Application of TaERF9 gene in co-modification of histones in nitrogen-mediated root development

Abstract

This invention discloses a TaERF9 The application of genes in co-modifying histones in nitrogen-mediated root development, the aforementioned TaERF9 The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022223.1, CM022224.1, and CM022225.1 in NCBI, respectively. This invention utilizes CRISPR-Cas9 technology to directionally edit wheat KN199, obtaining... TaERF9 Loss-of-function mutant plants. Protein interaction experiments demonstrated that TaERF9 can interact with the PRC2 subunit SWN. High and low nitrogen hydroponic experiments showed that... TaERF9 The gene mutation significantly promoted root development under high nitrogen conditions; under low nitrogen conditions, the mutant's root development remained similar to that of the wild type, demonstrating its ability to balance root development under different nitrogen supply conditions, revealing... TaERF9 The role of genes in nitrogen-responsive regulation of root development. In other words... TaERF9 Gene mutations can promote root development, thus providing genetic resources for nitrogen-efficient crop breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving TaERF9 Application of genes in co-modifying histones in nitrogen-mediated root development. Background Technology

[0002] Nitrogen is an essential nutrient that participates in many stages of crop growth and development. Nitrogen fertilizer is crucial in agricultural production, and therefore, a large amount of nitrogen fertilizer is used globally every year. With the continuous increase in nitrogen fertilizer use, environmental pollution problems such as water pollution and soil acidification have gradually emerged. Therefore, reducing the excessive use of nitrogen fertilizer and improving nitrogen use efficiency (NUE) is urgently needed.

[0003] Nitrate is both a nutrient and a key signaling molecule. Many plant developmental processes are regulated by nitrate signaling, such as breaking seed dormancy, promoting leaf growth, inducing flowering, and influencing root development. Nitrate signaling participates in the regulation of rice tillering, panicle structure, and root development through different regulatory modules. The impact of nitrate on the root system is particularly important, as plants primarily absorb nitrate through their roots. The structure and size of the root system largely determine the efficiency of nitrogen absorption, and the regulatory pathways of nitrate on root development are gradually being discovered. Nitrate can increase gibberellin levels in plants, thereby promoting the degradation of the growth-inhibiting protein DELLA, activating cell proliferation, and thus promoting root and shoot growth. In Arabidopsis, AtANR1 encodes a MADS-box transcription factor involved in promoting lateral root elongation under localized nitrate treatment. AtAFB3 (Auxin Signaling F-BOX3) is induced by increased intracellular nitrate and regulates downstream genes such as NAC3 / OBP4, thereby participating in the regulation of lateral root initiation and taproot development.

[0004] Epigenetic regulation plays a crucial role in controlling plant responses to environmental signals. In monocotyledons, nitrogen uptake is regulated by changes in chromatin rearrangement. CHB101 encodes a subunit of the ATP-dependent chromatin remodeling complex—the SWI / SNF complex. In maize, ZmCHB101 has been found to regulate chromatin remodeling in response to nitrate supply. ZmNRT2 .1 and ZmNRT2.2 The expression of nitrate transport genes, including TaWFZP, is mediated by the chromatin remodeling factor TaSYD in wheat. In wheat, TaWFZP regulates lateral root development genes. TaCRL1 , TaRHD6 The expression of [certain substances] affects root development and can promote [the development of the root system]. TaNRT2.1 , TaNRT2.3The expression of genes such as [specific gene name] enhances nitrogen uptake efficiency, thereby improving nitrogen use efficiency. Furthermore, histone modifications regulate root adaptive development strategies under low nitrogen conditions among different wheat varieties. In KN9204, increased H3K27ac and decreased H3K27me3 promoted root growth; while in J411, increased H3K27ac and decreased H3K27me3 promoted the nitrate transport system. Altering the modification status of H3K27me3 can alter root adaptive development strategies under low nitrogen conditions.

[0005] Given the adverse effects of excessive nitrogen fertilizer use on the ecological environment, this study aims to mine key genes that mediate histone modification and participate in nitrogen response in root development through multi-omics data mining. By using transgenic technology to create transgenic materials, this study will conduct in-depth research on the gene functions and mechanisms by which wheat responds to nitrogen signals and regulates root development, providing a solid research foundation for the creation and breeding of nitrogen-efficient wheat varieties. Summary of the Invention

[0006] The purpose of this invention is to provide TaERF9 Application of genes in co-modifying histones in nitrogen-mediated root development.

