Application of SNP molecular markers related to the trait of mandarin fish feeding on formulated feed

Abstract

This invention discloses the application of a SNP molecular marker related to the feeding trait of mandarin fish (Siniperca chuatsi) on formulated feed, belonging to the fields of biotechnology and aquatic animal genetics and breeding. The SNP molecular marker is located at locus 29390304 from the 5' end on chromosome 10 of the mandarin fish genome, and is either A or T, with the AA genotype indicating easier domestication; or the SNP molecular marker is located at locus 1218488 from the 5' end on chromosome 20 of the mandarin fish genome, and is either T or A, with the TT genotype indicating easier domestication. The SNP molecular marker of this invention is closely related to the ability of mandarin fish to feed formulated feed. Therefore, the SNP molecular marker of this invention can be used to predict the domestication potential of mandarin fish at an early stage, or to conduct marker-assisted breeding using this SNP molecular marker to increase the proportion of easily domesticated individuals in the population, thereby significantly reducing breeding costs and improving economic benefits.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and aquatic animal genetics and breeding, and in particular relates to the application of a SNP molecular marker related to the trait of mandarin fish feeding on artificial compound feed. Background Technology

[0002] Mandarin fish with upturned beak ( Siniperca chuatsi The mandarin fish (also known as the mandarin perch or osmanthus fish), belonging to the order Perciformes, family Serranidae, and genus *Siniperca*, is a unique and valuable freshwater economic fish species endemic to my country. It is widely favored by consumers for its tender flesh, delicious taste, and lack of intramuscular bones. The mandarin fish is a typical carnivorous fish, feeding entirely on live fish and shrimp throughout its life. This unique feeding habit presents a significant challenge to the aquaculture industry. Traditional mandarin fish farming relies primarily on live bait fish (such as mud carp), which not only leads to high farming costs but also suffers from unstable bait fish supply, a high risk of pathogen transmission causing frequent disease outbreaks, and severe pollution of the aquaculture water environment. To address these issues, feeding mandarin fish with formulated feed has become an inevitable trend in the industry's development. Significant progress has been made in the artificial domestication of mandarin fish to feed with formulated feed, but significant individual differences remain. In actual production, a considerable proportion of mandarin fish are difficult to domesticate, exhibiting refusal to eat formulated feed, stunted growth, and even starvation and death. This severely impacts the survival rate and economic benefits of formulated feed aquaculture.

[0003] SNPs (single nucleotide polymorphisms) are the most abundant form of genetic variation in the genome. Genome-wide association studies (GWAS), as a highly efficient genetic tool, have been widely used to analyze complex traits in plants and animals. While molecular markers for traits such as growth and disease resistance have been reported in aquatic animals, research on SNP molecular markers related to the complex behavioral trait of largemouth bass feeding on formulated feed is relatively limited. Existing technologies, such as the invention patent with publication number CN107034307A, provide an SNP marker related to the growth traits of largemouth bass. This SNP marker can be used for screening or detection of largemouth bass, or for screening or detecting largemouth bass or their parents that are easily trained to eat formulated feed during the artificial breeding process. This has positive effects in the breeding and selection of largemouth bass. Furthermore, the invention patent with publication number CN114908175A discloses SNP markers related to the feeding domestication of largemouth bass and their applications. This molecular marker can serve as a reliable marker for the feeding domestication trait of largemouth bass, facilitating early selection, thereby improving the success rate of feeding domestication selection, increasing breeding efficiency and accuracy, and providing a theoretical basis for rapidly screening largemouth bass that are easily trained to eat formulated feed.

[0004] Traditional breeding methods for mandarin fish feeding habits mainly rely on phenotypic selection, which is time-consuming, highly susceptible to environmental influences, and inefficient. Therefore, identifying SNP molecular markers closely related to the feeding traits of mandarin fish on formulated feeds and developing marker-assisted selection (MAS) technology is of great significance for breeding new mandarin fish varieties that are easy to tame and grow quickly, and for promoting the green and sustainable development of the mandarin fish farming industry. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides an application of SNP molecular markers related to the feeding of artificial compound feed on mandarin fish.

