A recombinant saccharomyces cerevisiae, 11 seed oil fermentation product and preparation method and application thereof

Abstract

The application discloses a kind of recombinant saccharomyces cerevisiae, 11 seed oil fermentation product and its preparation method and application, belong to synthetic biology and fermentation product preparation technical field.The recombinant saccharomyces cerevisiae of the application overexpresses coffee acid coenzyme A ligase 4CL coding gene, chalcone isomerase CHI coding gene, flavanone-3-hydroxylase F3H coding gene and chalcone synthase CHS mutant coding gene, and chalcone synthase CHS mutant is preferably Y69H / H71Y / Q161K.The preparation of 11 seed oil fermentation product includes: the first fermentation liquor is obtained under the condition that recombinant saccharomyces cerevisiae fermentation liquor is fermented in sophora extract and coffee acid;lactic acid bacteria fermentation liquor is fermented in 11 seed oil to obtain the second fermentation liquor;the first fermentation liquor and the second fermentation liquor are mixed to continue fermentation, and after ending, oil phase and water phase are collected respectively, and fermentation product is obtained.The product of the application has multi-dimensional antioxidant activity.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and fermentation product preparation technology, specifically to a recombinant brewer's yeast, 11 seed oil fermentation product, and their preparation methods and applications. Background Technology

[0002] In recent years, the cosmetics industry has undergone a paradigm shift, with a surge in consumer demand for natural and effective skincare products that offer both long-term health benefits and enhanced aesthetics. The concept of "oil-based skincare" has emerged and gained popularity in response. These oils are highly favored due to their rich content of essential fatty acids, antioxidants, and other beneficial components. However, as consumers continue to pursue effective skincare, enhancing the efficacy of plant oils has become a noteworthy and significant innovation.

[0003] 2R,3R-dihydroquercetin (DHQ) is a substance with potent antioxidant, anti-inflammatory, and collagen-synthesizing effects, showing significant potential in delaying skin aging and soothing skin problems, making it an ideal active skincare ingredient. However, DHQ is almost insoluble in oils, making it difficult to disperse evenly and exert its full efficacy. Summary of the Invention

[0004] The technical problem to be solved by this invention is to overcome the problems of low DHQ yield and poor DHQ solubility in oils in the prior art. It provides a strain that can efficiently synthesize DHQ, which is achieved through synthetic biology modification of yeast. Through the joint fermentation of lactobacillus and yeast, the dihydroquercetin is fully dispersed and dissolved in oils. That is, the fermentation process allows DHQ to be organically combined with vegetable oils, thereby obtaining a fermented oil and fermentation broth with multidimensional antioxidant activity.

[0005] The first objective of this invention is to provide a method for preparing an 11-seed oil fermentation product, the 11-seed oil fermentation product comprising fermented oil and / or fermentation broth, the preparation method comprising the following steps: S1. Prepare recombinant brewing yeast fermentation broth, and then continue to ferment the recombinant brewing yeast fermentation broth in the presence of Sophora japonica extract and caffeic acid to obtain the first fermentation broth; Prepare a lactic acid bacteria fermentation broth, and then continue to ferment the lactic acid bacteria fermentation broth in the presence of 11 seed oil to obtain a second fermentation broth; S2. Mix the first fermentation broth and the second fermentation broth, and continue fermentation; After fermentation S3 and S2 are completed, the oil phase is collected to obtain the fermented oil; and / or, after fermentation S2 is completed, the aqueous phase is collected to obtain the fermentation broth. The recombinant Saccharomyces cerevisiae was obtained by modifying the Saccharomyces cerevisiae host strain. The modification included: overexpressing the gene encoding caffeic acid coenzyme A ligase 4CL, the gene encoding chalcone isomerase CHI, the gene encoding flavanone-3-hydroxylase F3H, and the gene encoding chalcone synthase CHS mutant. The chalcone synthase CHS mutant contains one or more of the following mutations relative to the amino acid sequence shown in SEQ ID NO. 1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine.

[0006] Furthermore, the overexpression is performed via free expression or genome integration, preferably plasmid expression.

[0007] Furthermore, the amino acid sequence of caffeic acid coenzyme A ligase 4CL is shown in SEQ ID NO.2; the amino acid sequence of chalcone isomerase CHI is shown in SEQ ID NO.3; and the amino acid sequence of flavanone-3-hydroxylase F3H is shown in SEQ ID NO.4. The gene sequence encoding caffeic acid coenzyme A ligase 4CL is shown in SEQ ID NO.8; the gene sequence encoding chalcone isomerase CHI is shown in SEQ ID NO.10; and the gene sequence encoding flavanone-3-hydroxylase F3H is shown in SEQ ID NO.11.

[0008] Furthermore, the preparation of recombinant brewing yeast fermentation broth includes the following steps: inoculating recombinant brewing yeast into a seed culture medium to prepare a seed liquid, and inoculating the seed liquid into a yeast fermentation culture medium to prepare the recombinant brewing yeast fermentation broth; wherein, the yeast fermentation culture medium contains rice, soybean extract and glucose.

