Sucrose isomerase mutants, methods and uses
By introducing K160M and K302Y mutations at specific sites of sucrose isomerase, the problems of low catalytic efficiency and poor thermal stability in existing technologies have been solved, enabling efficient, stable, and economical production of isomaltulose and improving industrial production efficiency and product quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN UNIV OF SCI & TECH
- Filing Date
- 2026-04-01
- Publication Date
- 2026-07-31
AI Technical Summary
Existing sucrose isomerases suffer from low catalytic efficiency, poor thermal stability, and insufficient conversion rate in industrial production, making it difficult to meet the demand for efficient, stable, and economical production of isomaltulose.
By mutating lysine (K) to methionine (M) at amino acid residue 160 and lysine (K) to tyrosine (Y) at amino acid residue 302 of wild-type sucrose isomerase, a K160M/K302Y double mutant was formed. Its nucleotide and amino acid sequences were optimized to adapt to the E. coli expression system. A recombinant expression vector was constructed and purified to obtain a sucrose isomerase mutant with high catalytic activity.
It significantly improves catalytic efficiency (by nearly 3 times), reduces Km value, and enhances thermal stability, resulting in shorter reaction time, higher conversion rate, and lower cost for the industrial production of isomaltulose, demonstrating excellent application performance.
Smart Images

Figure CN121950781B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of bioengineering and enzyme engineering technology, and in particular to a highly catalytically active sucrose isomerase mutant, method and application. Background Technology
[0002] Isomaltulose (also known as palatinose) is a naturally occurring reducing disaccharide composed of glucose and fructose linked by α-1,6-glycosidic bonds. Isomaltulose possesses excellent properties such as moderate sweetness (approximately 45-50% of sucrose), a pure taste, non-cariogenicity, and a low glycemic index (GI value of only 32), making it promising for applications in the food, pharmaceutical, and health product industries. With increasing global health awareness and the rapid growth of the functional sugar market, isomaltulose has attracted significant attention as a novel healthy sugar source, leading to continuously expanding market demand.
[0003] The industrial production of isomaltulose primarily relies on the biocatalytic conversion by sucrose isomerase (SI, EC5.4.99.11). Sucrose isomerase catalyzes the isomerization of the glycosidic bond between glucose and fructose within the sucrose molecule, converting the α-1,2-glycosidic bond to an α-1,6-glycosidic bond, thereby generating isomaltulose. This enzymatic conversion process offers advantages such as mild reaction conditions, high specificity, few byproducts, and environmental friendliness, making it the mainstream technological route for isomaltulose production.
[0004] Sucrose isomerases are widely distributed in a variety of microorganisms, including Erwinia ( ). Erwinia Pantotheca ( ) Pantoea ), Pseudomonas spp. Pseudomonas Agrobacterium ( ) Agrobacterium Among these, sucrose isomerases derived from Erwinia rhapontici were the first to be discovered and commercially applied, but their catalytic activity is relatively low and the reaction time is long, limiting further improvements in production efficiency. P. dispersa Sucrose isomerases have attracted widespread attention due to their high catalytic activity and good stability, but the following key issues still exist in their industrial applications: (1) Catalytic efficiency needs to be improved Catalytic efficiency of wild-type sucrose isomerase ( k cat / K m ) Usually 5-10 mL·mg -1 ·min -1 Within a certain range. Catalytic efficiency is the core indicator for measuring enzyme catalytic performance; it comprehensively reflects the enzyme's conversion number (C₂C₃). k cat) and affinity for the substrate ( K m (The reciprocal of the original). Lower catalytic efficiency means that the enzyme's ability to convert substrates per unit time is limited. Under the high substrate concentration (400-800 g / L) conditions of industrial production, the enzyme's catalytic conversion rate becomes the rate-limiting step of the reaction, resulting in long reaction times (usually 18-24 hours), long production cycles, low equipment utilization, and limiting the economic benefits of industrial production. Especially in the later stages of the reaction when the substrate concentration decreases, K m Wild-type enzymes with higher catalytic activity have insufficient affinity for the substrate, resulting in a further decrease in catalytic efficiency and affecting the final conversion rate of isomaltulose.
[0005] (2) Insufficient thermal stability Industrial production typically takes place at relatively high temperatures (45-55℃) to increase reaction rates, reduce the risk of microbial contamination, and minimize viscosity issues. However, the optimal reaction temperature for wild-type sucrose isomerase is usually 30-35℃. At temperatures above 50℃, enzyme activity declines rapidly, and its thermal stability is poor, necessitating multiple additions of enzyme preparation during production (usually 2-3 times), which increases production costs and operational complexity.
[0006] (3) The industrial conversion rate needs to be improved. Wild-type sucrose isomerase typically achieves an isomaltulose conversion rate of 85-93% under optimal conditions. However, under industrial conditions (high substrate concentration, high temperature, and long reaction time), the conversion rate often drops to 80-88%, and the proportion of byproducts (such as trehalose) increases, affecting product purity and yield.
[0007] To address the aforementioned issues, scholars both domestically and internationally have conducted extensive research on the molecular modification of sucrose isomerases, with the main strategies including: Site-directed mutagenesis: This involves modifying key amino acids at the enzyme's active site or substrate binding site to improve its catalytic performance. For example, some studies have reported improvements through mutation... Erwinia rhapontici The source of sucrose isomerase N242 site increases the enzyme’s thermostability by 8-12%, but the improvement in catalytic efficiency is limited (<15%).
[0008] Rational design: Based on the three-dimensional structure and catalytic mechanism of enzymes, specific combinations of mutations are designed. However, the catalytic mechanism of sucrose isomerases is complex, involving the synergistic effects of multiple domains, and purely rational design often fails to predict the actual effects of mutations.
[0009] Random mutagenesis and directed evolution: Mutant libraries are constructed using techniques such as error-prone PCR and DNA shuffling, and high-throughput screening is used to obtain mutants with improved performance. This method does not rely on structural information, but the screening workload is large, and random mutagenesis is often accompanied by the accumulation of harmful mutations.
[0010] Semi-rational design: Combining sequence analysis, structure alignment, and saturation mutagenesis techniques to systematically mutate and screen predicted key sites is currently the mainstream strategy for enzyme molecule modification. This method reduces the amount of screening work and increases the probability of obtaining superior mutants.
