SNP molecular marker related to specific growth rate of grass carp and application thereof

Abstract

The application belongs to the field of aquatic animal molecular markers and aquatic genetic breeding, and specifically discloses SNP markers significantly related to specific growth rate (SGR) of grass carp and application thereof. The SNP molecular markers are as follows: 1) located at position 31625913 of the 13th chromosome of grass carp, and the polymorphic base is C / T; and 2) located at position 31648914 of the 13th chromosome of grass carp, and the polymorphic base is G / A. The application also discloses application of the SNP molecular markers, amplification primers or kits in breeding of grass carp with high specific growth rate. The SNP molecular markers can be used for early breeding of grass carp with fast growth potential, effectively avoiding the limitation of relying on post-cultivation phenotype determination in traditional breeding, significantly shortening the breeding cycle, improving the breeding efficiency and reducing the breeding cost, and has important application value for improving the production performance of grass carp, shortening the breeding cycle and improving the production efficiency.

Description

Technical Field

[0001] This invention relates to the field of molecular markers for aquatic animals and aquatic genetic breeding technology, and to SNP molecular markers related to grass carp specific growth rate (SGR) and their applications. Background Technology

[0002] Grass carp (Ctenopharyngodon idella) is one of the most important freshwater aquaculture fish species in my country, and its growth rate is a key indicator affecting aquaculture efficiency. Specific growth rate (SGR), as a core parameter for measuring growth performance, directly determines the aquaculture cycle and production efficiency. However, grass carp's late sexual maturity (typically 4-5 years) and long reproductive cycle make traditional phenotype-based breeding methods time-consuming and inefficient, severely limiting the development of superior grass carp varieties. Therefore, developing molecular markers closely related to specific growth rate (SGR) to achieve early and efficient marker-assisted selection has become an urgent need in the field of grass carp genetic breeding.

[0003] Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material of individuals, directly reflecting genetic polymorphism at the DNA level. Among them, single nucleotide polymorphisms (SNPs), as third-generation molecular markers, are the most numerous and widely distributed in the genome, and are therefore widely used in molecular breeding of plants and animals. Marker-assisted breeding (MAB) is a breeding technique that utilizes the close linkage between these molecular markers and genes controlling target traits to select for those traits by detecting the molecular markers. However, currently, there is a lack of molecular markers for marker-assisted breeding of grass carp growth traits, which restricts the improvement of grass carp growth traits. Summary of the Invention

[0004] The purpose of this invention is to improve the SNP molecular markers associated with grass carp specific growth rate (SGR) and their applications, in order to solve the above-mentioned problems.

[0005] To achieve the above objectives, the specific technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides SNP molecular markers related to grass carp specific growth rate (SGR), said SNP molecular markers being either 1) or 2):

[0007] 1) Located at position 31625913 on chromosome 13 of grass carp, the polymorphic base is C / T, referred to as molecular marker SNP Chr13:31625913 in this paper; the genotype of the polymorphic site is CC, which corresponds to a high specific growth rate;

[0008] 2) Located at position 31648914 on chromosome 13 of grass carp, the polymorphic base is G / A, referred to as molecular marker SNP Chr13:31648914 in this paper; the genotype of the polymorphic site is GG, which corresponds to a high specific growth rate.

[0009] Secondly, the present invention provides amplification primers for detecting the SNP molecular markers associated with grass carp specific growth rate (SGR), including primer pairs capable of detecting one or both of the two SNP molecular markers.

[0010] Preferably, the amplification primers include one or more of the following pairs:

[0011] As shown in SEQ ID NO:1 and SEQ ID NO:2, a pair of primers can amplify the molecular marker SNP Chr13:31625913;

[0012] As shown in SEQ ID NO:3 and SEQ ID NO:4, a pair of primers can amplify the molecular marker SNP Chr13:31648914;

[0013] Thirdly, the present invention provides a method for breeding grass carp with high specific growth rate (SGR), comprising the following steps:

[0014] Step 1: Extract DNA from the fin rays of the grass carp to be tested;

[0015] Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using the amplification primers.