[0007] To achieve the above objectives, the technical solution adopted by this invention is summarized as follows: The present invention adopts TaERF9 The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022223.1, CM022224.1, and CM022225.1 in NCBI, respectively. TaERF9-5A The coding sequence of the gene is 726 bp in length, and the nucleotide sequence is shown in SEQ ID NO.1, which includes 241 amino acids. The amino acid sequence is shown in SEQ ID NO.4. TaERF9-5B The coding sequence of the gene is 729 bp in length, and the nucleotide sequence is shown in SEQ ID NO.2, which includes 242 amino acids, and the amino acid sequence is shown in SEQ ID NO.5. TaERF9-5D The coding sequence of the gene is 741 bp in length, and the nucleotide sequence is shown in SEQ ID NO.3, which includes 246 amino acids, and the amino acid sequence is shown in SEQ ID NO.6.

[0008] In this invention, histone modification refers to histone modification H3K27me3.

[0009] The present invention also constructs a series of plant expression vectors, and the functions of expression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in improving the nitrogen efficiency of plants also fall within the protection scope of the present invention.

[0010] The functions of the genes protected by this invention include not only those described above.TaERF9 Genes, including those related to TaERF9 Homologous genes with high homology (up to 99%) have functions related to nitrogen efficiency.

[0011] The present invention discloses TaERF9 The biological function of the gene in improving nitrogen use efficiency in plants is specifically manifested in the following ways: compared to the wild type KN199, under high-nitrogen hydroponic conditions, TaERF9 The loss-of-function mutant can promote root development, thereby improving nitrogen use efficiency.

[0012] Based on their function, plants with high nitrogen use efficiency can be obtained through genetic modification. Specifically, this can be achieved by introducing nitrogen-enhancing substances into the target plant. TaERF9 By reducing gene expression or knocking out genes, transgenic plants are obtained. These plants have higher nitrogen use efficiency than the target plant under high nitrogen conditions.

[0013] Specifically, TaERF9 The gene can be introduced into the target plant via the recombinant expression vector. In this method, the recombinant expression vector can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0014] To improve the desirable traits of plants, this invention also protects a novel plant breeding method that can improve plant traits by "regulating the growth of certain plant components". TaERF9 The method of "gene expression" was used to obtain plants with altered root development capabilities. Among these, "regulating the expression of genes in plants" was employed. TaERF9 Gene expression can occur through overexpression, silencing, gene editing, or directed mutation. TaERF9 Genes. Regulation of gene expression levels includes using DNA homologous recombination technology, virus-mediated gene silencing technology, and Agrobacterium-mediated transformation systems to regulate the aforementioned... TaERF9 Expression was used to obtain transgenic plant lines.

[0015] More specifically, the method may be one of the following (1), (2), or (3): (1) By increasing the content of the target plant TaERF9 To improve protein activity and obtain plants with lower root development capacity than the target plant under high nitrogen conditions; (2) By promoting the growth of target plants TaERF9 Gene expression was used to obtain plants with lower root development capacity than the target plant under high nitrogen conditions; (3) By inhibiting the target plant TaERF9 Gene expression was used to obtain plants with stronger root development capabilities than the target plant under high nitrogen conditions.

[0016] "Promote the target plant" TaERF9 The expression of genes can be achieved in the following ways: (1) or (2) or (3): (1) TaERF9 Genes are introduced into the target plant; (2) Introduce strong promoters and / or enhancers; (3) Other common methods in the field, such as overexpression.

[0017] "Inhibit the target plant in TaERF9 The expression of the gene can be achieved by obtaining a gene loss mutant using CRISPR / Cas9 technology.

[0018] The target plant of this invention is wheat.

[0019] This invention identifies genes for root development under low nitrogen conditions through multi-omics analysis, and demonstrates through yeast double hybridization and bimolecular fluorescence complementation experiments that TaERF9 can interact with SWN, a key component of the histone-modified H3K27me3 writer PRC2.

[0020] In this invention, there are no particular limitations on the plants suitable for gene transformation, as long as they are suitable for gene transformation operations, such as various crops, flowering plants, or forestry plants. The plants may be (but are not limited to): dicotyledons, monocotyledons, or gymnosperms.

[0021] As a preferred approach, the term "plant" includes, but is not limited to, wheat and Arabidopsis thaliana; any plant possessing the gene or a homologous gene is applicable.

[0022] The term "plant" as used in this invention includes the whole plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain our target gene or nucleic acid. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores; similarly, each of these objects contains the target gene / nucleic acid.

[0023] This invention includes any plant cell, or any plant obtained or obtainable by the methods described herein, as well as all plant parts and their propagules. This patent also includes transfected cells, tissues, organs, or whole plants obtained by any of the foregoing methods. The only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that offspring obtained using the methods of this patent have identical characteristics.