[0011] Despite the progress made in the aforementioned research, the overall improvements in catalytic efficiency, thermal stability, and industrial conversion rate reported by sucrose isomerase mutants remain limited, failing to meet the demands of industrial production for highly efficient, stable, and economical enzyme formulations. Particularly in terms of catalytic efficiency improvement, existing technologies struggle to achieve breakthroughs exceeding a two-fold increase. Therefore, developing sucrose isomerase mutants with high catalytic activity, high catalytic efficiency, and good thermal stability is crucial for advancing technological progress and reducing costs in the industrial production of isomaltulose. Summary of the Invention
[0012] The purpose of this invention is to overcome the shortcomings of the prior art and provide a highly catalytically active sucrose isomerase mutant, method, and application.
[0013] The technical solution adopted by this invention to solve its technical problem is: A highly catalytically active sucrose isomerase mutant, wherein the mutant is formed by mutating lysine (K) to methionine (M) at amino acid residue 160 of the wild-type sucrose isomerase and lysine (K) to tyrosine (Y) at amino acid residue 302. The nucleotide sequence of the mutant is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.
[0014] Furthermore, the mutant has the following characteristics: (a) The specific enzyme activity is 630-670 U / mg, preferably 651.9 U / mg, which is 20-26% higher than that of wild-type sucrose isomerase (specific enzyme activity 533.9 U / mg), preferably 22.9% higher; (b) Catalytic efficiency, i.e. k cat / K m 21-26 mL·mg -1 ·min -1 Preferably 23.5 mL·mg -1 ·min -1 Compared to wild-type sucrose isomerase (catalytic efficiency 6.0 mL·mg), -1 ·min -1 The improvement is 280-320%, and the optimal improvement is 292%. (c)K m The value is 17-22 mg / mL, preferably 19.3 mg / mL, compared to wild-type sucrose isomerase (…). K m The value (49.8 mg / mL) decreased by 55-65%, with an optimal decrease of 61.2%, indicating that the mutant had a significantly enhanced affinity for the substrate; (d) k cat The value is 430-475 min. -1 The preferred value is 453.6 min. -1 Compared to wild-type sucrose isomerase ( k cat Value 298.8 min -1 The improvement was 48-55%, with a further improvement of 51.8% for the best-quality products. (e) The optimal reaction temperature is 34-36°C, preferably 35°C, which is 4-6°C higher than that of wild-type sucrose isomerase (optimal temperature 30°C), preferably 5°C higher; (f) After incubation at 50°C for 30 min, the residual enzyme activity is 45-53%, preferably 49%, which is 15-25% higher than that of wild-type sucrose isomerase (residual enzyme activity 29%), preferably 20% higher; Alternatively, the wild-type sucrose isomerase is derived from... Pantoea dispersa .
[0015] The application of the mutants described above in the preparation of isomaltulose.
[0016] The method for preparing the mutant as described above includes the following steps: (1) Gene design and synthesis: based on P. dispersa The amino acid sequence of wild-type sucrose isomerase was used to optimize the codons to adapt to the codon preference of the E. coli expression system. Mutant genes were designed with the 160th amino acid residue mutated from lysine (K) to methionine (M) and the 302nd amino acid residue mutated from lysine (K) to tyrosine (Y). The full-length sequence of the mutant gene was obtained by chemical total synthesis. (2) The synthesized mutant gene was cloned into the expression vector pET28 to construct the recombinant expression vector pET28-K160M / K302Y; (3) The recombinant expression vector was transformed into Escherichia coli host cells, and the recombinant bacteria were obtained after DNA sequencing verification. (4) Inoculate the recombinant bacteria into LB liquid medium containing 50 μg / mL kanamycin and culture at 37℃ and 220 r / min for 12-16 h with shaking. (5) Transfer to fermentation medium at an inoculum rate of 1-3%, and culture at 37°C with shaking at 220 r / min until OD. 600 The concentration was 0.6-0.8, and galactose was added to a final concentration of 0.5-2% to induce expression for 16-24 h. (6) Collect bacterial cells, sonicate to disrupt them, centrifuge to obtain the supernatant, and purify by nickel column affinity chromatography to obtain the mutant.
[0017] Furthermore, in step (1), the codon optimization is performed according to the E. coli codon usage frequency table, and the codon fitness index (CAI) of the optimized gene is ≥0.85.
[0018] Furthermore, in step (3), the host cell for Escherichia coli is BL21(DE3), Rosetta(DE3), or Origami(DE3).
[0019] Furthermore, the fermentation medium is LB liquid medium containing 50 μg / mL kanamycin.
[0020] A recombinant bacterium containing the mutant described above.
[0021] The method for preparing isomaltulose using the mutant described above includes the following steps: (1) Prepare a sucrose substrate solution with a sucrose concentration of 400-800 g / L and a pH of 5.5-6.5; (2) Add the mutant, with an enzyme dosage of 5-10 U / g substrate; (3) React at 35-55℃ for 6-12 h; (4) After the reaction is complete, the enzyme is inactivated to obtain the isomaltulose product.
[0022] Furthermore, the specific conditions of the method are as follows: (1) With a sucrose concentration of 400 g / L, pH 6.0-6.5, enzyme dosage of 6-8 U / g substrate, and reaction at 35℃ for 8-10 h, the isomaltulose conversion rate reached 92-96%; Or: (2) With a sucrose concentration of 800 g / L, pH 6.0-6.5, enzyme dosage of 8-10 U / g substrate, and reaction at 50℃ for 10-12 h, the isomaltulose conversion rate reached 90-96%.
[0023] The advantages and positive effects of this invention are as follows: 1. The mutant of this invention introduces double mutations of K160M and K302Y at amino acid residues 160 and 302 through directed evolution technology, resulting in a sucrose isomerase mutant with double mutations of K160M and K302Y, which significantly improves catalytic efficiency (by nearly 3 times) and reduces... K m It reduces the value (by 61%) and improves thermal stability, exhibiting excellent catalytic performance in the industrial production of isomaltulose, which can shorten reaction time, increase conversion rate, and reduce production costs.
[0024] 2. The highly catalytically active sucrose isomerase mutant K160M / K302Y obtained by the present invention through directed evolution technology has achieved significant improvements in catalytic efficiency, thermal stability, and industrial application performance. It can effectively solve the problems of low catalytic activity, long reaction time, poor high-temperature stability, and high production cost of wild-type sucrose isomerase in the existing technology, which is of great significance for promoting the technological progress and industrial upgrading of isomaltulose industrial production.
