Tea tree UGT708AC25 molecular marker and metabolite thereof in regulating plant internode length
Patent Information
- Application Number
- CN202610457612.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-08
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2046-04-08
AI Technical Summary
[0007]克隆节间长相关基因,开发相应的分子标记,通过分子育种改良植物节间长,有利于株型的改良,然而茶树节间长相关的分子标记较少
[0009] The technical problem to be solved by this invention is to provide the application of the UGT708AC25 molecular marker of tea plants and its metabolites in regulating internode length.
Smart Images

Figure CN121975976B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology; specifically, it relates to genes related to internode length in tea trees. CsUGT708AC25 Applications in reducing internode length in poplar and tea trees include gene cloning, marker-assisted breeding during the seedling stage, and internode length growth regulators. Background Technology
[0002] Tea is a labor-intensive industry, and breeding tea varieties suitable for machine harvesting is beneficial to the large-scale and industrialized development of the tea industry. Internode length is an important factor affecting machine harvesting, and regulating internode length is one of the key points in breeding tea varieties for machine harvesting. Internode length is a complex quantitative trait controlled by multiple genetic loci. Currently, a series of quantitative trait loci (QTLs) regulating internode length variation have been successfully located and cloned, as shown below: I. OsCYPq1: Zhao DD, Son JH, Farooq M, et al., 2021. Identification of candidate gene for internode length in rice to enhance resistance to lodging using QTL analysis [J / OL]. Plants, 10(7): 1369.
[0003] II. Cla015407: Gebremeskel H, Dou J, Li B, et al., 2019. Molecular mapping and candidate gene analysis for GA3 responsive short internode in watermelon( Citrullus lanatus )[J / OL]. International Journal of Molecular Sciences, 21(1): 290 (Watermelon ( Citrullus lanatus Molecular localization and candidate gene analysis of short intersegmental genes responding to gibberellin GA3 in 21999 [J / OL]. International Journal of Molecular Sciences, 21(1): 290.
[0004] three, EI : Sun X, Shu J, Ali Mohamed AM, et al., 2019. Identification andCharacterization of EI ( Elongated Internode ) gene in tomato ( Solanum lycopersicum )[J / OL]. International Journal of Molecular Sciences, 20(9): 2204 (Tomato ( Solanum lycopersicum ) elongated intersegment EI Identification and characterization of genes [J / OL]. International Journal of Molecular Sciences, 20(9): 2204).
[0005] Four, OsWRKY21 : Wei X, Zhou H, Xie D, et al., 2021. Genome-wide association study in rice revealed a novel gene in determining plant height and stem development, by encoding a WRKY transcription factor [J / OL]. International Journal of Molecular Sciences, 22(15): 8192.
[0006] five, TB1 : Vann L, Kono T, Pyhäjärvi T, et al., 2015. Natural variation inteosinte at the domestication locus teosinte branched1 ( tb1 [J / OL]. PeerJ, 3:e900 (Sow millet domestication site) teosinte branched1 (tb1) Natural variation studies [J / OL]. PeerJ, 3: e900).
[0007] Cloning internode length-related genes and developing corresponding molecular markers can improve plant internode length through molecular breeding, which is beneficial for improving plant type. However, there are few molecular markers related to internode length in tea trees.
[0008] The invention CN118048390A, "Application of the UGT708AC25 Gene in Tea Trees," discloses the application of the UGT708AC25 gene in regulating plant height. However, it is well known in the industry that internode length is not entirely equivalent to plant height; plant height is determined by internode length and number of internodes. Regulating plant height can be achieved through the following methods: regulating stem internode development, branching number, and internode number. Furthermore, CN118048390A does not mention "internodes" at all. Summary of the Invention
[0009] The technical problem to be solved by this invention is to provide the application of the UGT708AC25 molecular marker of tea plants and its metabolites in regulating internode length.