[0009] Preferably, the yeast fermentation medium contains the following components: 10-30 g / L rice, 10-30 g / L soybean extract, and 5-20 g / L glucose.

[0010] Furthermore, in the recombinant brewer's yeast fermentation broth, the concentration of Sophora japonica extract was 1-5 g / L, and the concentration of caffeic acid was 2-20 g / L.

[0011] Further, the preparation of lactic acid bacteria fermentation broth includes the following steps: inoculating lactic acid bacteria into a seed culture medium to prepare a seed liquid, and inoculating the seed liquid into a lactic acid bacteria fermentation culture medium to prepare the lactic acid bacteria fermentation broth; wherein, the lactic acid bacteria fermentation culture medium contains glucose, soybean extract, corn flour and whey powder.

[0012] Preferably, the lactic acid bacteria fermentation medium contains the following components: glucose 10-30 g / L, soybean extract 10-30 g / L, corn flour 5-20 g / L, and whey powder 10-30 g / L.

[0013] Furthermore, the lactic acid bacteria is Lactobacillus CGMCC No. 24962.

[0014] Furthermore, the mass ratio of lactic acid bacteria fermentation broth to 11 seed oil is 1:(0.5-3).

[0015] Furthermore, 11 seed oil contains one or more of the following: meadowfoam seed oil, sunflower seed oil, wheat germ oil, borage seed oil, European hazelnut seed oil, plantain leaf artichoke seed oil, macadamia seed oil, jojoba seed oil, peony seed oil, European blueberry seed oil, and perilla seed oil.

[0016] Preferably, it is composed of meadowfoam seed oil, sunflower seed oil, wheat germ oil, borage seed oil, European hazelnut seed oil, plantain leaf and blue thistle seed oil, macadamia seed oil, jojoba seed oil, peony seed oil, European blueberry seed oil and perilla seed oil.

[0017] Furthermore, when mixing the first fermentation broth and the second fermentation broth, the mass ratio of the first fermentation broth to the second fermentation broth is 1:(0.5-2).

[0018] This invention also claims protection for the 11 seed oil fermentation product prepared by the preparation method.

[0019] A second objective of this invention is to provide the application of the fermented product in the preparation of daily chemical products (such as cosmetics, antioxidant products, etc.).

[0020] The third objective of this invention is to provide a recombinant Saccharomyces cerevisiae, which is obtained by modifying a Saccharomyces cerevisiae host strain, wherein the modification includes: overexpressing the gene encoding caffeic acid-coenzyme A ligase 4CL, the gene encoding chalcone isomerase CHI, and the gene encoding a chalcone synthase CHS mutant; The chalcone synthase CHS mutant contains one or more of the following mutations relative to the amino acid sequence shown in SEQ ID NO. 1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine.

[0021] Furthermore, the modification also includes overexpression of the gene encoding flavanone-3-hydroxylase F3H.

[0022] A fourth objective of this invention is to provide the application of the recombinant brewing yeast in the preparation of sagerol.

[0023] A fifth object of the present invention is to provide the use of the recombinant Saccharomyces cerevisiae in the preparation of 2R,3R-dihydroquercetin.

[0024] The sixth object of the present invention is to provide the application of the recombinant brewing yeast in the preparation of daily chemical products (such as 11 seed oil fermentation products).

[0025] A seventh object of the present invention is to provide a chalcone synthase CHS mutant, wherein the chalcone synthase CHS mutant contains one or more of the following mutations relative to the amino acid sequence shown in SEQ ID NO.1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine.

[0026] An eighth object of the present invention is to provide a nucleic acid encoding the CHS mutant of the chalcone synthase.

[0027] Furthermore, the coding gene sequence is shown in SEQ ID NO.9.

[0028] A ninth object of the present invention is to provide a gene expression cassette or recombinant plasmid carrying the said nucleic acid.

[0029] The tenth object of the present invention is to provide recombinant cells containing the CHS mutant of the chalcone synthase, wherein the host cell is a non-plant cell, such as a microorganism.

[0030] The beneficial effects of this invention are: (1) This invention provides a highly efficient production method for dihydroquercetin. By modifying yeast, the microbial production capacity of dihydroquercetin is significantly improved. (2) Through the combined fermentation of lactobacillus and yeast, the free fatty acids, surfactants and other substances generated during the fermentation process allow dihydroquercetin to fully dissolve in the oil. (3) The fermented oil of 11 seeds obtained by the method of the present invention has multidimensional antioxidant effects; (4) The fermentation liquid of 11 seeds obtained by the method of the present invention has multidimensional antioxidant effects.

[0031] Preservation of biological materials Lactobacillus plantarum JJL-01 was deposited on May 23, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 24962, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0032] Figure 1 This is a comparison of the tolerance of different bacterial strains to dihydroquercetin; where the same value indicates that the bacterial concentration used was consistent at different dihydroquercetin concentrations.

[0033] Figure 2 This is a schematic diagram of the construction of a gene expression cassette related to dihydroquercetin synthesis.