[0025] 3. Compared with the wild type, this mutant showed a 22.9% increase in specific enzyme activity and a higher catalytic efficiency. k cat / K m Increased by 292%, K m The enzyme activity was reduced by 61.2%, the optimal temperature increased by 5℃, and the residual enzyme activity increased by 20% after incubation at 50℃ for 30 min. In the industrial production of isomaltulose, this mutant achieved a conversion rate of 95.0% after 10 h of reaction at 400 g / L sucrose and 35℃, which is 58% shorter than the wild type. At 800 g / L sucrose and 50℃ for 12 h of reaction, the conversion rate reached 94.3% without the need for enzyme supplementation, representing an 8.6% increase in conversion rate and a 67% reduction in total enzyme consumption compared to the wild type, significantly improving production efficiency and economic benefits. This mutant provides an excellent biocatalyst for the efficient and green production of isomaltulose.
[0026] 4. The catalytic efficiency of the mutant of this invention is significantly improved: The catalytic efficiency of the mutant K160M / K302Y of this invention ( k cat / K m ) Reached 23.5 mL·mg -1 ·min -1 Compared to wild-type sucrose isomerase (6.0 mL·mg) -1 ·min -1This represents a 292% improvement, nearly three times the previous level. This is one of the mutants with the largest reported increase in catalytic efficiency for sucrose isomerase in the literature, significantly outperforming mutants obtained through single-point mutations or rational design in existing technologies (which typically show an improvement of <50%). High catalytic efficiency means faster reaction rates, shorter production cycles, higher equipment utilization, and significantly improved production efficiency under the same enzyme dosage.
[0027] The significant improvement in catalytic efficiency is mainly attributed to two improvements: First k cat The value increased by 51.8%, indicating a significant increase in the transformation number of the mutant, resulting in more substrate molecules being transformed per unit time; secondly, K m The value decreased by 61.2%, indicating a significant improvement in the mutant's affinity for the substrate, maintaining high catalytic activity even at lower substrate concentrations. This synergistic improvement in both aspects resulted in a nearly three-fold increase in catalytic efficiency.
[0028] 5. The specific enzyme activity of the mutant of this invention is increased. The specific enzyme activity of the mutant of this invention is 651.9 U / mg, which is 22.9% higher than that of the wild type (533.9 U / mg). The increase in specific enzyme activity indicates that the mutant has a stronger catalytic ability per unit mass of enzyme protein, and requires less enzyme protein under the same yield conditions, thereby reducing the production and usage costs of enzyme preparations.
[0029] 6. The thermal stability of the mutant of this invention is significantly improved. The optimal reaction temperature for the mutant of this invention is 35°C, which is 5°C higher than that of the wild type (30°C). After incubation at 50°C for 30 minutes, the residual enzyme activity of the mutant is 49%, while that of the wild type is only 29%, representing a 20% increase. This improved thermal stability allows the mutant to operate stably at higher temperatures (50°C) for extended periods, enabling a single reaction to be completed without the need for intermediate enzyme replenishment, simplifying production operations and reducing production costs. In contrast, the wild type requires the addition of 6 U / g of substrate enzyme every 4-6 hours at 50°C, totaling 2-3 additions, which is complex and costly.
[0030] 7. The mutant of this invention exhibits excellent performance in industrial applications. Under industrial conditions (high substrate concentration of 400-800 g / L, high temperature of 50℃, pH 6.0-6.5), the mutant of this invention exhibits excellent application performance: At 400 g / L sucrose and 35℃, the mutant can achieve a conversion rate of 92-96% in 8-10 h, while the wild type requires 24 h at 30℃ to achieve a conversion rate of 90-92%, shortening the reaction time by 58% and significantly improving production efficiency. Under conditions of 800 g / L sucrose and 50℃, the mutant reaction can achieve a conversion rate of 90-96% in 10-12 h without the need for enzyme supplementation, while the wild type requires multiple enzyme supplementation under the same conditions (6 U / g substrate every 4-6 h, for a total of 2-3 times), with a final conversion rate of only 84-86%. The conversion rate is increased by 11.2%, and the operation complexity and enzyme cost are significantly reduced. The mutant maintained a high isomaltulose conversion rate of 95.6% at 50℃, while the wild type's conversion rate dropped to 84.4% at the same temperature, fully demonstrating the superior catalytic performance and stability of the mutant under high temperature conditions. Attached Figure Description
[0031] Figure 1 These are the physical and restriction maps of the recombinant expression plasmid of this invention; wherein, A: physical map of the recombinant expression plasmid pET28-K160M / K302Y; B: lane M: DNA molecular weight standard (1 kb ladder ruler), lane 1: synthesized mutant gene; C: lane M: DNA molecular weight standard (1 kb ladder ruler), lane 2: recombinant expression plasmid pET28-K160M / K302Y after... Bam After HI enzyme digestion; Figure 2 This is an SDS-PAGE electrophoresis pattern of the purified sucrose isomerase mutant K160M / K302Y in this invention; where M is the protein molecular weight reference and I is the purified sucrose isomerase mutant K160M / K302Y.
[0032] Figure 3 This diagram shows the optimal pH and pH stability of the sucrose isomerase mutant in this invention; where A: optimal pH; B: pH stability. Figure 4 The figure shows the application evaluation results of the sucrose isomerase mutant of the present invention catalyzing the synthesis of isomaltulose from sucrose under different substrate concentrations and temperatures. Detailed Implementation
[0033] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0034] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0035] In a first aspect, a highly catalytically active sucrose isomerase mutant, wherein the mutant is formed by mutating lysine (K) to methionine (M) at amino acid residue 160 of the wild-type sucrose isomerase and tyrosine (Y) at amino acid residue 302. The nucleotide sequence of the mutant is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.
[0036] Furthermore, the mutant has the following characteristics: (a) The specific enzyme activity is 630-670 U / mg, preferably 651.9 U / mg, which is 20-26% higher than that of wild-type sucrose isomerase (specific enzyme activity 533.9 U / mg), preferably 22.9% higher; (b) Catalytic efficiency, i.e. k cat / K m 21-26 mL·mg -1 ·min -1 Preferably 23.5 mL·mg -1 ·min -1 Compared to wild-type sucrose isomerase (catalytic efficiency 6.0 mL·mg), -1 ·min -1 The improvement is 280-320%, and the optimal improvement is 292%. (c) K m The value is 17-22 mg / mL, preferably 19.3 mg / mL, compared to wild-type sucrose isomerase (…). K m The value (49.8 mg / mL) decreased by 55-65%, with an optimal decrease of 61.2%, indicating that the mutant had a significantly enhanced affinity for the substrate; (d) k cat The value is 430-475 min. -1 The preferred value is 453.6 min. -1 Compared to wild-type sucrose isomerase ( k cat Value 298.8 min -1 The improvement was 48-55%, with a further improvement of 51.8% for the best-quality products. (e) The optimal reaction temperature is 34-36°C, preferably 35°C, which is 4-6°C higher than that of wild-type sucrose isomerase (optimal temperature 30°C), preferably 5°C higher; (f) After incubation at 50°C for 30 min, the residual enzyme activity is 45-53%, preferably 49%, which is 15-25% higher than that of wild-type sucrose isomerase (residual enzyme activity 29%), preferably 20% higher; Alternatively, the wild-type sucrose isomerase is derived from... Pantoea dispersa .