[0006] On the one hand, the present invention provides a SNP molecular marker associated with the feeding of artificial compound feed on mandarin fish, wherein the SNP molecular marker includes at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP1 molecular marker as shown in SEQ ID No. 1. The SNP1 molecular marker is located at the 301st position from the 5' end on SEQ ID No. 1, corresponding to the 29390304th position from the 5' end on chromosome 10 of the mandarin fish genome, and is a base A or a base T. The second type is a nucleotide sequence containing the SNP2 molecular marker as shown in SEQ ID No. 2. The SNP molecular marker is located at the 301st position from the 5' end on SEQ ID No. 2, corresponding to the 1218488th position from the 5' end on chromosome 20 of the mandarin fish genome, and is a base T or a base A.

[0007] The sequence shown in SEQ ID No. 1 is as follows: AGGACGGGCGGCGCAGATCGGAGCGATATGCCCTCCTCAGACACACCTGTTAGAAGCGTGGGTCGGTCGGCCTGTCCCGTGGGGGATGTCGGTCACCGCCTCCCTTCTTGTATCACCTCCTCTTCCTCCTCTTGAGAGAGAAAGGCGAAAGCTGATGCGCGGCTCCCTATCTTCGCCTATTCTGCCTTAAAAAAAAAAACAACAACAAAAAAACAAGCGATTTGTGATGTTAAAAGACGGGGGTTCTCGCTGGTTTGGCGTCTCCAGCGCCGCTGAGCCGACGGAGCGCACGGTTTACAGXAATTATGGACACGTCCACATTAGCGGACAGATTTCCCCATTGACAGCGCTGTTTCTTGACAAATCTTCAGATTATTATCCCCCCCCCCACTCCTCGTTTTCTTGTTTTCCTCTTTGTCACCTTCCCTGTCTCTTCCTCCTCCGGGCCCGGGCTGATGGGAGACAACCGGACACCTGTTTGAATCCTGTTTATCCTTCTTCCTCTGGCACACTTAAAGCGCAACGCTACGCCTCATTTCCTCGCTCCTCAAATATATACGATTAGGTGATATCGCCTTCCCAACAGCAGCAGCAGCTGTAG, where X is base A or base T.

[0008] The sequence shown in SEQ ID No.2 is: , where Y is either base T or base A.

[0009] For SNP1, when the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes of the mandarin fish are A and A respectively, it is called the AA homozygous genotype. Mandarin fish with the AA genotype have a strong ability to eat artificial feed (easy to train). When the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes are A and T respectively, it is called the AT heterozygous genotype. Mandarin fish with the AT genotype have a weak ability to eat artificial feed (difficult to train). When the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes are T and T respectively, it is called the TT homozygous genotype. Mandarin fish with the TT genotype have a weak ability to eat artificial feed (difficult to train).

[0010] For SNP2, when the SNP molecular markers in the sequences shown in SEQ ID No. 2 on the two chromosomes of mandarin fish are T and T respectively, it is called the TT homozygous genotype. Mandarin fish with the TT genotype have a strong ability to consume artificial compound feed. When the SNP molecular markers in the sequences shown in SEQ ID No. 2 on the two chromosomes are T and A respectively, it is called the TA heterozygous genotype. Mandarin fish with the TA genotype have a weak ability to consume artificial compound feed.

[0011] During breeding, if the SNP molecular marker is the first type, then in the mandarin fish breeding population, select the broodstock individuals with the AA genotype at the 301st locus from the 5' end of SEQ ID No.1, and eliminate the broodstock individuals with the AT or TT genotype at that locus.

[0012] If the SNP molecular marker is the second type, then in the mandarin fish breeding population, select the TT genotype at the 301st locus from the 5' end of SEQ ID No.2, and cull the TA genotype at that locus.