[0010] To address the above problems, this invention provides a gene associated with internode length in tea trees. CsUGT708AC25 The use of seedling molecular markers is to identify whether a plant belongs to a short-internode plant; Molecular markers were amplified using the following primer pairs: Marker0927: 5'-TTATTTTTCTAAAACAAAATGCCAC-3' (SEQ ID NO: 5) Marker1125: 5'-CAAACTTCAAATTGGAAATTACAAA-3' (SEQ ID NO: 6).
[0011] This invention also provides a method for identifying whether a plant belongs to a short-internode plant using the above-mentioned seedling molecular markers, comprising the following steps: 1) Extract RNA from the plant to be tested and reverse transcribe it into cDNA. The plant is a tea tree or a poplar tree. 2) Amplification using the aforementioned molecular marker primers Marker0927 and Marker1125 CsUGT708AC25 Encoding area; When the amplification result (base sequence result) is Cs UGT708AC25.1 If the genotype is determined, the plant to be tested is determined (predicted) to be a short-internode plant; When the amplification result (base sequence result) Cs UGT708AC25.2 If the genotype is determined, the plant to be tested is predicted to be a long-internode plant; Cs UGT708AC25.1 The nucleotide sequence of the gene is as described in SEQ ID NO: 1, Cs UGT708AC25.2 The nucleotide sequence of the gene is as described in SEQ ID NO: 2.
[0012] This invention also provides Cs UGT708AC25.1 Genes, Cs UGT708AC25.2Use of genes: negatively regulating internode length in plants; Cs UGT708AC25.1 The nucleotide sequence of the gene is as described in SEQ ID NO: 1, Cs UGT708AC25.2 The nucleotide sequence of the gene is as described in SEQ ID NO: 2; CsUGT708AC25.1 The amino acid sequence of the protein encoded by the gene is as described in SEQ ID NO: 3. CsUGT708AC25.2 The amino acid sequence of the protein encoded by the gene is as described in SEQ ID NO: 4; The plant in question is either a tea tree or a poplar tree.
[0013] As Cs of the present invention UGT708AC25.1 Genes, Cs UGT708AC25.2 Improved use of genes: Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 All genes reduce internode length in poplar trees, and CsUGT708AC25.1 The inhibitory effect is stronger than CsUGT708AC25.2 .
[0014] As Cs of the present invention UGT708AC25.1 Genes, Cs UGT708AC25.2 Further improvements in the use of genes: silencing Cs UGT708AC25.1 Genes and Cs UGT708AC25.2 Genes that inhibit the content of vitexin and isovitexin in tea plants.
[0015] Description: The CsUGT708AC25 enzyme metabolizes and synthesizes vitexin and isovitexin. That is, this invention relates to gene silencing, the function of gene-corresponding synthases, and the detection of the content of corresponding synthase metabolites.
[0016] As Cs of the present invention UGT708AC25.1 Genes, Cs UGT708AC25.2 Further improvements in the use of genes: CsUGT708AC25 The antisense primers used for gene silencing are as follows: (1) CsUGT708AC25.1 Related primers CsUGT708AC25.1 Antisense primer-1: 5' CGGAGTCAGATGACCCATGC 3' (SEQ ID NO: 7); CsUGT708AC25.1 Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3' (SEQ ID NO: 8); CsUGT708AC25.1 Antisense primer-3: 5' TGTGCACATAGTCATCGGAT 3' (SEQ ID NO: 9); CsUGT708AC25.1Antisense primer-4: 5' AGTTGTTCTCCTTTTTCGAG 3' (SEQ ID NO: 10); CsUGT708AC25.1 Antisense primer-5: 5' TCTGAAATCACCCTCTGGTC 3' (SEQ ID NO: 11); (2) CsUGT708AC25.2 Related primers CsUGT708AC25.2 Antisense primer-1: 5' CCGGAGTCAGATGACCCATG 3' (SEQ ID NO: 12); CsUGT708AC25.1 Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3' (SEQ ID NO: 13); CsUGT708AC25.1 Antisense primer-3: 5' GGTAACGGAGAGAACGTAAT 3' (SEQ ID NO: 14); CsUGT708AC25.1 Antisense primer-4: 5' TGTGCACATAGTCATCGGAT 3' (SEQ ID NO: 15); CsUGT708AC25.1 Antisense primer-5: 5' GGTGGGAGGTTACTTAAGAC 3' (SEQ ID NO: 16).