[0034] Figure 3 This is a comparison of the DPPH free radical scavenging capacity of fermented oil and crude oil from 11 seeds.

[0035] Figure 4 These are the results of the antioxidant capacity test of the fermentation broth from 11 seeds.

[0036] Figure 5 This is a comparison of the ABTS free radical scavenging capabilities of fermented oil and crude oil from 11 seeds.

[0037] Figure 6 This is a comparison of the hydroxyl radical scavenging capabilities of fermented oil and crude oil from 11 seeds.

[0038] Figure 7 This is a comparison of the superoxide anion free radical scavenging capabilities of fermented oil and crude oil from 11 seeds. Detailed Implementation

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0040] The solution involved in this invention is as follows: An 11-seed fermented oil with multidimensional antioxidant activity, the preparation method of which includes the following steps: S1. Construct a yeast strain capable of efficiently synthesizing DHQ; S2. Ferment yeast, lactobacillus and 11 seed oil; S3. Separate the fermented liquid and collect the oil phase to obtain 11-seed fermented oil.

[0041] In one embodiment of the present invention, the liquid after fermentation in step S3 is separated, and the aqueous phase is collected and purified to obtain 11-seed fermentation liquid.

[0042] In one embodiment of the present invention, the method for preparing the yeast in step S1 is to express caffeic acid coenzyme A ligase, chalcone synthase, chalcone isomerase and flavanone-3-hydroxylase in Saccharomyces cerevisiae.

[0043] In one embodiment of the present invention, the chalcone synthase is a mutant of the chalcone synthase with the amino acid sequence shown in SEQ ID NO.1. Further, the mutant is obtained by mutating amino acids at positions 69, 71, and 161 of the amino acid sequence. This mutant exhibits significantly enhanced enzyme activity when catalyzing the reaction to produce sennaol using caffeic acid as a substrate. Preferably, tyrosine at position 69 is mutated to histidine; histidine at position 71 is mutated to tyrosine; and glutamine at position 161 is mutated to lysine.

[0044] In one embodiment of the present invention, the 11 seed oils in step S2 are composed of meadowfoam seed oil, sunflower seed oil, wheat germ oil, borage seed oil, European hazelnut seed oil, plantain leaf and blue thistle seed oil, macadamia seed oil, jojoba seed oil, peony seed oil, European blueberry seed oil and perilla seed oil.

[0045] In one embodiment of the present invention, the lactobacillus described in step S2 has a strain accession number of CGMCC No. 24962.

[0046] In one embodiment of the present invention, the refining method includes, but is not limited to, steps such as sterilization, dehydration, deacidification, and deodorization.

[0047] In one embodiment of the present invention, the refining method includes, but is not limited to, steps such as oil-water separation, sterilization, membrane filtration, and deodorization.

[0048] Example 1: Error-prone PCR construction of chalcone synthase mutant The microbial synthesis of dihydroquercetin occurs via multiple pathways, including de novo synthesis from glucose, two-step catalytic synthesis from naringenin, one-step catalytic synthesis from quercetin, and multi-step catalytic synthesis from phenylalanine. Considering factors such as substrate availability, synthesis efficiency, and the feasibility of the synthesis process, this invention selects caffeic acid as the substrate for the synthesis of dihydroquercetin. In this reaction, caffeic acid is converted to caffeoyl-CoA by caffeate-CoA ligase. Caffeoyl-CoA reacts with malonyl-CoA under the action of chalcone synthase to form chalcone. Chalcone is then converted to sennarol by chalcone isomerase. Sennarol is then converted to dihydroquercetin by flavanone-3-hydroxylase. In this process, chalcone synthase typically exhibits broad substrate acceptance, catalyzing the condensation reactions of various hydroxycinnamoyl-CoA derivatives with malonyl-CoA. For example, cinnamyl-CoA, p-coumaroyl-CoA, caffeoyl-CoA, and feruloyl-CoA generate a variety of flavonoids. Therefore, this invention first uses protein engineering to regulate the substrate preference of chalcone synthase, thereby efficiently catalyzing the synthesis of sennarol from caffeic acid, and further efficiently synthesizing dihydroquercetin.

[0049] To efficiently screen for chalcone synthase mutants, a chalcone synthesis pathway was constructed in *E. coli*. First, codon optimization was performed based on the amino acid sequence of the caffeic acid-coenzyme A ligase (SEQ ID NO. 2), yielding the DNA sequence shown in SEQ ID NO. 5. This sequence was then cloned into the BamHI and HindIII sites of the pACYCDueT-1 plasmid to obtain the recombinant plasmid pACYC-4CL. Next, codon optimization was performed based on the amino acid sequence of the chalcone isomerase (SEQ ID NO. 3), yielding the DNA sequence shown in SEQ ID NO. 6. This sequence was then cloned into the NdeI and XhoI sites of the recombinant plasmid pACYC-4CL to obtain the recombinant plasmid pACYC-4CL-CHI. The recombinant plasmid pACYC-4CL-CHI was transformed into *E. coli* W3110(DE3) competent cells using a heat shock method to obtain recombinant *E. coli* 4CL-CHI. Finally, based on the amino acid sequence of chalcone synthase (SEQ ID NO. 1), the codon-optimized DNA sequence shown in SEQ ID NO. 7 was synthesized and cloned into the NcoI and XhoI sites of the pET28a plasmid to obtain the recombinant plasmid pET-CHS. The recombinant plasmid pET-CHS was transformed into *E. coli* 4CL-CHI to obtain a recombinant *E. coli* strain capable of catalyzing the synthesis of sennaol from caffeic acid, named *E. coli* 4CL-CHI-CHS.