[0024] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0025] Advantages of this invention: (1) This invention uses multi-omics joint analysis to innovatively explore wheat ( Triticum aestivum L.) regulates root development TaERF9 In wild-type wheat KN199, a [synthetic / ... TaERF9 Analysis of the mutant plants showed that, compared to the wild type, in hydroponic experiments under different nitrogen conditions, TaERF9 The gene mutation can promote the root development of wheat under high nitrogen conditions. Under low nitrogen conditions, the mutant material responds less to low nitrogen, and there is no significant difference in root development between the mutant and wild types, providing genetic resources for high-nitrogen-efficiency breeding of crops.

[0026] (2) Plants with high nitrogen use efficiency can be obtained through genetic modification. Specifically, this can be achieved by... TaERF9 Genetic mutations yielded transgenic plants that exhibited stronger root development than the target plant under high nitrogen conditions, providing a new approach for nitrogen-efficient breeding of plants. Attached Figure Description

[0027] Figure 1 yes TaERF9 The nucleotide and amino acid sequences of homologous genes from the three subgenomes of the gene. (See figure.) Figure 1 A, 1B, and 1C correspond to respectively TaERF9-5A , TaERF9-5B , TaERF9-5D nucleotide sequence; Figure 1 D, 1E, and 1F correspond to respectively TaERF9-5A , TaERF9-5B , TaERF9-5D The amino acid sequence.

[0028] Figure 2 Genes related to root development under low nitrogen conditions were identified through multi-omics analysis, and their interaction with PRC2 was verified through biochemical experiments. (See figure.) Figure 2 A shows the presence of a dynamic variation region of H3K27me3 in KN9204 material affected by low nitrogen content. TaERF9 Gene binding motif; Figure 2 B Display TaERF9 The gene interacts with the PRC2 component SWN in yeast cells in vitro; Figure 2 C display TaERF9The gene interacts with the PRC2 component SWN at the subcellular level.

[0029] Figure 3 yes TaERF9 Genotyping results of CRISPR mutants of the gene.

[0030] Figure 4 yes TaERF9 The statistical results of root phenotypes of mutant plants under high-nitrogen and low-nitrogen hydroponic conditions are shown in the figure. KN199 is the wild-type control, and ERF9-cr is the wild-type control. TaERF9 The CRISPR mutant lines; HN represents a high-nitrogen environment, and LN represents a low-nitrogen environment. Detailed Implementation

[0031] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0032] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the gene editing methods, gene editing vector construction methods, and gene-edited plant acquisition methods employed in this invention, except for those used in the following embodiments, can all be implemented using methods already disclosed in existing literature.

[0035] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0036] biomaterials Wheat KN199 seeds were preserved in the laboratory; Primer synthesis and sequencing were completed by BGI Genomics Co., Ltd. The CRISPR genetic transformation materials were provided by Weimi Biotechnology Co., Ltd.

[0037] Example 1 TaERF9 Gene mining Transcriptome and histone modification H3K27me3 data of roots of nitrogen-efficient cultivar KN9204 and nitrogen-inefficient cultivar J411 under high-nitrogen and low-nitrogen environments were measured to obtain their expression status. By screening for species-specific low-nitrogen expression genes and corresponding dynamically changing H3K27me3 regions, some genes involved in the root development of KN9204 were identified. To detect recruitment factors mediating dynamic H3K27me3 changes, plant motif position weight matrices were downloaded from the JASPAR database. Transcription factor binding motifs in these H3K27me3 regions were scanned dynamically using FIMO (4.11.2), and enrichment tests were performed on the detected motifs using Fisher's test in R. The results showed that in KN9204, regions with increased low-nitrogen transcription and dynamic H3K27me3 changes were enriched with [recruiting factors]. TaERF9 This suggests that it may be a key gene for regulating H3K27me3-mediated root development. Figure 2 A).

[0038] Polycomb Repressive Complex 2 (PRC2) is a highly conserved epigenetic regulatory complex in eukaryotes, composed of multiple subunits including SWN and FIE. It represses target gene transcription by catalyzing the trimethylation of lysine residue 27 of histone H3. Yeast two-hybrid assays and bimolecular fluorescence complementation experiments have demonstrated that TaERF9 can indeed interact with the key component of PRC2, SWN. Figure 2 (B, 2C). This indicates that TaERF9 is a key transcription factor mediating histone modification regulation of root development genes.

[0039] TaERF9 The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022223.1, CM022224.1, and CM022225.1 in NCBI, respectively. TaERF9-5A The coding sequence of the gene is 726 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in Figure A, it includes 241 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in D. TaERF9-5B The coding sequence of the gene is 729 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in B, it includes 242 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in E. TaERF9-5D The coding sequence of the gene is 741 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in C, it includes 246 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in F.