[0017] The present invention also provides a method for reducing the internode length of poplar and tea trees: exogenous spraying of vitexin and isovitexin, or adding vitexin and isovitexin to the tissue culture formula, thereby reducing the internode length of the plants (poplar and tea trees) (significantly reducing).
[0018] An improvement to the method of reducing internode length in poplar and tea trees according to the present invention: We provide internode tissue culture 1 and internode tissue culture 2 to regulate the internode length of poplar trees. Cultured poplar trees in internode tissue culture 1 and internode tissue culture 2 can reduce the internode length of poplar trees. We provide two internode spray solutions, 1 and 2, to regulate the internode length of tea trees. Spraying these solutions on tea trees can reduce the internode length.
[0019] This invention first provides a gene for regulating internode length in tea plants. CsUGT708AC25 The study also explored the proteins encoded by this gene, and then provided the uses of the gene products, vitexin and isovitexin, to reduce internode length in poplar or tea trees, and developed internode tissue culture product 1 / 2 for poplar and internode spray product 1 / 2 for tea trees.
[0020] Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 The gene was used to construct a transgenic poplar tree, which showed a significant reduction in internode length, indicating that the gene negatively regulates internode length in poplar trees. Exogenous application of vitexin and isovitexin significantly reduced internode length in poplar and tea trees.
[0021] This invention provides, for the first time, a molecular marker for the internode length of tea plants, and for the first time provides... CsUGT708AC25 The study also investigated the effects of vitexin and isovitexin on the regulation of internode length in poplar and tea trees, and provided corresponding internode tissue culture 1, internode tissue culture 2, internode spray solution 1, and internode spray solution 2. Attached Figure Description
[0022] To make the objectives, technical solutions, and advantages of the present invention clearer, the specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0023] Figure 1 Among short-internode and long-internode tea varieties CsUGT708AC25 The two haplotypes, namely Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 The amino acid sequence of the gene; AJWL, AXBC, and YMX belong to Cs. UGT708AC25.1 Haplotypes JHKC, QM809, and SY3 belong to Cs UGT708AC25.2 Haplotype.
[0024] Figure 2 Recombinant plasmid CsUGT708AC25.1 / 2 -Carrier spectrum of PMAL.
[0025] Figure 3 The results show the enzymatic activity of the recombinant protein CsUGT708AC25.1 / 2.
[0026] Figure 4 The optimal reaction conditions for recombinant protein CsUGT708AC25.1 / 2; Figure 4 middle: A, B, and C represent the optimal pH, optimal temperature, and optimal reaction time for CsUGT708AC25.1, respectively. D, E, and F represent the optimal pH, optimal temperature, and optimal reaction time for CsUGT708AC25.2, respectively.
[0027] Figure 5 Enzymatic characteristics of recombinant protein CsUGT708AC25.1 / 2.
[0028] Figure 6 For silence CsUGT708AC25.1 / 2 The antisense inhibition results of tea trees; Figure 6 middle: A is CsUGT708AC25.1 Relative expression levels of silent strains; B are respectively CsUGT708AC25.1 The content of vitexin, isovitexin, and the total content of vitexin and isovitexin in the silent strain; C is CsUGT708AC25.2 Relative expression levels of silent strains; D are respectively as follows: CsUGT708AC25.2 The content of vitexin, isovitexin, and the total content of vitexin and isovitexin in the silent strain.
[0029] Figure 7 The recombinant plasmid pBWA(V)HS-3xflag- CsUGT708AC25.1 / 2 The carrier spectrum.
[0030] Figure 8 for CsUGT708AC25.1 / 2 Overexpression of the internode phenotype in 84K poplar; Figure 8 middle: The control group was 84K poplar (84K); CsUGT708AC25.1 -OE's L3 and L7 are CsUGT708AC25.1 Overexpression lines; CsUGT708AC25.2 -OE's L2 and L7 are CsUGT708AC25.2 Overexpression lines; one-way ANOVA was used, and different letters were used to indicate significant differences ( P <0.05).