[0013] The present invention also provides a method for screening mandarin fish strains with strong ability to consume artificial compound feed. The method includes detecting the genotype of the SNP molecular markers described in the mandarin fish genome and selecting mandarin fish with specific genotypes for breeding.

[0014] Preferably, if the SNP molecular marker is the first type, the specific genotype is AA. If the SNP molecular marker is the second type, the specific genotype is the TT type.

[0015] This invention also provides a method for marker-assisted selection breeding based on the strong ability of mandarin fish to consume artificial formulated feed, the method comprising: a) Extracting DNA from the mandarin fish species to be bred; b) Genotyping the extracted DNA to determine the genotype of the SNP molecular marker; c) Based on the identification results, select mandarin fish with a strong ability to consume artificial compound feed for breeding.

[0016] Furthermore, if the SNP molecular marker is the first type, the mandarin fish with a strong ability to consume artificial compound feed is a mandarin fish with the AA type SNP molecular marker genotype; If the SNP molecular marker is the second type, the mandarin fish with a strong ability to consume artificial compound feed is a mandarin fish with the TT type SNP molecular marker genotype.

[0017] For genetic improvement aimed at achieving the trait of easy domestication in mandarin fish, the method includes: identifying the aforementioned SNP molecular markers in the breeding stock of the core group of mandarin fish, and making corresponding selections based on the SNP molecular markers: If the SNP molecular marker is SNP1, then in the core group of Mandarin fish, select the broodstock individuals with the AA genotype at the 301st site from the 5' end on SEQ ID No.1, and eliminate the broodstock individuals with the AT or TT genotypes at that site; If the SNP molecular marker is SNP2, then in the core group of Mandarin fish, the broodstock individuals with the TT genotype at the 301st locus from the 5' end of SEQ ID No.2 are selected, and the broodstock individuals with the TA genotype at that locus are eliminated.

[0018] Due to the adoption of the above technical solutions, the embodiments of the present invention have at least the following beneficial effects: the SNP molecular marker of the present invention is closely related to the ability of mandarin fish to feed on artificial compound feed. Therefore, the SNP molecular marker of the present invention can be used to predict the domestication potential of mandarin fish in the early stage, or to carry out molecular marker-assisted breeding through this SNP molecular marker to increase the proportion of easily domesticated individuals in the population, thereby significantly reducing breeding costs and improving economic benefits. Attached Figure Description

[0019] Figure 1 The images show a comparison of the morphological characteristics of mandarin fish populations feeding on formulated feed in this embodiment of the invention. The top image shows mandarin fish that are easy to train and feed on formulated feed, while the bottom image shows mandarin fish that are not easy to train and feed on formulated feed.

[0020] Figure 2 This is a Manhattan plot for genome-wide association analysis in an embodiment of the present invention, where the horizontal lines represent threshold lines. Detailed Implementation

[0021] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0022] Example 1: Detection of SNP molecular markers related to artificial compound feed intake in mandarin fish. 1. Domestication of the diet of juvenile mandarin fish and sample collection In this embodiment, all juvenile mandarin fish were purchased from the same breeding batch at an aquaculture fry farm to minimize genetic background differences. The initial specifications of the experimental fish were: weight 1.30±0.08 g, body length 5.05±0.24 cm, totaling 500 fish. The feeding acclimatization experiment was conducted in an indoor recirculating aquaculture system (water temperature 25±1℃, dissolved oxygen >6 mg / L). The experiment consisted of two phases: Phase 1 (live bait fish + frozen bait fish, 3 days): Feed with live bait fish, gradually increasing the proportion of frozen bait fish until the fish is fully adapted to the frozen bait fish.

[0023] Phase Two (Frozen Bait Fish + Formulated Feed, 9 days): After the experimental fish have adapted to the frozen bait fish, gradually increase the proportion of formulated feed until they are exclusively fed formulated feed. Feeding should be done at fixed times, locations, in fixed quantities, and with fixed signals, twice a day. The feed amount should be 1%-3% of the fish's body weight, and adjusted dynamically according to their feeding behavior. Each feeding session should last 30 minutes, and any uneaten feed should be removed promptly.