[0040] Example 2 TaERF9 Identification of transgenic plants with gene loss of function CRISPR target design was performed using a high-throughput CRISPR-Cas9 target design program developed by VimiBio. A single-gene, dual-target design was employed, with the target design as follows: Target1: 5'-AGGAAGAAGAACGTCTACCGCGG-3'; Target2: 5'-CGAGCCACTTGCGCACCGCGCGG-3'; After obtaining transgenic plants, multiple generations of self-pollination were performed to propagate and harvest materials homozygous for the three mutations. The following primers were used to identify their editing status: ERF9-5A-F: GTATATAACCGCCTCCCCTCG; ERF9-5A-R:GAACTAACGACTGTGTGCTGG; ERF9-5B-F: CGTCGCAGTCCATCCACT; ERF9-5B-R:TCCATCTATCGTCATGAGATCCT; ERF9-5D-F: TCCTGACCTTATCCAACTGGA; ERF9-5D-R:TCACTATCAGTAACCACCAATTT.

[0041] The DNA sequence of the target gene region was amplified by PCR, and the CRISPR editing was identified after first-generation sequencing. Two types of CRISPR editing were identified in this way. TaERF9 Editing types: Editing type 1 (cr1) manifests as 64 bp deletion, 1 bp deletion, and 66 bp deletion in the wheat A, B, and D subgenomes, respectively, with corresponding transcriptional effects of premature termination, premature termination, and frameshift mutation; Editing type 2 (cr2) manifests as deletion of A and G bases, 1 bp deletion, and 66 bp deletion in the wheat A, B, and D subgenomes, respectively, with corresponding transcriptional effects of premature termination, premature termination, and frameshift mutation. Figure 3 This indicates that the obtained mutant lines produced effective gene editing.

[0042] Example 3 TaERF9 Effects of gene mutation on wheat root development under different nitrogen levels For wild-type KN199 and TaERF9 Seeds of loss-of-function mutant materials were soaked in 0.3% H2O2 at 4°C for 24 h, then sown in vermiculite and grown in a greenhouse with 16 h light / 8 h darkness at 22°C. When the seedlings reached one leaf and one bud, the endosperm was removed, and they were allowed to acclimate in pure water for one day, followed by growth in a high-nitrogen (3 mM NO3) environment. - ) and low nitrogen (0.04 mM NO3) - Hydroponic culture was carried out for 3 weeks under two nitrogen levels (greater than 1 mM NO3). - For high-nitrogen environments, NO3 levels are less than 0.5 mM. - (For a low-nitrogen environment). The roots were scanned using an EPSON scanner, and root data were extracted from the obtained images using WinRHIZO software.

[0043] The results showed that at high nitrogen levels, TaERF9 The mutant plants showed greater total root length, root surface area, root volume, and number of root tips than the wild-type control KN199. Under low nitrogen conditions, the total root length, root surface area, and root volume of wild-type KN199 all increased, consistent with the common knowledge that roots grow larger under low nitrogen, proving that low nitrogen treatment was effective. TaERF9The mutant plants showed no significant differences from KN199 in total root length, root surface area, root volume, and number of root tips. Figure 4 A, 4B, 4C, and 4D). (Explanation) TaERF9 The mutation promotes root development in high-nitrogen environments but weakens root development in low-nitrogen environments, indicating a reduced ability to sense changes in nitrogen levels after the mutation.

[0044] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. TaERF9 The application of genes in nitrogen-mediated plant root development, characterized by: The TaERF9 Genes are TaERF9-5A, TaERF9-5B, TaERF9-5D composition ， The TaERF9-5A, TaERF9-5B, TaERF9-5D The nucleotide sequences are shown in SEQ ID NO. 1~3, and the corresponding amino acid sequences of the TaERF9 protein are shown in SEQ ID NO. 4~6. This was achieved through the construction of... TaERF9 CRISPR vector ， get TaERF9 The loss-of-function mutant plant, under high nitrogen conditions, exhibits stronger root development than the wild type; the plant is wheat.

2. A method for improving the root development ability of wheat under high nitrogen conditions, characterized in that, The method involves knocking out [the target plant]... TaERF9 Genes were used to obtain plants with stronger root development capabilities than the target plant under high nitrogen conditions. TaERF9 Genes are TaERF9-5A, TaERF9-5B, TaERF9-5D Composition, the TaERF9-5A, TaERF9-5B, TaERF9- 5D The nucleotide sequences are shown in SEQ ID NO.1~3, and the target plant is wheat.

3. The method according to claim 2, characterized in that, Knockout TaERF9 Genes are edited using CRISPR / Cas9 technology. TaERF9 Genes, Acquisition TaERF9 Loss-of-function mutant.

Images