[0050] Error-prone PCR amplification of the CHS-encoding gene was performed using pET-CHS as a template and primers F1 / R1. Primer sequences are shown in Table 1. A final concentration of 0.2 mM manganese chloride was added to the Taq enzyme PCR system to increase the mutation probability. The plasmid backbone was amplified using pET-CHS as a template and primers F2 / R2. The purified plasmid backbone and fragments were ligated using a seamless cloning kit. The ligation product was transformed into *E. coli* 4CL-CHI using electroporation to obtain a chalcone synthase mutant library.

[0051] Table 1 Primers used for constructing chalcone synthase mutant libraries F1 CTTTAAGAAGGAGATATACCATGGTATCTGTAGAGGAAATCCGTA R1 GTGGTGGTGCTCGAGTTAGGACAGGTTCTCCAGCGGCAG F2 CATGGTATATCTCCTTCTTAAAGTTAAACAAAATTAT R2 CTCGAGCACCACCACCACCAC Example 2: Screening of Chalcone Synthase Mutants Single colonies of *E. coli* 4CL-CHI-CHS and chalcone synthase mutant libraries from Example 1 were picked and cultured in test tubes containing 5 mL of LB medium. LB medium consisted of 5 g / L yeast extract, 10 g / L tryptone, and 10 g / L sodium chloride, and was cultured overnight at 37°C and 200 rpm. The cultured bacterial culture was then transferred to a fresh 5 mL TB medium at a 3% inoculum volume and cultured at 37°C and 200 rpm for 2 h. The culture was then cooled to 25°C and 0.2 mM IPTG was added to induce expression. TB medium contained 12 g / L tryptone, 24 g / L yeast extract, 4 mL / L glycerol, 9.4 g / L dipotassium hydrogen phosphate, and 2.2 g / L potassium dihydrogen phosphate. After induction for 4 h, 0.1 g / L caffeic acid was added and the temperature was adjusted to 30℃. The mixture was cultured for another 48 h. After fermentation, 1.5 times the volume of ethanol was added, the mixture was vortexed and centrifuged to collect the supernatant containing sennaol.

[0052] Take 200 μL of the collected supernatant, add 200 μL of 5% NaNO2 solution, let stand for 10 min, then add 200 μL of 10% Al(NO3)3 solution, let stand for 10 min, then add 2 mL of 4% NaOH solution. Measure the absorbance of the reaction mixture at 413 nm using an ELISA reader.

[0053] Strains with absorbance values ​​higher than the control strain *E. coli* 4CL-CHI-CHS were selected as primary positives. These were then subjected to secondary screening via shake-flask fermentation using the method described above. 250 mL shake flasks were used, with a liquid volume of 50 mL. HPLC analysis was used for secondary screening. The HPLC detection conditions were as follows: an Agilent Eclipse XDB-Cl8 column; a mobile phase of C2H3N (acetonitrile): H2O: CH3COOH (glacial acetic acid) = 40:60:0.01 (v / v); a column temperature of 30℃; a flow rate of 0.6 mL / min; and a detection wavelength of 280 nm. Through secondary screening of the 11 primary positive strains, three strains with improved *Syngonium oxychloride* conversion were ultimately obtained. Sequencing analysis of the mutant sites in these strains was performed, and the results are shown in Table 2.

[0054] Table 2. Mutation sites and activity analysis of chalcone synthase 69 Tyrosine Histidine 65.6% 71 Histidine Tyrosine 78.9% 161 glutamine Lysine 31.4% Example 3: Construction and activity analysis of chalcone synthase combinatorial mutants Using pET-CHS as a template, the CHS gene fragment was amplified segmentally using primers F1 / R3, F4 / R4, and F5 / R2, with the three mutation sites from Example 2 introduced at the 5' end of the primers. The plasmid backbone was amplified using primer F2 / R2. The primer sequences are shown in Tables 1 and 3, respectively. The amplified gene was ligated using a seamless cloning kit, and the ligation product was transformed into E. coli DH5α competent cells. After sequencing verification, the plasmid was extracted and transformed into E. coli 4CL-CHI to obtain recombinant E. coli, named E. coli 4CL-CHI-CHS-M.