[0037] The application of the mutants described above in the preparation of isomaltulose.
[0038] The method for preparing the mutant as described above includes the following steps: (1) Gene design and synthesis: based on P. dispersa The amino acid sequence of wild-type sucrose isomerase was used to optimize the codons to adapt to the codon preference of the E. coli expression system. Mutant genes were designed with the 160th amino acid residue mutated from lysine (K) to methionine (M) and the 302nd amino acid residue mutated from lysine (K) to tyrosine (Y). The full-length sequence of the mutant gene was obtained by chemical total synthesis. (2) The synthesized mutant gene was cloned into the expression vector pET28 to construct the recombinant expression vector pET28-K160M / K302Y; (3) The recombinant expression vector was transformed into Escherichia coli host cells, and the recombinant bacteria were obtained after DNA sequencing verification. (4) Inoculate the recombinant bacteria into LB liquid medium containing 50 μg / mL kanamycin and culture at 37℃ and 220 r / min for 12-16 h with shaking. (5) Transfer to fermentation medium at an inoculum rate of 1-3%, and culture at 37°C with shaking at 220 r / min until OD. 600 The concentration was 0.6-0.8, and galactose was added to a final concentration of 0.5-2% to induce expression for 16-24 h. (6) Collect bacterial cells, sonicate to disrupt them, centrifuge to obtain the supernatant, and purify by nickel column affinity chromatography to obtain the mutant.
[0039] Furthermore, in step (1), the codon optimization is performed according to the E. coli codon usage frequency table, and the codon fitness index (CAI) of the optimized gene is ≥0.85.
[0040] Furthermore, in step (3), the host cell for Escherichia coli is BL21(DE3), Rosetta(DE3), or Origami(DE3).
[0041] Furthermore, the fermentation medium is LB liquid medium containing 50 μg / mL kanamycin.
[0042] A recombinant bacterium containing the mutant described above.
[0043] The method for preparing isomaltulose using the mutant described above includes the following steps: (1) Prepare a sucrose substrate solution with a sucrose concentration of 400-800 g / L and a pH of 5.5-6.5; (2) Add the mutant, with an enzyme dosage of 5-10 U / g substrate; (3) React at 35-55℃ for 6-12 h; (4) After the reaction is complete, the enzyme is inactivated to obtain the isomaltulose product.
[0044] Furthermore, the specific conditions of the method are as follows: (1) With a sucrose concentration of 400 g / L, pH 6.0-6.5, enzyme dosage of 6-8 U / g substrate, and reaction at 35℃ for 8-10 h, the isomaltulose conversion rate reached 92-96%; Or: (2) With a sucrose concentration of 800 g / L, pH 6.0-6.5, enzyme dosage of 8-10 U / g substrate, and reaction at 50℃ for 10-12 h, the isomaltulose conversion rate reached 90-96%.
[0045] Secondly, the present invention provides a method for preparing the above-mentioned highly catalytically active sucrose isomerase mutant, comprising the following steps: (1) Gene design and synthesis: based on Pantoea dispersa The amino acid sequence of wild-type sucrose isomerase was used to optimize the codons to suit the codon preferences of the E. coli expression system. Mutant genes were designed with lysine (K) mutated to methionine (M) at amino acid residue 160 and tyrosine (Y) mutated to amino acid residue 302. The full-length sequence of the mutant gene (approximately 1.7 kb) was obtained by total chemical synthesis. The codon optimization was preferably performed according to the E. coli codon usage frequency table, and the codon fitness index (CAI) of the optimized gene was ≥0.85. (2) The synthesized mutant gene was used... Bam HI and Hind After double digestion with enzyme III, the cloned expression vector pET-28a(+) was cloned into the expression vector pET-28a(+) that had undergone the same enzyme digestion treatment, and the recombinant expression vector pET28-K160M / K302Y was constructed. (3) Transform the recombinant expression vector into Escherichia coli host cells (preferably BL21(DE3), Rosetta(DE3) or Origami(DE3)), spread them on LB solid medium containing 50 μg / mL kanamycin, incubate overnight at 37°C, pick single colonies to extract plasmids and send them for sequencing verification, and obtain recombinant bacteria after confirming that the mutation site is correct. (4) The recombinant bacteria were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37℃ and 220 r / min for 12-16 h with shaking. (5) Transfer the inoculum to the fermentation medium at a rate of 1-3%, and incubate at 37°C with shaking at 220 r / min until the OD reaches 100%. 600 The concentration was 0.6-0.8, and galactose was added to a final concentration of 0.5-2% (preferably 1%). Expression was induced at 15-20℃ for 16-24 h. (6) Collect bacterial cells and resuspend them in lysis buffer (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 10 mM imidazole). Sonicate the cells in an ice bath (300 W power, 3 s working time, 5 s interval, total time 15 min). Centrifuge at 12000 r / min for 30 min and collect the supernatant. Purify the supernatant by nickel column affinity chromatography (elute with elution buffer containing 250 mM imidazole). Dialyze to remove salts to obtain the mutant.
[0046] Thirdly, the present invention provides a recombinant bacterium containing the above-mentioned recombinant expression vector pET28-K160M / K302Y.
[0047] Fourthly, the present invention provides the application of the above-mentioned highly catalytically active sucrose isomerase mutant or recombinant bacteria in the preparation of isomaltulose.
[0048] Fifthly, the present invention provides a method for preparing isomaltulose using the above-mentioned mutant, comprising the following steps: (1) Prepare a sucrose substrate solution with a sucrose concentration of 400-800 g / L, preferably 400 g / L or 800 g / L, and adjust the pH to 5.5-6.5 with citrate-sodium citrate buffer or phosphate buffer, preferably pH 6.0-6.5; (2) Add the highly catalytically active sucrose isomerase mutant of the present invention, with an enzyme addition amount of 5-10 U / g substrate, preferably 6-8 U / g substrate (medium substrate concentration) or 8-10 U / g substrate (high substrate concentration). (3) React at 35-55℃ for 6-12 h, preferably at 35℃ for 8-10 h or at 50℃ for 10-12 h; (4) After the reaction is complete, boil the product in a water bath for 10 min or adjust the pH to above 10 to inactivate the enzyme. After cooling, perform decolorization, desalting and other post-treatment steps to obtain the isomaltulose product.
