome using BWA software, and sorted and deredundant was performed using SAMtools software. Sequencing depth and genome coverage were then statistically analyzed. The ChIP-seq results were visualized using IGV software to identify CENH3-binding DNA sites. The CENH3 binding sites on each chromosome could be clearly identified based on the signal peaks. Figure 3 ).

[0094] The above description is only a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. An antigenic polypeptide of peanut functional centromere histone CENH3, characterized in that, The full-length sequence of peanut CENH3 protein is shown in SEQ ID NO.1; by screening for its N-terminal specific and highly immunogenic segment, an antigenic polypeptide with an amino acid sequence as shown in SEQ ID NO.2 was obtained.

2. Use of an antigenic polypeptide of peanut functional centromere histone CENH3 according to claim 1, characterized in that, The antigenic polypeptide was used as an immunogen to prepare antibodies that specifically recognize peanut functional centromeres.

3. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 2, characterized in that, The antigenic peptide was used to prepare a detection reagent / kit that specifically recognizes the functional centromere of peanuts.

4. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 2, characterized in that, The antibody is prepared by the following steps: Preparation and detection of immunoantigens; The immunoantigen and the detection antigen were diluted to 1 mg / mL with 1×PBS buffer and used for animal immunization experiments. After the animal immunization experiment is completed, whole blood samples are collected; the whole blood samples are centrifuged, and the supernatant is collected, which is the antiserum; After the antiserum was sterilized by filtration through a 0.45 μm filter membrane, it was purified by antigen affinity chromatography to obtain purified polyclonal antibody against peanut CENH3 protein.

5. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 4, characterized in that, Preparation of immunoantigens and detection of antigens, including: Using Sulfo-SMCC as a coupling agent, the synthesized antigenic peptide was coupled with the KLH carrier protein to obtain an immunogenic antigen. Glutaraldehyde was used as a coupling agent to conjugate the antigenic peptide with the BSA carrier protein to obtain the detection antigen.

6. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 5, characterized in that, The step of using Sulfo-SMCC as a coupling agent to conjugate the synthesized antigen peptide with the KLH carrier protein to obtain an immunoantigen includes: KLH carrier protein was dissolved in 1×PBS buffer and the concentration was adjusted to 10 mg / mL; an equal volume of 5 mg / mL Sulfo-SMCC was added and the mixture was reacted at room temperature for 30 minutes to activate KLH. The antigenic peptide was added to the activated KLH solution at a molar ratio of 10:1 to the KLH, and incubated overnight at 4°C by rotation. Uncoupled free peptides are removed by dialysis to obtain peptide-KLH conjugates, which are immune antigens.

7. The application of the antigenic polypeptide of peanut functional centromere histone CENH3 according to claim 5, characterized in that, The step of using glutaraldehyde as a coupling agent to conjugate the antigen peptide to the BSA carrier protein to obtain the detection antigen includes: BSA was dissolved in 1×PBS buffer and the concentration was adjusted to 10 mg / mL; 25% glutaraldehyde solution was added to make the final concentration of glutaraldehyde 0.5%, and the reaction was carried out at room temperature for 1 hour; the antigen peptide was added at 10 times the molar ratio of the BSA and incubated overnight at 4°C by rotation; the uncoupled free peptide and glutaraldehyde were removed by dialysis to obtain the peptide-BSA conjugate, which is the detection antigen.

8. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 4, characterized in that, The purification process includes the following steps: purifying specific antibodies in rabbit immune serum using antigen affinity chromatography.

9. The use of the antigenic polypeptide of peanut functional centromere group histone CENH3 according to claim 8, characterized in that, The step of purifying specific antibodies in rabbit immune serum using antigen affinity chromatography includes: The antigenic peptide was covalently coupled to activated Sulfolink Resin to prepare an antigen affinity column with 1 mg of peptide coupled to 1 mL of resin, and equilibrated with 10 column volumes of PBS buffer. Rabbit serum filtered through a 0.45 μm filter membrane was passed through a column, and the target antibody was captured by the specific binding between the peptide and the antibody. The flow-through was then collected. Wash the affinity column with 10 column volumes of 1×PBS buffer to remove unbound contaminating proteins until the absorbance of the eluent at 280 nm is close to the baseline. Add 5 mL of antibody eluent and collect the eluent in 1 mL tubes. Measure the absorbance of each tube at 280 nm and collect the fraction with antibody peaks as the antibody fraction. The collected antibody fraction was placed in a dialysis bag and dialyzed at 4°C for 24 hours using 1×PBS buffer as the dialysate, with the dialysate being changed 3 times during the process to remove glycine from the eluent. After dialysis, the antibody concentration was adjusted by ultrafiltration or lyophilization to obtain purified polyclonal antibody against peanut CENH3 protein.

Images