[0055] Table 3 Primers used for constructing chalcone synthase mutants R3 AGATaCATGTgACGTTTACGGATCATGCTCT F4 CGTAAACGTcACATGtATCTGACCGAAGATTTTCTGAAGA R4 GCCCTGCTTGTACATCATCAGACGTTTGAC F5 TGATGATGTACAAGCAGGGCTGCTTCGCGGGTG The recombinant strain E. coli 4CL-CHI-CHS-M was subjected to shake-flask fermentation and HPLC detection according to the method in Example 2. The results showed that the yield of sennaol in this combined mutant strain was 2.6 times higher than that in E. coli 4CL-CHI-CHS.

[0056] Example 4: Comparison of tolerance to dihydroquercetin among different host bacteria Dihydroquercetin (DHQ) exhibits significant antibacterial activity against microorganisms such as Staphylococcus aureus, Bacillus subtilis, and Escherichia coli. To achieve efficient production of dihydroquercetin, this invention first screens microbial strains with good tolerance to dihydroquercetin. For example... Figure 1 As shown, a comparison of the toxicity of dihydroquercetin to Escherichia coli, Bacillus subtilis, and yeast reveals that while dihydroquercetin exhibits significant toxicity to all three strains, its toxicity to yeast is the lowest. The yeast strain was purchased from Solarbio (catalog number: LC0822).

[0057] Example 5: Construction of recombinant yeast First, the key enzyme genes for dihydroquercetin synthesis were optimized based on the codon preference of *Saccharomyces cerevisiae*. The optimized genes for caffeic acid-coenzyme A ligase (4CL), chalcone synthase combinatorial mutant (CHS), chalcone isomerase (CHI), and flavanone-3-hydroxylase (F3H) are shown in SEQ ID NO. 8-11, respectively. A schematic diagram of the construction of the gene expression cassette related to dihydroquercetin synthesis is shown below. Figure 2 As shown, the promoter and terminator were amplified from Saccharomyces cerevisiae S288C, and the G418 selection marker (KanMX) was artificially synthesized, the DNA sequence of which is shown in SEQ ID NO.12. The primers used are shown in the table below.

[0058] Table 4 Primers used for constructing the expression cassette of dihydroquercetin synthesis-related genes. F6 ttcaactcaagacgcacagatat Amplify promoter pgk1 R6 tgttttatatttgttgtaaaaagtagata F7 AAccacaccgtggggccttgt Amplify promoter tdh1 R7 tttgttttgtgtgtaaatttagtgaagt F8 aacgacattactatatatatataatataggaagca Amplify promoter trp1 R8 actccaagctgcctttgtgtgct F9 aactgtgggaatactcaggtatcg Amplify promoter leu2 R9 aggggcagacattagaatggtat F10 cttctaccaatatcgtcattgc Amplification terminator ssd R10 cgacctcaaatgtttacgcag F11 actttttacaacaaatataaaacaATGGCAACAGTTCAACTTCCACCT Amplification of 4CL with homologous arms R11 atacctgagtattcccacagttTTAATTGCCATTTTGTGTCTTACGC F12 atataccattctaatgtctgcccctATGTCCACATCTCTATCCGTAAC Amplification of CHI with homologous arms R12 acaaggccccacggtgtggTTAACTCTGAGGTTTTTCAGAATCTG F13 actaaatttacacacaaaacaaaATGGCACCTAACCCAACAACCACT Amplification of F3H with homologous arms R13 ttatatatatagtaatgtcgttAGCAAAGATTTCCTCGGTACCTTTGGGC F14 gcacacaaaggcagcttggagtATGGTTAGCGTAGAAGAGATCAG Amplification of CHS with homologous arms R14 gcaatgacgatattggtagaagTTAAGATAAGTTCTCCAAAGGTAATGAATGCA F15 gcgtaaacatttgaggtcgGACATGGAGGCCCAGAATACC Amplification of KanMX with homologous arms R15 CAGTATAGCGACCAGCATTCACATA After purification via fusion PCR, the above-mentioned genes were transformed into competent cells of *Saccharomyces cerevisiae* prepared in Example 4 by electroporation, using G418 as the screening antibiotic. Transformants were validated by colony PCR using extracted genome, yielding a recombinant *Saccharomyces cerevisiae* capable of catalyzing the production of dihydroquercetin from caffeic acid.

[0059] Example 6: Preparation of Fermented Oil from 11 Seeds (1) The recombinant yeast prepared in Example 5 was inoculated into YPD medium for culture.

[0060] (2) The recombinant yeast seed liquid prepared in step (1) is transferred to the yeast fermentation medium at an inoculation rate of 1%. The yeast fermentation medium consists of 18 g / L rice, 20 g / L commercially available soybean extract, and 10 g / L glucose. The mixture is cultured at 30°C for 24 h to obtain the recombinant yeast pre-fermentation liquid.

[0061] (3) Add 2 g / L Sophora japonica extract (purchased from Shaanxi Guanchen Biotechnology) and 5 g / L caffeic acid to the yeast pre-fermentation broth obtained in step (2), and continue fermentation at 30℃ for 24 h.