[0016] Step 3: Sequencing analysis is performed on the amplification products obtained in Step 2 to determine the genotype of the SNP molecular markers of the grass carp individuals to be tested. Genotype analysis is then used to determine whether the grass carp has the genetic potential for high specific growth rate (SGR).

[0017] Preferably, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, grass carp with the polymorphic base located at position 31625913 on chromosome 13 of grass carp and the genotype CC (the base sequence is shown in SEQ ID NO:5) have the potential for excellent high specific growth rate (SGR).

[0018] Preferably, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:3 and SEQ ID NO:4, grass carp with a polymorphic base located at position 31648914 on chromosome 13 and a genotype of GG (the base sequence is shown in SEQ ID NO:6) have the potential for high specific growth rate (SGR).

[0019] When the molecular marker is SNP Chr13:31625913, grass carp individuals with the CC genotype exhibit a higher specific growth rate (SGR) and faster growth rate; while individuals with the CT and TT genotypes have relatively lower specific growth rates (SGR) and slower growth rates. When the molecular marker is SNP Chr13:31648914, grass carp individuals with the GG genotype have a better specific growth rate (SGR) than individuals with the GA and AA genotypes.

[0020] Fourthly, the present invention provides a kit containing amplification primers capable of detecting the SNP molecular markers associated with grass carp specific growth rate (SGR). The amplification primers include one or more pairs of the following: SEQ ID NO:1-2, SEQ ID NO:3-4.

[0021] Fifthly, the present invention provides the application of the SNP molecular marker, the amplification primer, or the kit in the selection of grass carp with high specific growth rate (SGR).

[0022] The present invention has at least the following beneficial effects:

[0023] (1) This invention uses genome-wide association analysis to identify gene loci controlling the specific growth rate (SGR) of grass carp, and screens out two candidate SNP loci significantly associated with SGR, namely SNP Chr13:31625913 and Chr13:31648914. The results show that the CC genotype is the preferred genotype in SNP Chr13:31625913, and the GG genotype is the preferred genotype in SNP Chr13:31648914. Individuals carrying these genotypes have faster growth rates. These two SNPs can be used as molecular markers to predict the growth rate of grass carp with high accuracy. The SNP loci of this invention have promising applications in marker-assisted breeding of grass carp.

[0024] (2) The SNP markers of the present invention can be determined by primers, which has the advantages of simple and quick operation, accurate and reliable results, and low cost.

[0025] (3) The SNP molecular marker of this invention is not affected by factors such as individual age and sex. This SNP molecular marker can be used for early selection and breeding of grass carp with high specific growth rate (SGR), effectively avoiding the limitations of traditional breeding that relies on phenotypic determination in the later stages of aquaculture, greatly reducing the workload of breeding, significantly shortening the breeding time, accelerating the breeding process, improving breeding efficiency, and reducing breeding costs; it has important guiding significance for improving the production performance of grass carp, reducing the breeding cost of grass carp and increasing breeding income, and is suitable for promotion and application. Attached Figure Description

[0026] Figure 1 The images show the Manhattan plot and QQ plot from the grass carp specific growth rate (SGR) GWAS analysis provided in this embodiment of the invention. 1A is the Manhattan plot, 1B is the QQ plot, and 1C shows the phenotypic distribution: the horizontal axis represents the SGR phenotypic value of the experimental population.

[0027] Figure 2 This is a statistical chart showing the specific growth rate (SGR) of grass carp carrying different genotypes of SNP Chr13:31625913 in the embodiments of the present invention. Among them, 2A is the whole genome high-throughput sequencing screening result in Example 1, and 2B is the first-generation sequencing verification result in Example 2.

[0028] Figure 3 This is a statistical chart showing the specific growth rate (SGR) of grass carp carrying different genotypes of SNP Chr13:31648914 in this invention. 3A represents the results of whole-genome high-throughput sequencing screening in Example 1, and 3B represents the results of first-generation sequencing verification in Example 2. Detailed Implementation

[0029] This invention focuses on the genetic improvement of the key economic trait of specific growth rate (SGR) in grass carp. By applying the SNP molecular markers obtained through screening to marker-assisted selection, it provides a simple, accurate, and low-cost method for grass carp breeding. This invention can effectively identify individuals with high specific growth rate (SGR) genetic potential, has practical value for improving the breeding efficiency of grass carp growth rate, and is suitable for widespread application.