[0049] Preferably, the specific conditions of the preparation method are as follows: Condition 1 (medium substrate concentration, optimal temperature): sucrose concentration 400 g / L, pH 6.0-6.5, enzyme dosage 6-8 U / g substrate, reaction at 35℃ for 8-10 h, isomaltulose conversion rate reaches 92-96%, preferably above 95.0%; Condition 2 (high substrate concentration, high temperature): sucrose concentration 800 g / L, pH 6.0-6.5, enzyme dosage 8-10 U / g substrate, reaction at 50℃ for 10-12 h, isomaltulose conversion rate reaches 90-96%, preferably above 94%.
[0050] Specifically, the relevant preparation and testing methods are as follows: Example 1: Design and synthesis of sucrose isomerase mutant gene 1.1 Codon optimization and chemical synthesis of mutant genes according to Pantoea dispersa The amino acid sequence of the wild-type sucrose isomerase (GenBank accession number: AAP57083) was used as a basis. Based on the mature peptide with the signal peptide consisting of the N-terminal 21 amino acid residues removed, and referring to the *E. coli* codon usage frequency table (http: / / www.kazusa.or.jp / codon / ), codon optimization was performed on the encoding gene to remove rare codons, avoid mRNA secondary structure formation, and improve gene expression efficiency in *E. coli*. Simultaneously, the 160th amino acid residue was mutated from lysine (K, codon AAA) to methionine (M, codon ATG), and the 302nd amino acid residue was mutated from lysine (K, codon AAA) to tyrosine (Y, codon TAC). The optimized gene had a codon fitness index (CAI) of 0.89 and a GC content adjusted to 50-55%. The optimized mutant gene sequence is shown in SEQ ID No. 1, and its amino acid sequence is shown in SEQ ID No. 2.
[0051] The optimized mutant gene sequence (approximately 1.7 kb in length) was synthesized by a biotechnology company (Sangon Biotech (Shanghai) Co., Ltd.) using a total chemical synthesis method. Simultaneously, the synthesized gene was introduced at both ends of the gene. Bam HI and Hind III. Restriction endonuclease recognition sites to facilitate subsequent cloning.
[0052] 1.2 Construction of recombinant expression plasmids The synthesized mutant gene was used Bam HI and Hind III. Double digestion (37℃ for 2 h), and simultaneously double digestion of the expression vector pET-28a(+) with the same enzyme. After separation of the digestion products by 1% agarose gel electrophoresis, the target fragment and linearized vector were recovered separately by gel excision.
[0053] The recovered mutant gene fragment was mixed with the linearized pET-28a(+) vector obtained above at a molar ratio of 3:1, and T4 DNA ligase was added. Ligation was carried out overnight at 16°C. The ligation product was transformed into *E. coli* DH5α competent cells using the heat shock transformation method (*Industrial Microbiology Experimental Technology Manual*, edited by Zhuge Jian and Wang Zhengxiang, 1994), plated on LB agar containing 50 μg / mL kanamycin, and incubated overnight at 37°C. Single colonies were picked for colony PCR identification. Positive clones were cultured in shake flasks, and plasmids were extracted and used... Bam HI digestion and restriction mapping yielded a 7.05 kb fragment, which perfectly matched the expected result, indicating successful construction of the recombinant expression plasmid pET28-K160M / K302Y (e.g., ...). Figure 1 (As shown).
[0054] 1.3 Construction and Validation of Recombinant Bacteria The correct recombinant expression plasmid pET28-K160M / K302Y was transformed into Escherichia coli BL21(DE3) competent cells using the heat shock transformation method. The cells were plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Single colonies were picked to obtain the recombinant expression strain BL21(DE3) / pET28-K160M / K302Y. The recombinant expression plasmid was extracted and identified by restriction mapping. The cells were then stored in glycerol tubes at -80°C for later use.
[0055] 1.4 Gene synthesis and construction of single mutants and wild-types (comparative example) Using the same method, wild-type sucrose isomerase gene (codon optimized, no mutation), single mutant K160M gene (containing only K160M mutation) and single mutant K302Y gene (containing only K302Y mutation) were synthesized respectively. Recombinant expression vectors pET28-WT, pET28-K160M and pET28-K302Y were constructed and transformed into Escherichia coli BL21(DE3) for subsequent comparative studies.
[0056] Example 2: Expression and purification of mutants 2.1 Seed Culture A single colony of recombinant bacteria BL21(DE3) / pET28-K160M / K302Y was picked from a glycerol tube at -80℃ and inoculated into 50 mL of LB liquid medium containing 50 μg / mL kanamycin. The culture was then incubated at 37℃ and 220 r / min for 12-14 h with shaking to obtain the seed culture.
[0057] 2.2 Induced expression of recombinase The seed culture was transferred to 500 mL of LB liquid medium containing 50 μg / mL kanamycin at a 2% inoculation rate, and cultured at 37°C with shaking at 220 r / min until OD was reached. 600 Once the concentration reaches 0.6-0.8, add galactose to a final mass concentration of 1%, and induce expression at 18℃ and 220r / min for 20 h.
[0058] 2.3 Preparation and purification of enzyme proteins Collect bacterial cells and centrifuge at 5000 r / min for 10 min at 4℃, discarding the supernatant. Resuspend the bacterial cells in lysis buffer (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 10 mM imidazole) (at a ratio of 1 g bacterial cells to 5 mL buffer), and sonicate on ice (300 W, 3 s on, 5 s off, total 15 min). Centrifuge the lysate at 12000 r / min for 30 min, filter the supernatant through a 0.45 μm filter membrane, and load it onto a Ni-NTA affinity chromatography column pre-equilibrated with lysis buffer. Wash sequentially with wash buffers containing 20 mM, 50 mM, and 100 mM imidazole, and elute the target protein with elution buffer containing 250 mM imidazole. Collect the elution peak, dialyze to buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl) to remove imidazole, concentrate, aliquot, and store at -80℃ for later use. The purified mutant enzyme protein was analyzed by 10% SDS-PAGE electrophoresis. After Coomassie brilliant blue staining, a single band appeared at approximately 62 kDa. Figure 2 The molecular weight was consistent with that of sucrose isomerase, indicating that the target protein was successfully expressed and had good purity (>95%). Protein concentration was determined using the Bradford method, with bovine serum albumin (BSA) as the standard to plot a standard curve [Kielkopf CL, Bauer W, Urbatsch IL. Bradford Assay for Determining Protein Concentration. Cold Spring Harb Protoc. 2020 Apr 1;2020(4):102269. doi:10.1101 / pdb.prot102269. PMID: 32238597.].