[0031] Figure 9 To determine the internode phenotype of Populus 84K after using blank internode tissue culture (referred to as blank), internode tissue culture 1, and internode tissue culture 2; a one-way ANOVA was used, with different letters used to indicate significant differences ( ). P <0.05).
[0032] Figure 10 To determine the internode phenotypes of Longjing 43 and Wuyi Narcissus after using blank internode mixture (referred to as blank), internode spray solution 1, and internode spray solution 2; a one-way ANOVA was used, with different letters used to indicate significant differences (…). P <0.05); Figure 10 In the Chinese dictionary: A corresponds to Longjing 43, and B corresponds to Wuyi Narcissus. Detailed Implementation
[0033] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: Example 1: Tea Tree Internode Length Related Genes CsUGT708AC25 Molecular markers and functional analysis Using the EMMAX model, a genome-wide association study (GWAS) was conducted on the semi-lignified internode length (SL) of 332 natural core germplasm resources from the National Tea Germplasm Resource Center (Hangzhou). Using the 'Shuchazao' V2 tea variety as the reference genome, genes with an expression level greater than 70 in the stem and a physical distance of less than 14.2 kb from the leadSNP were selected. CsUGT708AC25 As a candidate gene.
[0034] Note: The reference genome of 'Shuchazao' V2 is provided in Xia E, Tong W, Hou Y, et al. The reference genome of tea plant and resequencing of 81 diverse accessions provide insights into genome evolution and adaptation of tea plants[J]. Molecular Plant: English Edition, 2020, 13(7):14.DOI:10.1016 / j.molp.2020.04.010.
[0035] Molecular markers Marker0927 (5'-TTATTTTTCTAAAACAAAATGCCAC-3') and Marker1125 (5'-CAAACTTCAAATTGGAAATTACAAA-3') were used in tea varieties with different internode lengths. CsUGT708AC25 Gene cloning, the cloning method is the same as that used for tea trees. UGT708AC25 The application of the gene (Example 1 of CN118048390A) uses the pEASY®-T&B Zero Cloning Kit as the vector.
[0036] The study focused on three short-internode tea varieties (YMX, AXBC, and AJWL, all with an average internode length (SL) of less than 3 cm) planted at the National Tea Germplasm Resource Center (Hangzhou), and three long-internode tea varieties (JHKC, QM809, and SY3, all with an average internode length (SL) of more than 4.5 cm).
[0037] Specifically as follows: 1. Extraction of total RNA from tea plants: Same as step 1 in Example 1 of CN118048390A; 2. Reverse transcription: The extracted RNA is reverse transcribed into cDNA; same as step 2 of Example 1 in CN118048390A; 3. PCR amplification: The specific primers UGT708AC25-F and UGT708AC25-R in CN118048390A are replaced with Marker0927 and Marker1125 as described in this invention, and the annealing temperature is changed to 58°C. The rest is the same as step 3 of Example 1 in CN118048390A.
[0038] By comparing the sequence with the 'Shuchazao' V2 sequence of the tea tree reference genome, we obtained... CsUGT708AC25.1 / 2 The coding region sequence is then converted into an amino acid sequence, such as... Figure 1 As shown. A type exists in tea trees with short internodes and those with long internodes, respectively. CsUGT708AC25 Haploid. All short-internode tea varieties are... CsUGT708AC25.1 The haplotype, with its nucleotide sequence shown in SEQ ID No: 1 (same as CN118048390A), and the amino acid sequence of the protein it encodes shown in SEQ ID No: 3, is characterized by amino acids at positions 114, 359, and 430 being valine (V), valine (V), and glycine (G), respectively; all long-internode tea varieties are... CsUGT708AC25.2 The haplotype has the nucleotide sequence shown in SEQ ID No: 2 and the amino acid sequence of the protein it encodes is shown in SEQ ID No: 4. Its main characteristic is that the amino acid sites at positions 114, 359 and 430 are alanine (A), isoleucine (I) and aspartic acid (D).