[0024] After the domestication period, strict phenotypic identification and grouping were conducted based on feeding behavior: The easily trained group: These fish were able to consistently and actively rise to the surface to feed on formulated artificial feed; examination of their intestinal contents confirmed that they primarily consumed formulated artificial feed. A total of 140 fish were selected.

[0025] The group that is difficult to train: consistently avoids formulated feed, only consuming feed pellets that sink to the bottom or are accidentally ingested, or vomiting them after eating; intestinal examination shows an empty intestine or very little formulated feed. A total of 60 tails were selected.

[0026] The physical characteristics of easily tamed and difficult-to-tamed mandarin fish are shown in [link to relevant documentation]. Figure 1 Muscle tissue was collected from each experimental fish and stored at -20°C.

[0027] 2. Whole-genome resequencing (GWAS) to screen for SNP loci related to domestication in mandarin fish. This invention successfully screened and obtained molecular markers closely linked to the taming trait of mandarin fish (Siniperca chuatsi) through a genome-wide association analysis strategy based on whole-genome resequencing of 200 individuals. The specific steps are as follows: First, high-quality genomic DNA was extracted from independent individuals (140 easily tamed and 60 difficult to tamed) that underwent rigorous phenotypic identification, and sequencing libraries were constructed for each individual. Then, whole-genome resequencing at a depth of at least 15× was performed on each individual using the Illumina NovaSeq platform. After obtaining the raw data, quality control and alignment to a reference genome were performed, and individual-level single nucleotide polymorphism (SNP) calling was conducted using the GATK standard workflow to obtain a high-confidence variant dataset. Based on this individual genotype matrix and corresponding phenotypic data, an efficient mixed linear model was used for genome-wide association analysis to correct for the influence of population structure and accurately identify SNP sites that achieved significant association at the genome level between the two groups. Strict significance thresholds were set, and functional annotation of the sites was comprehensively considered.

[0028] GWAS analysis identified 32 SNP loci significantly associated with the domestication of mandarin fish. Figure 2The Manhattan plot of genome-wide association analysis in this embodiment of the invention is shown. Two SNP loci associated with the domestication of mandarin fish were ultimately identified.

[0029] The first type, denoted as SNP1, contains a nucleotide sequence with an SNP molecular marker as shown in SEQ ID No.1. The SNP molecular marker is located at the 301st position from the 5' end on SEQ ID No.1, corresponding to the 29390304th position from the 5' end on chromosome 10 of the mandarin fish genome, and is either A or T. The second type is designated as SNP2. The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 2. The SNP molecular marker is located at the 301st position from the 5' end on SEQ ID No. 2, corresponding to the 1218488th position from the 5' end on chromosome 20 of the mandarin fish genome, and is either T or A.

[0030] 3. Detection of SNPs related to domestication in Mandarin fish using allele-specific PCR Genotyping was performed on SNP1 and SNP2, which may be related to domestication traits in step 2. The alleles and genotypes of the SNP loci in the easily domesticated and difficult domestication populations are shown in Table 1.

[0031] Table 1. Distribution of alleles and genotypes in easily domesticated and difficult-to-domesticate mandarin fish populations

[0032] Note: One of the 200 mandarin fish was missing the SNP1 site, and its genotype was not detected.

[0033] Table 1 shows a significant correlation between the polymorphisms at SNP1 and SNP2 loci and the ease with which mandarin fish can be domesticated by artificial feed. Specifically, the AA genotype at SNP1 is a favorable genotype for easy domestication. In breeding, selecting individuals with the AA genotype and eliminating those with the AT and TT genotypes can significantly improve the domestication success rate of the population. Similarly, the TT genotype at SNP2 is also a favorable genotype for easy domestication. Selecting individuals with the TT genotype and eliminating those with the TA genotype (AA was not observed in this experiment, but theoretically should also be eliminated) helps improve the ease of domestication. Using these two molecular markers for assisted breeding allows for the genetic differentiation of juvenile fish with indistinguishable phenotypes. By eliminating individuals carrying unfavorable alleles (T in SNP1 and A in SNP2), a high proportion of easily domesticated superior strains of mandarin fish can be rapidly established.