[0059] 2.4 Expression and purification of wild-type and single mutants Wild-type sucrose isomerase, single mutants K160M and K302Y were expressed and purified using the same method for subsequent comparative studies.
[0060] Example 3: Characterization of the enzymatic properties of mutants 3.1 Enzyme activity assay method Activity assay of sucrose isomerase and its mutants: 0.1 mL of diluted enzyme solution (0.1–1 U / mL) was added to 5 mL of a reaction system containing 100 g / L sucrose (50 mM potassium phosphate buffer, pH 6.0). The reaction was carried out at 30°C for 10 min, and then terminated by boiling in a water bath for 10 min. The reaction solution was diluted and the amount of isomaltulose produced was detected by high-performance liquid chromatography (HPLC). HPLC conditions: Aminex HPX-87C column, ultrapure water as the mobile phase, flow rate 0.6 mL / min, column temperature 85°C, and differential refractive index detector. Definition of enzyme activity unit: Under the above conditions, the amount of enzyme required to catalyze the production of 1 μmol of isomaltulose per minute is defined as 1 enzyme activity unit (U).
[0061] 3.2 Enzyme activity assay The enzyme activities of wild-type sucrose isomerase, single mutant K160M, K302Y and double mutant K160M / K302Y prepared in Example 2 were determined according to the above method, and the specific enzyme activity (U / mg protein) was calculated in combination with the protein concentration. The results are shown in Table 1.
[0062] Table 1 Comparison of specific enzyme activities of sucrose isomerase mutants
[0063] The results showed that the specific enzyme activities of the single mutants K160M and K302Y increased by 8.0% and 11.9%, respectively, while the specific enzyme activity of the double mutant K160M / K302Y increased by 22.9%, which was significantly higher than the simple sum of the two single mutants (19.9%), indicating that there is a positive synergistic effect between the two mutation sites K160M and K302Y.
[0064] 3.3 Determination of kinetic parameters The kinetic parameters of the wild-type sucrose isomerase and the double mutant K160M / K302Y prepared in Example 2 were determined using the Lineweaver-Burk double reciprocal plot method. Using different concentrations of sucrose (10-200 g / L) as substrates, the initial rates were measured under optimal conditions (wild-type 30℃, mutant 35℃, pH 6.0), and double reciprocal curves of 1 / v versus 1 / [S] were plotted to calculate... K m Value and V max value. k cat The value is based on the formula k cat = V max / [E] is calculated, where [E] is the enzyme concentration. Catalytic efficiency k cat / K m Depend on k cat and K m The calculations were performed. The results are shown in Table 2.
[0065] Table 2 Comparison of kinetic parameters of sucrose isomerase mutants
[0066] The results showed that the mutant K160M / K302Y K m The value was 19.3 mg / mL, which was 61.2% lower than that of the wild type (49.8 mg / mL), indicating that the mutant had a significantly enhanced affinity for the substrate; k cat The value is 453.6 min -1 Compared to the wild type (298.8 min) -1 The 51.8% increase indicates a significant improvement in the transformation number of the mutant; catalytic efficiency... k cat / K m Reaching 23.5 mL·mg -1 ·min -1 Compared to the wild type (6.0 mL·mg) -1 ·min -1 The improvement was 292%, achieving a breakthrough improvement of nearly 3 times, which fully demonstrates the significant effect of double mutation on enzyme catalytic performance.
[0067] 3.4 Determination of Optimal Temperature Diluted enzyme solutions with enzyme activity of 2-16 U / mL were taken and reacted at 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, and 55℃ for 10 min under pH 6.0 and 100 g / L sucrose conditions. The enzyme activity was measured, and the relative enzyme activity was calculated with the highest enzyme activity as 100%. The results are shown in Table 3.
[0068] Table 3 Comparison of optimal temperatures for sucrose isomerase mutants
[0069] The results showed that the optimal temperature of the single mutant K160M, K302Y and double mutant K160M / K302Y prepared in Example 2 was 35℃, which was 5℃ higher than that of the wild type (30℃), indicating that the mutation effectively improved the optimal temperature of the enzyme.
[0070] 3.5 Thermal stability determination Diluted enzyme solutions with an activity of 16-32 U / mL were incubated at 30℃, 35℃, 40℃, and 50℃, with samples taken every 30 minutes to determine residual enzyme activity. Relative enzyme activity was calculated with the activity of the unincubated enzyme solution as 100%. Particular attention was paid to the residual enzyme activity after incubation at 50℃ for 30 minutes. The results are shown in Table 4.
[0071] Table 4 Comparison of thermal stability of sucrose isomerase mutants
[0072] The results showed that after incubation at 50℃ for 30 min, the residual enzyme activity of the wild-type was only 29%, while that of the double mutant K160M / K302Y was 49%, an increase of 20% compared to the wild-type. This was significantly higher than the effects of the single mutants K160M (9% increase) and K302Y (13% increase), further demonstrating the synergistic effect of the double mutant. The thermostability of the mutant at 35℃ and 40℃ was also significantly better than that of the wild-type, indicating that the mutation effectively improved the overall thermostability of the enzyme.
[0073] 3.6 Determination of optimal pH and pH stability Diluted enzyme solutions (prepared in Example 2) with enzyme activity of 16-32 U / mL were used to determine the optimal pH by measuring enzyme activity under different pH conditions (pH 4.5-8.0, using citrate-sodium citrate buffer or potassium phosphate buffer). The results showed that... Figure 3 The optimal pH for both the wild-type and mutant sucrose isomerases was 6.0. In pH stability tests, the enzyme solutions were incubated at 4°C for 1 h in different pH buffers, and the residual enzyme activity was measured. The results showed that both the wild-type and mutant enzymes retained more than 80% of their enzyme activity within a pH range of 5.5-7.0, demonstrating good pH stability.