[0062] (4) Inoculate Lactobacillus (CGMCC No. 24962) into Lactobacillus seed culture medium for cultivation. The Lactobacillus seed culture medium consists of: 7 g / L peptone, 5 g / L beef meal, 4 g / L yeast extract, 2 g / L glucose, 2 g / L dipotassium hydrogen phosphate, 4 g / L sodium acetate, 2 g / L triammonium citrate, and 0.2 g / L magnesium sulfate.

[0063] (5) The Lactobacillus seed liquid prepared in step (4) is transferred to the Lactobacillus fermentation medium at an inoculation rate of 1%. The Lactobacillus fermentation medium consists of: 18 g / L glucose, 20 g / L soybean extract, 10 g / L corn flour, and 20 g / L whey powder. The medium is cultured at 30°C for 8 h to obtain the Lactobacillus pre-fermentation liquid.

[0064] (6) Add 200% of the initial lactobacillus culture medium weight of 11 seed oil to the lactobacillus pre-fermentation broth obtained in step (5), and continue fermentation at 30°C for 6 h. The 11 seed oil is composed of 30wt% meadowfoam seed oil, 30wt% sunflower seed oil, 10wt% wheat germ oil, 5wt% borage seed oil, 5wt% European hazelnut seed oil, 5wt% plantain leaf artichoke seed oil, 5wt% macadamia seed oil, 5wt% jojoba seed oil, peony seed oil, 3wt% European blueberry seed oil and 2wt% perilla seed oil.

[0065] (7) Mix the yeast fermentation broth and lactobacillus fermentation broth obtained in steps (3) and (6) at a ratio of 2:1 and ferment them together at 25°C for 24 h.

[0066] (8) After fermentation, the fermentation product was removed from the cells using a ceramic membrane. The product was then centrifuged at 10,000 r / min for 10 min, and the upper oil phase was collected.

[0067] (9) The obtained oil phase was further dehydrated by rotary evaporation to obtain 11 seed fermented oil.

[0068] Example 7: Preparation of Fermentation Broth for 11 Seeds (1) Based on Example 6, the lower aqueous phase obtained by centrifugation in step (8) is collected, 1% activated carbon is added, and the mixture is stirred at 50°C for 2 h. The activated carbon is further removed by centrifugation, and the clear liquid is collected.

[0069] (2) The clear liquid obtained in step (1) is passed through a ceramic membrane to further remove bacteria and residues. The ceramic membrane has a pore size of 50 nm. The clear liquid obtained from the ceramic membrane is collected. (3) The clear liquid obtained in step (2) is further purified by ultrafiltration membrane. The ultrafiltration membrane used has a molecular weight cutoff of 5 kD, and the clear liquid is collected. (4) The clear liquid obtained in step (3) is purified by cation exchange resin and anion exchange resin respectively; (5) Adjust the pH of the purified liquid to 5.2 to obtain 11 seed fermentation liquid.

[0070] Test Example 1: Antioxidant Capacity Test of 11-Seed Fermented Oil and 11-Seed Fermented Broth - DPPH Free Radical Scavenging Experiment 1,1-Diphenyl-2-trinitrophenylhydrazine (DPPH) is a stable, long-lived free radical. Its ethanol solution is deep purple and exhibits strong absorption around 517 nm. In the presence of free radical scavengers, the DPPH ethanol solution absorbs less light by pairing with unaccepted electrons. The degree of fading of the DPPH ethanol solution is linearly related to the number of electrons it accepts, thus allowing evaluation of the sample's ability to scavenge free radicals, i.e., its antioxidant activity.

[0071] The DPPH free radical scavenging abilities of the fermented oil and crude oil of 11 seeds prepared in Example 6 were measured respectively, and the results are as follows: Figure 3 As shown, the DPPH free radical scavenging rate of fermented 11-seed oil was 94.5%, while that of crude 11-seed oil was only 18.1%, meaning the DPPH free radical scavenging capacity of fermented 11-seed oil was 5.2 times that of crude 11-seed oil. This indicates that fermented 11-seed oil has outstanding antioxidant capacity.

[0072] The DPPH antioxidant capacity of the fermentation broth of the 11 seeds obtained in Example 7 was determined, and the results are as follows: Figure 4 As shown, the DPPH free radical scavenging rate of the 11-seed fermentation broth was 28.5%, indicating that the 11-seed fermentation broth has DPPH free radical antioxidant capacity.

[0073] Test Example 2: Antioxidant Capacity Test of 11-Seed Fermented Oil and 11-Seed Fermented Broth - ABTS Free Radical Scavenging Experiment The ABTS radical scavenging test assesses the antioxidant activity of an antioxidant by measuring its ability to scavenge ABTS radicals. ABTS radicals are blue-green pigments with a maximum absorption wavelength of 734 nm. Their absorption intensity decreases in the presence of antioxidants, thus allowing evaluation of the test sample's ability to scavenge free radicals, i.e., the strength of its antioxidant activity.