[0039] By utilizing the cloning and sequencing results of the long-internode-associated molecular markers Marker0927 and Marker1125, long-internode hybrids can be effectively screened at the seedling stage.
[0040] That is, when the PCR amplification yields SEQ ID No: 1 ( CsUGT708AC25.1 If the sample is haploid, then the test sample is a short-internode tea variety. When the PCR amplification result is SEQ ID No: 2 ( CsUGT708AC25.2 If the sample is haploid, then the sample to be tested is a long-internode tea tree variety.
[0041] Example 2: Expression of recombinant protein CsUGT708AC25.1 / 2 in Escherichia coli The initial vector was the pEASY®-T&B Zero Cloning Kit, the final vector was PMAL-c5X, and finally, a recombinant plasmid with protein expression function was constructed. CsUGT708AC25.1 / 2- PMAL ( Figure 2 The one obtained in Example 1. CsUGT708AC25.1 / 2 Linked to the vector PMAL-c5X, and then the recombinant plasmid was... CsUGT708AC25.1 / 2-PMAL was transformed into Escherichia coli Rosetta (DE3) to induce protein expression.
[0042] The method is as follows: 1. Using KOD Plus-Neo high-fidelity enzyme (TOYOBO), primers PMAL-CsUGT708A-NdeⅠ-F and PMAL-CsUGT708A-BamHⅠ-R were used to induce the enzyme in Example 1. CsUGT708AC25.1 / 2 The coding region is then augmented with NdeI and BamHI restriction enzyme sites. The restriction endonucleases NdeI (Thermo Scientific FastDigest NdeI) and BamHI (Thermo Scientific FastDigest BamHI) are then used to cleave the enzymes containing these sites. CsUGT708AC25.1 / 2 The recombinant plasmid was double-digested with the vector PMAL-c5X, then ligated using DNA Ligation Kit Ver.2.1 Solution Ⅰ ligase, and finally the recombinant plasmid was... CsUGT708AC25.1 / 2 -PMAL was transferred into E. coli Rosetta (DE3) to induce the expression of the fusion protein.
[0043] Specifically as follows: (1) Primers PMAL-CsUGT708A-NdeⅠ-F: CGCCATTGATGGGTGATCAAAAAATAGTTTCCG (SEQ ID NO: 17); PMAL-CsUGT708A-BamHI-R: CGGGATCCTTAGGCAGTCTCTGCAAGCCTCAAC (SEQ ID NO: 18); (2) For the system with added enzyme sites, refer to the instructions for KOD Plus-Neo high-fidelity enzyme (TOYOBO) and modify the annealing temperature to 55℃ and the extension time to 1 minute; (3) The enzyme digestion system and procedure were based on the instructions for NdeI (Thermo Scientific FastDigest NdeI) and BamHI (Thermo Scientific FastDigest BamHI). 1 μL of enzyme was added to each, and the program was modified to 37°C for 45 minutes. (4) The ligation reaction system consisted of 4 μL of cut gene plasmid, 1 μL of cut vector, and 5 μL of Solution I ligase, with parameters of 16℃ and 3 hours.
[0044] 2. Add 1 ml of *E. coli* containing the recombinant plasmid to 100 mL of liquid LB medium containing 50 μg / mL ampicillin. Shake at 37°C and 200 rpm until OD ≈ 0.4~0.6. Add isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. Incubate at 16°C and 150 rpm for 16 hours. Collect the cells by centrifugation at 4°C and 10000 rpm for 10 min. Resuspend each gram of cells in 5 ml of protein buffer I (CBI). Sonicate the cells on ice using a cell disruptor: ambient temperature 4°C, total duration 15 min, sonication for 3 seconds, pause for 3 seconds, 25% power. Centrifuge at 4°C and 10000 rpm for 10 min to collect the supernatant (crude extract). Dilute the crude extract at a volume ratio of 1:6 (crude extract: CBI). Then, use Amylose... Purification chromatography using Resin (BioLabs) linear starch resin.