[0034] In summary, the SNP sites discovered in this application are of great significance for the aquaculture industry of mandarin fish, mainly in two aspects: 1. It is significant for continuous optimization through generations. For example, when SNP1 is of the AA genotype, there are 137 easily domesticated mandarin fish and 43 difficult-to-domesticate mandarin fish. Obviously, the AA genotype mandarin fish individuals are more easily domesticated. In the breeding process, this difference can be continuously reduced through multiple generations and selection, and the proportion of difficult-to-domesticate mandarin fish individuals can be reduced, ultimately significantly optimizing the domestication ability of the mandarin fish population. 2. In genetic breeding, finding alleles is an important method. The significance of this patent application lies in the fact that it is the first time that a molecular marker that is significantly associated with the feeding behavior of mandarin fish has been discovered at the genome level. This allows the complex feeding behavior to be located at a specific genomic locus, which is an important breakthrough in basic research.

[0035] On the other hand, this marker can be directly used to construct a marker-assisted selection system, rapidly accumulating beneficial genes by selecting parents carrying superior alleles, thereby achieving genetic improvement of domestication traits. This is a crucial first step in realizing "genomic selection" and "precision breeding" of mandarin fish.

Claims

1. Application of SNP molecular markers in screening for mandarin fish strains with strong ability to consume formulated feed, wherein the SNP molecular markers include at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 1, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 1 and is A or T; The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 2 and is either T or A; If the SNP molecular marker is the first type, the feeding trait of the mandarin fish on artificial feed is as follows: the AA genotype mandarin fish has a strong ability to feed on artificial feed, while the AT or TT genotype mandarin fish has a weak ability to feed on artificial feed. If the SNP molecular marker is the second type, the feeding trait of the mandarin fish on artificial feed is as follows: the TT genotype mandarin fish has a strong ability to feed on artificial feed, while the TA genotype mandarin fish has a weak ability to feed on artificial feed. When applying the SNP molecular marker, if the SNP is the first type, then in the breeding population of mandarin fish, select the broodstock individuals with the AA genotype at the 301st locus from the 5' end of SEQ ID No.1, and cull the broodstock individuals with the AT or TT genotype at that locus; When applying the SNP molecular marker, if the marker is the second type, then in the Mandarin fish breeding population, select the broodstock individuals with the TT genotype at the 301st locus from the 5' end of SEQ ID No. 2, and cull the broodstock individuals with the TA genotype at that locus.

2. A method for screening mandarin fish strains with strong ability to consume formulated feed, characterized in that, This method involves detecting the genotype of SNP molecular markers in the genome of mandarin fish and selecting mandarin fish with specific genotypes for breeding; The SNP molecular marker includes at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 1, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 1 and is A or T; The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 2 and is either T or A; If the SNP molecular marker is the first type, the specific genotype is type AA; If the SNP molecular marker is the second type, the specific genotype is the TT type.

3. A method for marker-assisted selection breeding based on the strong ability of mandarin fish to consume formulated feed, characterized in that, The method includes: a) Extracting DNA from the mandarin fish species to be bred; b) Genotyping the extracted DNA to determine the genotype of the SNP molecular marker; The SNP molecular marker includes at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 1, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 1 and is A or T; The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 2 and is either T or A; c) Based on the identification results, select mandarin fish with a strong ability to consume artificial compound feed for breeding; If the SNP molecular marker is the first type, the mandarin fish with strong ability to consume artificial compound feed is a mandarin fish with the AA type SNP molecular marker genotype. If the SNP molecular marker is the second type, the mandarin fish with a strong ability to consume artificial compound feed is a mandarin fish with the TT type SNP molecular marker genotype.

Images