[0074] The ABTS free radical scavenging abilities of the fermented oil and crude oil of 11 seeds prepared in Example 6 were determined respectively, and the results are as follows: Figure 5 As shown, the ABTS free radical scavenging rate of fermented oil from 11 seeds was 87.2%, while that of crude oil from 11 seeds was only 16.1%, meaning the ABTS free radical scavenging capacity of fermented oil from 11 seeds was 5.4 times that of crude oil from 11 seeds. This indicates that fermented oil from 11 seeds has outstanding antioxidant capacity.

[0075] The ABTS antioxidant capacity of the fermentation broth of the 11 seeds obtained in Example 7 was determined, and the results are as follows: Figure 4 As shown, the ABTS free radical scavenging rate of the 11-seed fermentation broth was 26.1%, indicating that the 11-seed fermentation broth has ABTS free radical antioxidant capacity.

[0076] Test Example 3: Antioxidant Capacity Test of 11-Seed Fermented Oil and 11-Seed Fermented Broth - Hydroxyl Radical Scavenging Experiment Hydroxyl radicals (·OH) are among the most reactive oxygen species in the body, capable of mediating numerous physiological changes and damaging biomolecules such as proteins, nucleic acids, and lipids, leading to impaired cell structure and function, and ultimately causing disease. In the test, H₂O₂ / Fe 2+ Hydroxyl radicals are generated via the Fenton reaction, and Fe... 2+ Oxidized to Fe 3+ This results in the red phenanthrene-Fe 2+ Oxidized to colorless o-phenanthroline-Fe 3+ , making o-phenanthroline-Fe 2+ The maximum absorption peak at 536 nm disappears. The change in absorbance at 530-540 nm can be measured by spectrophotometer. Based on this, the change in hydroxyl radical content can be calculated, and the hydroxyl radical scavenging rate or scavenging ability of the sample can be calculated.

[0077] The hydroxyl radical scavenging abilities of the fermented oil and crude oil of 11 seeds prepared in Example 6 were measured respectively, and the results are as follows: Figure 6 As shown, the hydroxyl radical scavenging rate of fermented 11-seed oil was 81.2%, while that of crude 11-seed oil was only 17.2%, meaning the hydroxyl radical scavenging capacity of fermented 11-seed oil was 4.7 times that of crude 11-seed oil. This indicates that fermented 11-seed oil has outstanding antioxidant capacity.

[0078] The antioxidant capacity of the hydroxyl radicals in the fermentation broth of the 11 seeds obtained in Example 7 was determined, and the results are as follows: Figure 4 As shown, the hydroxyl radical scavenging rate of the 11-seed fermentation broth was 21.1%, indicating that the 11-seed fermentation broth has hydroxyl radical antioxidant capacity.

[0079] Test Example 4: Antioxidant Capacity Test of 11-Seed Fermented Oil and 11-Seed Fermented Broth - Superoxide Anion Free Radical Scavenging Experiment Superoxide anion radicals are free radicals produced during the metabolism of organisms. They possess strong oxidizing power and can attack biomolecules such as lipids, proteins, and nucleic acids, causing damage to cell structure and function. Therefore, the ability to scavenge superoxide anion radicals is an important indicator for evaluating the performance of antioxidants. The assay method is the pyrogallol auto-oxidation method, which is simple to operate and has a sensitive reaction. Pyrogallol undergoes auto-oxidation under alkaline conditions to produce O2· - O2· - It can accelerate the autoxidation rate of pyrogallol, while simultaneously generating colored intermediates. The accumulation of these intermediates shows a good linear relationship with time, and the colored products exhibit strong light absorption at 325 nm. It also removes O2· - This can inhibit auto-oxidation reactions and prevent the accumulation of intermediate products, thereby achieving the purpose of clearing superoxide anions.

[0080] The superoxide anion radical scavenging abilities of the fermented oil and crude oil of 11 seeds prepared in Example 6 were determined respectively, and the results are as follows: Figure 7 As shown, the superoxide anion scavenging rate of the 11-seed fermented oil was 85.4%, while that of the 11-seed crude oil was only 17.7%, meaning the superoxide anion scavenging capacity of the 11-seed fermented oil was 4.8 times that of the 11-seed crude oil. This indicates that the 11-seed fermented oil has outstanding antioxidant capacity.

[0081] The superoxide anion free radical antioxidant capacity of the fermentation broth of the 11 seeds obtained in Example 7 was determined, and the results are as follows: Figure 4 As shown, the superoxide anion scavenging rate of the 11-seed fermentation broth was 23.4%, indicating that the 11-seed fermentation broth has superoxide anion antioxidant capacity.