[0074] Example 4: Application of mutants in the preparation of isomaltulose To comprehensively evaluate the performance of the mutant K160M / K302Y in the industrial production of isomaltulose, this example included comparative experiments under different substrate concentrations and temperature conditions. The experimental results are summarized in Table 5 and... Figure 4 .
[0075] 4.1 Experimental Conditions and Methods Preparation of reaction system: Weigh sucrose according to the set substrate concentration (400 g / L or 800 g / L), dissolve it in deionized water, and adjust the pH to 6.0-6.5 with citrate-sodium citrate buffer or potassium phosphate buffer.
[0076] Enzyme addition and reaction: Add the purified enzyme preparation (wild-type sucrose isomerase or mutant K160M / K302Y, prepared in Example 2) according to the set amount of enzyme, place it in a constant temperature water bath, set the reaction temperature (30℃, 35℃ or 50℃), and start the reaction timer.
[0077] Sampling and analysis: 0.5 mL samples were taken every 2 hours, and the reaction was terminated by boiling in a water bath for 10 min. After dilution, the isomaltulose content was detected by HPLC, and the conversion rate was calculated. Conversion rate (%) = (isomaltulose concentration / initial sucrose concentration) × 100%.
[0078] Enzyme supplementation procedure (wild type at 50°C): When using wild type at 50°C, add 6 U / g of substrate enzyme preparation every 4-6 hours, and record the number of enzyme supplementations and the total amount of enzyme used.
[0079] 4.2 Experimental Results Table 5. Performance comparison between mutant and wild type in isomaltulose preparation
[0080] 4.3 Results Analysis (1) Moderate substrate concentration conditions (400 g / L) Mutant K160M / K302Y (Group 1): Under the conditions of 35℃ and 7 U / g substrate, the conversion rate reached 93.2% after 8 h of reaction and 95.0% after 10 h of reaction. No enzyme supplementation was required, and the reaction was completed in one step.
[0081] Wild type (Group 2): At 30℃ (optimal temperature for wild type) and 7 U / g substrate, the conversion rate was only 86.5% after 12 h of reaction, and reached 91.2% after 24 h of reaction.
[0082] Comparative conclusion: The mutant can achieve a conversion rate of 95.0% after 10 h at a higher temperature (35℃ vs 30℃), while the wild type requires 24 h to reach 91.2%. The mutant reaction time is shortened by 58%, the conversion rate is increased by 3.8%, and the production efficiency is significantly improved.
[0083] (2) High substrate concentration and high temperature conditions (800 g / L, 50℃) Mutant K160M / K302Y (Group 3): Under the conditions of 50℃ and enzyme dosage of 9 U / g substrate, the conversion rate reached 91.8% after 10 h of reaction and 94.3% after 12 h of reaction. No enzyme supplementation was required throughout the process, and the total enzyme dosage was only 9 U / g substrate.
[0084] Wild-type sucrose isomerase (Group 4): Under conditions of 50℃ and an initial enzyme dosage of 9 U / g substrate, due to poor thermostability, an enzyme preparation of 6 U / g substrate needs to be added every 5 h. After 12 h of reaction (with 2 enzyme additions), the conversion rate was only 78.2%, and after 18 h of reaction (with 3 enzyme additions), the conversion rate was 85.7%, with a total enzyme dosage as high as 27 U / g substrate.
[0085] Comparative conclusions: The mutant K160M / K302Y achieved a conversion rate of 94.3% after 12 h of reaction at 50℃ without the need for enzyme supplementation, while the wild-type achieved a conversion rate of only 85.7% after 18 h of reaction and 3 enzyme supplementations. The mutant increased the conversion rate by 8.6%, shortened the reaction time by 33%, and reduced the total enzyme consumption by 67%, significantly reducing production costs and operational complexity.
[0086] In summary, the mutant K160M / K302Y of this invention exhibits significant technical and economic advantages in the industrial production of isomaltulose. In particular, under high temperature and high substrate concentration conditions, it can achieve high conversion rate, no enzyme supplementation required, and low enzyme dosage for efficient production, providing an excellent biocatalyst for the technological upgrading and cost reduction of the isomaltulose industry.
[0087] The relevant sequences in this invention are as follows: SEQ ID No. 1: Nucleotide sequence of sucrose isomerase mutant K160M / K302Y (restriction sites added at both ends of the gene (currently marked with lowercase underscores)). 