[0030] To enable those skilled in the art to better understand the technical solution of the invention, the following embodiments are provided for illustration:

[0031] Example 1: Screening of SNP molecular markers associated with individual-specific growth rate (SGR) in grass carp

[0032] 1. Sample Collection

[0033] The grass carp used in this study were collected from the Wujiang National Four Families Carp Farm in Jiangsu Province, China. Seventy-eight healthy individuals of the "Hu Su No. 1" grass carp were selected, and the weight data of each fish was measured and recorded. At the same time, the tail fin tissue of the experimental fish was collected for the extraction of genomic DNA.

[0034] 2. Extraction of genomic DNA

[0035] DNA was extracted from the samples using a magnetic bead method. The concentration of DNA samples was detected using a Qubit real-time fluorescence analyzer; the integrity of the DNA samples was detected by 1% agarose gel electrophoresis.

[0036] 3. SNP quality control and population structure analysis

[0037] The raw high-throughput sequencing data was processed using quality control and filtering, and PLINK software was used. Thresholds were set, including a deletion rate > 0.1, minor allele frequency (MAF) < 0.05, recall rate < 0.1, and Hardy-Weinberg precision (HWE) < ​​1e-6, to remove low-quality SNPs from the raw data, ultimately yielding 6,660,311 high-quality SNP loci for subsequent analysis.

[0038] Before starting the genome-wide association analysis, to avoid the influence of population structure, principal component analysis (PCA) was performed on the quality-controlled data using PLINK software, and the data was visualized using the R package ggplot2. The phylogenetic tree was constructed using raxml-ng software and visualized using the website (https: / / itol.embl.de).

[0039] 4. Genome-wide association analysis of specific growth rate (SGR) traits

[0040] Genome-wide association analysis (GWAS) was performed using rMVP software based on a mixed linear model (MLM) approach. GWAS were conducted on specific growth rates (SGRs) of 78 individuals, taking into full account population structure and inter-individual phylogenetic relationships. The statistical model is as follows:

[0041] y = Xα + Zβ + e

[0042] In the formula, y represents the phenotypic trait; Xα is the population structure, which is a fixed effect; Zβ is the marking effect; and e is the residual.

[0043] Bonferroni correction (Bonferroni 1936) was used to determine the significance threshold for the whole genome. The calculation formula was p = 0.05 / N, where N represents the total markers used for association analysis. QQ plots and Manhattan plots were drawn using the CMplot package in R. Phenotypic variance interpretation (PVE) and F-values ​​were calculated using rMVPl software.

[0044] 5. Results Analysis

[0045] After PLINK quality control washing, 6,660,311 SNP loci were obtained from 78 grass carp individuals for further GWAS analysis. The Bonferroni-corrected threshold for genome-wide significant SNP markers was set at P = 0.05 / 6660311 = 7.5 × 10⁻⁶. -9 GWAS results for grass carp specific growth rate (SGR) trait are as follows: Figure 1 As shown in the figure. Among them, two SNPs on chromosome 13 that were most strongly associated with grass carp specific growth rate (SGR) were SNP Chr13:31625913 C>T (P=7.73E-06) and SNP Chr13:31648914 G>A (P= 8.22E-06). The QQ plot shows that the GWAS analysis performed was of good quality.

[0046] Statistical results of specific growth rate (SGR) at two SNP loci for different genotypes in 78 grass carp in this example. Figure 2 As shown in A-3A, the specific growth rate (SGR) is calculated using the following formula: SGR = (lnWt - lnW0) / t × 100%, where W0 is the initial mass, Wt is the mass at the end of the experiment, and t is the duration of the experiment. Specific results are explained below:

[0047] like Figure 2 As shown in Figure A, there were significant differences in specific growth rate (SGR) among individuals with different genotypes at the SNP Chr13:31625913 C>T locus (P < 0.001). Individuals carrying the CC genotype had a significantly higher SGR than those carrying the CT and TT genotypes; conversely, the SGR of individuals with the CT genotype was also significantly higher than that of individuals with the TT genotype. Overall, a growth rate gradient of CC > CT > TT was observed.