[0082] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

Claims

1. A method for preparing an 11-seed oil fermentation product, characterized in that, The 11 seed oil fermentation products include fermented oil and / or fermentation liquid, and the preparation method includes the following steps: S1. Prepare recombinant brewing yeast fermentation broth, and then continue to ferment the recombinant brewing yeast fermentation broth in the presence of Sophora japonica extract and caffeic acid to obtain the first fermentation broth; Prepare a lactic acid bacteria fermentation broth, and then continue to ferment the lactic acid bacteria fermentation broth in the presence of 11 seed oil to obtain a second fermentation broth; S2. Mix the first fermentation broth and the second fermentation broth, and continue fermentation; After fermentation S3 and S2 are completed, the oil phase is collected to obtain the fermented oil; and / or, after fermentation S2 is completed, the aqueous phase is collected to obtain the fermented liquid; The recombinant Saccharomyces cerevisiae was obtained by modifying the Saccharomyces cerevisiae host strain. The modification included: overexpressing the gene encoding caffeic acid coenzyme A ligase 4CL, the gene encoding chalcone isomerase CHI, the gene encoding flavanone-3-hydroxylase F3H, and the gene encoding chalcone synthase CHS mutant. The chalcone synthase CHS mutant contains one or three of the following mutations relative to the amino acid sequence shown in SEQ ID NO. 1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine; The 11 seed oils contain one or more of the following: meadowfoam seed oil, sunflower seed oil, wheat germ oil, borage seed oil, European hazelnut seed oil, plantain leaf artichoke seed oil, macadamia seed oil, jojoba seed oil, peony seed oil, European blueberry seed oil, and perilla seed oil.

2. The preparation method according to claim 1, characterized in that, It must contain at least one of the following features (1) to (3): (1) The overexpression mode is either free expression or genome integration; (2) The amino acid sequence of caffeic acid coenzyme A ligase 4CL is shown in SEQ ID NO.2; the amino acid sequence of chalcone isomerase CHI is shown in SEQ ID NO.3; and the amino acid sequence of flavanone-3-hydroxylase F3H is shown in SEQ ID NO.

4. (3) The gene sequence encoding caffeic acid coenzyme A ligase 4CL is shown in SEQ ID NO.8; the gene sequence encoding chalcone isomerase CHI is shown in SEQ ID NO.10; The gene sequence encoding flavanone-3-hydroxylase F3H is shown in SEQ ID NO.

11.

3. The preparation method according to claim 1, characterized in that, It must contain at least one of the following features (1) to (6): (1) The preparation of recombinant brewing yeast fermentation broth includes the following steps: inoculating recombinant brewing yeast into a seed culture medium to prepare a seed liquid, and inoculating the seed liquid into a yeast fermentation culture medium to prepare the recombinant brewing yeast fermentation broth; wherein, the yeast fermentation culture medium contains rice, soybean extract and glucose; (2) The concentration of Sophora japonica extract is 1-5 g / L, and the concentration of caffeic acid is 2-20 g / L; (3) The lactic acid bacteria is lactic acid bacteria CGMCC No. 24962; (4) The preparation of lactic acid bacteria fermentation broth includes the following steps: inoculating lactic acid bacteria into a seed culture medium to prepare a seed liquid, and inoculating the seed liquid into a lactic acid bacteria fermentation culture medium to prepare the lactic acid bacteria fermentation broth; wherein, the lactic acid bacteria fermentation culture medium contains glucose, soybean extract, corn flour and whey powder; (5) The mass ratio of lactic acid bacteria fermentation broth to 11 seed oil is 1:(0.5-3); (6) When mixing the first fermentation broth and the second fermentation broth, the mass ratio of the first fermentation broth and the second fermentation broth is 1:(0.5-2).

4. The preparation method according to claim 3, characterized in that, It must contain at least one of the following features (1) to (2): (1) The yeast fermentation medium contains the following components: rice 10-30 g / L, soybean extract 10-30 g / L, glucose 5-20 g / L; (2) The lactic acid bacteria fermentation medium contains the following components: glucose 10-30 g / L, soybean extract 10-30 g / L, corn flour 5-20 g / L, whey powder 10-30 g / L.

5. The fermented seed oil product obtained by the preparation method according to any one of claims 1-4.

6. The application of the 11 seed oil fermentation product according to claim 5 in the preparation of daily chemical products.

7. A recombinant brewing yeast, characterized in that, The recombinant Saccharomyces cerevisiae was obtained by modifying the Saccharomyces cerevisiae host strain. The modification included: overexpressing the gene encoding caffeic acid coenzyme A ligase 4CL, the gene encoding chalcone isomerase CHI, and the gene encoding chalcone synthase CHS mutant. The chalcone synthase CHS mutant contains one or three of the following mutations relative to the amino acid sequence shown in SEQ ID NO. 1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine; Overexpression of the gene encoding flavanone-3-hydroxylase F3H.

8. The use of the recombinant brewer's yeast of claim 7 in the preparation of sagerol, 2R,3R-dihydroquercetin or daily chemical products.

9. A CHS mutant of chalcone synthase, characterized in that, The chalcone synthase CHS mutant contains one or three of the following mutations relative to the amino acid sequence shown in SEQ ID NO. 1: The tyrosine residue at position 69 is mutated to histidine; The histidine at position 71 is mutated to tyrosine; The glutamine at position 161 is mutated to lysine.

10. A nucleic acid encoding the CHS mutant of chalcone synthase according to claim 9, a gene expression cassette or recombinant plasmid carrying the gene encoding the CHS mutant of chalcone synthase according to claim 9, or a recombinant cell containing the CHS mutant of chalcone synthase according to claim 9.

Images