[0045] (1) Column packing: Follow the instructions for BioLabs unpacked chromatography column (E0001); (2) Pour the linear starch resin into a 2.5×10 cm column and wash the column with 5 column volumes of CBⅠ; (3) Pour in the diluted crude extract at a maximum flow rate of 5 ml / min; (4) Wash with 12 column volumes of CBⅠ at a maximum flow rate of 10 mL / min; (5) Elute the fusion protein with 15 ml of protein buffer II (CBII) containing 10 mM maltose tag.
[0046] The target bands were determined by SDS-PAGE gel running, and the protein concentration was determined by the Easy Protein Quantitative Kit (Bradford). The purified proteins were named CsUGT708AC25.1 and CsUGT708AC25.2, respectively, as the experimental group for enzymatic characterization.
[0047] Similarly, the vector PMAL-c5X was transformed into Escherichia coli Rosetta (DE3), and the purified protein obtained was named empty vector protein as a negative control for enzymatic characterization, following method 2 of Example 2.
[0048] Protein Buffer I (CB I) formulation: 20 mM Tris-HCl (pH 7.4), 1 mM DTT, 1 mM EDTA-Na2, 200 mM NaCl, 10% (v / v) glycerol.
[0049] Protein Buffer II (CBII) formulation: 20mM Tris-HCl (pH 7.4), 1mM DTT, 1mM EDTA-Na2, 200mM NaCl, 10% (v / v) glycerol, 10mM maltose.
[0050] Example 3: Enzymatic characteristics of recombinant protein CsUGT708AC25.1 / 2 Enzyme activation reaction system: 0.1 mM substrate, 1 mM sugar donor, 100 mM Tris-HCl (pH 7.4), 1 mM DTT, 5 μg purified protein (obtained in Example 2), total volume 200 μl, made up to ddH2O. The mixture was incubated at 35 °C for 60 min, and the reaction was terminated by adding 50 μl of 1 M HCl. The mixture was filtered through a 0.22 μM organic phase membrane and analyzed using high-resolution liquid chromatography-quadrupole-orbital trap high-resolution mass spectrometry (UHPLC-Q Exactive-MS, Thermo Fisher), i.e., liquid chromatography coupled with mass spectrometry. The substrates used included 2-hydroxynaringenin, naringenin, sennain, apigenin, luteolin, and geraniol. The sugar donors used included UDP-glucose, UDP-mannose, and UDP-xylose. Each substrate and each of the three sugar donors was reacted once, for a total of 18 experimental groups. The reaction conditions for each experimental group were the enzyme activation reaction system described above.
[0051] The analytical conditions for UHPLC-Q Exactive-MS are as follows: (1) Liquid chromatography: The chromatographic column was a UMISIL™ C18 column (150 mm × 4.6 mm, pore size 80 Å, ThermoScientific). TM The aqueous phase consisted of 0.1% formic acid (phase A), and the organic phase consisted of methanol containing 0.1% formic acid (phase B). The gradient elution program, with a total duration of 18 min, was as follows: 0 min, 15% B; 8 min, 40% B; 12 min, 70% B; 14 min, 95% B; 15.9 min, 95% B; 16 min, 15% B; 18 min, stop. The flow rate was 0.6 ml / min, the column temperature was 35℃, and the full-band scanning was performed from 190 to 800 nm. The detection wavelengths were 280 nm and 350 nm.
[0052] (2) Mass spectrometry conditions: Run time 0~18min, positive ion channel, default charge 1. First-level scan: resolution 70000, AGC target value 3e6, maximum injection time 100ms, scan range 60~900m / z; Second-level fragmentation: resolution 17500, AGC target value 1e5, maximum injection time 50ms, number of cycles 5, TopN selection 5, isolation window 4.0m / z, collision energy 20, 40, 60; Advanced settings: minimum AGC threshold 8.00e3, intensity threshold 1.6e5, peptide matching priority enabled, isotope exclusion enabled, dynamic exclusion 10.0s.