[0048] like Figure 3 As shown in Figure A, the specific growth rate (SGR) of individuals with different genotypes at the SNP Chr13:31648914 G>A locus showed significant differences (P < 0.001). Individuals carrying the GG genotype had the highest specific growth rate (SGR), significantly higher than those with the GA and AA genotypes; furthermore, the specific growth rate (SGR) of individuals with the GA genotype was also significantly higher than that of individuals with the AA genotype. Overall, a growth rate gradient of GG > GA > AA was observed.

[0049] Example 2: Validation of SNP molecular markers related to grass carp specific growth rate (SGR)

[0050] The validation experiment used different grass carp populations, randomly selecting 50 experimental fish. The specific growth rate (SGR) trait of each fish was measured and recorded. Simultaneously, tail fin samples were collected and preserved from each fish for DNA extraction. The specific procedure for DNA extraction was the same as in Example 1. Subsequently, using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO:1 and SEQ ID NO:2 as primers to obtain a gene fragment containing SNP Chr13:31625913 C>T (i.e., a molecular marker sequence, such as SEQ ID NO:5). Among them:

[0051] The sequences of the upstream and downstream primer pairs for SNP Chr13:31625913 are as follows:

[0052] SNP Chr13:31625913-F:5'-GTCTCATACAGGGTATAACAGA-3' (SEQ ID NO: 1);

[0053] SNP Chr13:31625913-R:5'-CAACTGACCACCACACATA-3' (SEQ ID NO: 2).

[0054] The total PCR amplification volume was 25 μL. The specific reaction system is shown in Table 1, and the amplification program is shown in Table 2.

[0055] Table 1 PCR reaction procedure

[0056]

[0057] Table 2 PCR amplification reaction procedure

[0058]

[0059] The molecular marker sequence is shown in SEQ ID NO:5. SNP Chr13:31625913 C>T is located at position 201 of the gene fragment SEQ ID NO:5, and the mutation type is C / T.

[0060] SEQ ID NO:5 (where the underlined single base in the middle indicates the mutation site, and the underlines on both sides indicate the positions of the upstream and downstream primers):

[0061] TTTAGTCATGTTTTT GTCTCATACAGGGTATAACAGA CTATTTAAAATACATATATTATCAGTTGTTACACTATATCTCCCAATAAAATGTTATTTTAAAAGCTTAATTTCATAATAGTTTTAGTTTTGTAGTTTTAATTTTGGGGGGCAAAACAATGTAATGCAATACATAGATCAGTGGTTCCCAACCTTTTCCAACT C GCGGCCCACACATCCAAACACGTGTTATTGTGCTGGTACATTAAGGACTGCCATGGACCGATGACTCCTAAAGTTTTCGGATATTCTTCATAT TATGTG TGGTGGTCAGTTGGCAGCAGTGACAAATTGTCTTTTCCAATAAGTTTAAATATATTTTTTACCTTTTTAAAGCCATATTTTCACTTATTATTAACTTCTTG

[0062] Two μL of the reaction product was subjected to 1% agarose gel electrophoresis for detection. Qualified samples were used for subsequent sequencing to determine the genotype of each sample in SNP Chr13:31625913.

[0063] Genotypes of each individual were obtained through first-generation sequencing, and specific growth rate (SGR) data of individuals with different genotypes were collected. Figure 2 B presents the results of experimental verification of SNP Chr13:31625913. Figure 2 B indicates that there are significant differences in specific growth rates among individuals with different genotypes of grass carp SNPChr13:31625913; among them, individuals carrying the CC genotype have a higher specific growth rate than individuals carrying the CT and TT genotypes. (Compared to Example 1) Figure 2 Result A is consistent.

[0064] The verification method for SNP Chr13:31648914 G>A is the same as above, using the following upstream and downstream primers:

[0065] SNP Chr13:31648914 -F:5'-GGGTGGAAATACTGCCTTGG-3' (SEQ ID NO: 3);

[0066] SNP Chr13:31648914-R:5'-GTTGTCTGTGTCTGTGTATATG-3' (SEQ ID NO: 4).