1 ggatcc ACGAATATAC AAAAGTCCGC TGATTTTCCC ATTTGGTGGA AACAGGCAGTATTTTACCAG 61 ATTTATCCCC GCTCATTTAA AGATAGCAAT GGTGATGGTA TCGGCGATAT TCCCGGTATC 121 ATTGAGAAAC TGGACTATTT AAAAATGCTG GGAGTTGATG CTATCTGGAT AAACCCGCAC 181 TATGAGTCTCTAACACCGA CAATGGTTAC GATATTAGTG ATTATCGTAA AATCATGAAG 241 GAGTACGGCA GCATGGCTGA CTTTGACCGT CTGGTTGCCG AAATGAATAA ACGTGGTATG 301 CGCCTGATGA TTGATATTGT TATCAATCAT ACCAGCGATC GTCACCGCTG GTTTGTGCAG 361 AGCCGTTCAG GTAAAGATAA TCCTTACCGC GACTATTATT TCTGGCGTGA TGGTAAACAG 421 GGACAGGCTC CCAATAACTA TCCCTCTTTC TTTGGCGGTT CAGCCTGGCA ACTGGATATG 481 CAGACTGACC AGTATTATCT GCACTATTTT GCACCACAGC AGCCGGATCT GAACTGGGAT 541 AACCCAAAAG TTCGGGCTGA ACTCTACGAT ATTCTGCGTT TCTGGCTGGA TAAAGGCGTA 601 TCCGGACTAC GTTTTGATAC CGTGGCTACT TTCTCCAAAA TTCCTGGCTT CCCGGACCTG 661 TCAAAAGCGC AGCTGAAGAA TTTTGCCGAA GCGTATACTG AGGGGCCGAA TATTCATAAA 721 TATATCCATG AAATGAACCG CCAGGTACTG TCTAAATATA ATGTTGCCAC CGCTGGTGAA 781 ATCTTCGGTG TGCCAGTGAG TGCTATGCCG GATTATTTTG ACCGGCGGCG TGAAGAACTC 841 AATATTGCTT TCACCTTTGA TTTGATCAGG CTCGATCGTT ATCCCGATCA GCGCTGGCGT 901 CGTTACCCAT GGACATTAAG CCAGTTTCGT CAAGTTATCT CTCAGACTGA CCGTGCCGCC 961 GGTGAATTTG GCTGGAACGC CTTTTTCCTT GATAACCATG ATAACCCGCG CCAGGTCTCA 1021 CACTTTGGTG ACGACAGCCC ACAATGGCGC GAACGCTCGG CAAAAGCACTGGCAACGCTG 1081 CTGCTGACGC AGCGTGCCAC GCCGTTTATC TTTCAGGGGG CGGAGTTGGGAATGACTAAT 1141 TACCCCTTTA AAAATATAGA GGAATTTGAT GATATTGAGG TTAAAGGCTTCTGGAACGAC 1201 TATGTAGCCA GCGGAAAAGT AAACGCTGCT GAATTTTTAC AGGAGGTTCGCATGACCAGC 1261 CGCGATAACA GCCGAACACC AATGCAGTGG AACGACTCTG TTAATGCCGGATTCACCCAG 1321 GGCAAACCCT GGTTTCACCT CAATCCCAAC TATAAGCAAA TCAATGCCGCCAGGGAGGTG 1381 AATAAACCCG ACTCGGTATT CAGTTACTAC CGTCAACTGA TCAACCTGCGTCACCAGATC 1441 CCGGCACTGA CCAGTGGTGA ATACCGTGAT CTCGATCCGC AGAATAACCAGGTCTATGCC 1501 TATACCCGTA TACTGGATAA TGAAAAATAT CTGGTGGTAG TTAATTTTAAACCTGAGCAG 1561 CTGCATTACG CTCTGCCAGA TAATCTGACT ATTGCCAGCA GTCTGCTGGAAAATGTCCAC 1621 CAACCATCAC TGCAAGAAAA TGCCTCCACG CTGACTCTTG CTCCGTGGCAAGCCGGGATC 1681 TATAAGCTGA ACTGA aagctt SEQ ID No.2: Amino acid sequence of sucrose isomerase mutant K160M / K302Y 1 TNIQKSADFP IWWKQAVFYQ IYPRSFKDSN GDGIGDIPGI IEKLDYLKML GVDAIWINPH 61 YESPNTDNGY DISDYRKIMK EYGSMADFDR LVAEMNKRGM RLMIDIVINH TSDRHRWFVQ 121 SRSGKDNPYR DYYFWRDGKQ GQAPNNYPSF FGGSAWQLDM QTDQYYLHYF APQQPDLNWD 181 NPKVRAELYD ILRFWLDKGV SGLRFDTVAT FSKIPGFPDL SKAQLKNFAE AYTEGPNIHK 241 YIHEMNRQVL SKYNVATAGE IFGVPVSAMP DYFDRRREEL NIAFTFDLIR LDRYPDQRWR 301 RYPWTLSQFR QVISQTDRAA GEFGWNAFFL DNHDNPRQVS HFGDDSPQWR ERSAKALATL 361 LLTQRATPFI FQGAELGMTN YPFKNIEEFD DIEVKGFWND YVASGKVNAA EFLQEVRMTS 421 RDNSRTPMQW NDSVNAGFTQ GKPWFHLNPN YKQINAAREV NKPDSVFSYY RQLINLRHQI 481 PALTSGEYRD LDPQNNQVYA YTRILDNEKY LVVVNFKPEQ LHYALPDNLT IASSLLENVH 541 QPSLQENAST LTLAPWQAGI YKLN Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A sucrose isomerase mutant, characterized in that: The mutant is formed by mutating lysine K to methionine M at amino acid residue 160 of the wild-type sucrose isomerase and lysine K to tyrosine Y at amino acid residue 302. The amino acid sequence of the mutant is shown in SEQ ID No.
2.
2. The application of the mutant as described in claim 1 in the preparation of isomaltulose.
3. The method for preparing the mutant as described in claim 1, characterized in that: Includes the following steps: (1) Gene design and synthesis: based on P. dispersa The amino acid sequence of wild-type sucrose isomerase was obtained, and codons were optimized to adapt to the codon preference of the E. coli expression system. A mutant gene was designed with the 160th amino acid residue mutated from lysine K to methionine M and the 302nd amino acid residue mutated from lysine K to tyrosine Y. The full-length sequence of the mutant gene was obtained by chemical total synthesis. (2) The synthesized mutant gene was cloned into the expression vector pET28 to construct the recombinant expression vector pET28-K160M / K302Y; (3) The recombinant expression vector was transformed into Escherichia coli host cells, and the recombinant bacteria were obtained after DNA sequencing verification. (4) Inoculate the recombinant bacteria into LB liquid medium containing 50 μg / mL kanamycin and culture at 37℃ and 220 r / min for 12-16 h with shaking. (5) Transfer to fermentation medium at an inoculum rate of 1-3%, and culture at 37°C with shaking at 220 r / min until OD. 600 The concentration was 0.6-0.8, and galactose was added to a final concentration of 0.5-2% to induce expression for 16-24 h. (6) Collect bacterial cells, sonicate to disrupt them, centrifuge to obtain the supernatant, and purify by nickel column affinity chromatography to obtain the mutant.
4. The method of claim 3, wherein: In step (1), the codons were optimized according to the E. coli codon usage frequency table, and the codon fitness index (CAI) of the optimized gene was ≥0.
85.
5. The method of claim 3, wherein: In step (3), the host cells for Escherichia coli are BL21 (DE3), Rosetta (DE3), or Origami (DE3).
6. The method of making according to any one of claims 3 to 5, wherein: The fermentation medium is LB liquid medium containing 50 μg / mL kanamycin.
7. A recombinant bacterium comprising the mutant as described in claim 1.
8. A method for producing isomaltulose using the mutant according to claim 1, characterized by: Includes the following steps: (1) Prepare a sucrose substrate solution with a sucrose concentration of 400-800 g / L and a pH of 5.5-6.5; (2) Add the mutant, with an enzyme dosage of 5-10 U / g substrate; (3) React at 35-55℃ for 6-12 h; (4) After the reaction is complete, the enzyme is inactivated to obtain the isomaltulose product.
9. The method of claim 8, wherein: The specific conditions for the method are as follows: (1) With a sucrose concentration of 400 g / L, pH 6.0-6.5, enzyme dosage of 6-8 U / g substrate, and reaction at 35℃ for 8-10 h, the isomaltulose conversion rate reached 92-96%; Or: (2) With a sucrose concentration of 800 g / L, pH 6.0-6.5, enzyme dosage of 8-10 U / g substrate, and reaction at 50℃ for 10-12 h, the isomaltulose conversion rate reached 90-96%.