[0067] The gene fragment containing SNP Chr13:31648914 was obtained as shown in SEQ ID NO:6. The mutation site is located at position 201, and its mutation type is G / A.

[0068] SEQ ID NO:6 (where the underlined single base in the middle indicates the mutation site, and the underlines on both sides indicate the positions of the upstream and downstream primers):

[0069] ACATTCAGCTCTTAGCAACCAGGTTTAATTGCAAGAATGAAAGTAGTATTTGGATGTTATAAACCTTTAAAAACCTCTGAAACTCTAAGTAGTTAGAATT GGGTGGAAATACTGCCTTGGTGGCGCTTTTTTCGGTCCTCCAAAACTAGGGTCCTGGAAATGCGGTGCTGTAACTGTGGTTTCTCCGATTCGGTAGGTGGT G CTGTCACAAAAAAAACTAGAGTCCTAGAACTGCAGTCCTGAAATTGCAGTGTCCGGTATTGCAGACAGATAATAATTGTTTAATTTGAGAAAACTATTGTCATAA CATATACACAGACACAGACAAC TTGTGACAGAAATATGAAAGGGTTTATTTAAATTTCATTTGATTAAAAATAAATGAACATTTTTTCTCATT

[0070] Figure 3 B presents the results of experimental verification of SNP Chr13:31648914. Figure 3 B indicates that there are significant differences in specific growth rates among individuals with different genotypes of grass carp SNPChr13:31648914; among them, individuals carrying the GG genotype have a higher specific growth rate than individuals carrying the GA and AA genotypes. (Compared to Example 1) Figure 3 Result A is consistent.

[0071] In summary, this invention successfully screened two SNP markers (SNP Chr13:31625913 and SNP Chr13:31648914) that are significantly associated with grass carp specific growth rate (SGR). Their genotypes can be determined using a pair of primers, which is simple and reliable. These two SNP sites have promising applications in molecular marker-assisted breeding and genome selection breeding of grass carp.

[0072] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for breeding grass carp with high specific growth rates, characterized in that, Includes the following steps: Step 1: Extract DNA from the fin rays of the grass carp to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using amplification primers; the amplification primers include: a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, and / or, a primer pair as shown in SEQ ID NO:3 and SEQ ID NO:4; Step 3: Sequencing the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker in the grass carp individual to be tested. Genotype analysis is used to determine whether the grass carp has the genetic potential for a high specific growth rate: When performing PCR amplification with the primer pair shown in SEQ ID NO:1 and SEQ ID NO:2, the polymorphic base at position 201 of the amplification fragment shown in SEQ ID NO:5 is detected. When the genotype at this site is CC, the grass carp individual is determined to have a higher genetic potential for a specific growth rate; When performing PCR amplification with the primer pair shown in SEQ ID NO:3 and SEQ ID NO:4, the polymorphic base at position 201 of the amplification fragment shown in SEQ ID NO:6 is detected. When the genotype at this site is GG, the grass carp individual is determined to have a higher genetic potential for a specific growth rate.

2. The application of amplification primers or kits in the breeding of grass carp with high specific growth rates, characterized in that, The amplification primers include: a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, and / or a primer pair as shown in SEQ ID NO:3 and SEQ ID NO:4; the kit contains the amplification primers; When the amplification primers are a pair of primers as shown in SEQ ID NO:1 and SEQ ID NO:2, the grass carp genomic DNA is amplified by PCR. The polymorphic base at position 201 of the amplified fragment as shown in SEQ ID NO:5 is detected. When the genotype at this site is CC, the grass carp individual has a higher genetic potential for a specific growth rate. When the amplification primers are a pair of primers as shown in SEQ ID NO:3 and SEQ ID NO:4, PCR amplification of grass carp genomic DNA is performed using them. The polymorphic base at position 201 of the amplified fragment shown in SEQ ID NO:6 is detected. When the genotype at this site is GG, the grass carp individual has a higher genetic potential for a specific growth rate.

Images