[0053] Previous research indicates that 2-hydroxynaringenin readily undergoes dehydroxylation and spontaneously transforms into apigenin under acidic conditions; 2-hydroxynaringenin's... C The glycosides are vitexin and isovitexin, which are isomers.
[0054] Therefore, under the above conditions, enzyme function was verified using 2-hydroxynaringenin as the substrate and UDP-glucose as the sugar donor. Two experimental groups were set up: the purified protein of experimental group 1 was CsUGT708AC25.1 protein, and the purified protein of experimental group 2 was CsUGT708AC25.2 protein. The purified protein of the negative control was an empty vector protein. For ease of detection, a mixed standard containing 2-hydroxynaringenin and its possible derivatives was set up, including 2-hydroxynaringenin (S1), apigenin (S2), vitexin (P1), and isovitexin (P2).
[0055] The mass spectrometry analysis results of UHPLC-Q Exactive-MS are as follows: Figure 3 As shown, in positive ion mode (60–900 m / z), scans were performed using ions of apigenin (m / z = 271.0587–271.0615), 2-hydroxynaringenin (m / z = 289.0693–289.0721), and vitexin / isovitexin (m / z = 433.1107–433.1151). Comparison with mixed standards revealed the detection of glycosylated products vitexin (P1) and isovitexin (P2) in the enzyme-added system, while no corresponding glycosylated products were detected in the empty protein vector. In conclusion, CsUGT708AC25.1 / 2 can catalyze the conversion of 2-hydroxynaringenin to vitexin and isovitexin, suggesting that vitexin and isovitexin are involved in the regulation of internodes in tea plants.
[0056] Enzyme kinetic parameters were analyzed using 2-hydroxynaringenin as a substrate and UDP-glucose as a sugar donor. For example... Figure 4 As shown, the optimal reaction conditions for CsUGT708AC25.1 were first determined to be pH=8.5 and 35℃. Figure 4(A and B in the text); The optimal reaction conditions for CsUGT708AC25.2 are pH=7, 35℃ ( Figure 4 (D and E in the figure). Under optimal conditions, enzyme kinetic analysis was performed using 25–150 µM substrate and 1 mM sugar donor, with at least three replicates. The Km value was calculated using the Michaelis-Menten equation. The enzyme kinetic curves are shown in the figure. Figure 5 As shown, the Michaelis constant (Km) of CsUGT708AC25.1 is 47.53±11.62µM, and the catalytic constant (Kcat) is 2.37±0.00x10⁻¹⁰. -4 S -1 The catalytic efficiency (Kcat / Km) was 4.99 ± 1.22 M. -1 s -1 The Michaelis constant (Km) of CsUGT708AC25.2 is 72.95 ± 12.03, and the catalytic constant (Kcat) is 1.629 ± 0.00 x 10⁻⁶. -4 S -1 The catalytic efficiency (Kcat / Km) was 2.23 ± 0.37 M. -1 s -1 In summary, the enzyme activity of CsUGT708AC25.1 is higher than that of CsUGT708AC25.2, meaning that CsUGT708AC25.1 has a greater ability to produce vitexin and isovitexin than CsUGT708AC25.2. This difference in enzyme activity, leading to the difference in the accumulation of vitexin and isovitexin in the internodes, may be an important reason for the internode differences among tea varieties.
[0057] Example 4: Antisense inhibition of CsUGT708AC25.1 / 2 in tea Using the Solido online primer design software, submit the obtained SEQ ID No: 1 and SEQ ID No: 2 nucleotide sequences. Based on the calculation results, obtain the inhibition primers (antisense primer-1 to antisense primer-5) and negative control primers (positive primer-1 to positive primer-5), and have them synthesized by the corresponding companies. The specific primer sequences are as follows: (1) CsUGT708AC25.1 Related primers CsUGT708AC25.1 Justice primer-1: 5' GCATGGGTCATCTGACTCCG 3' (SEQ ID NO: 19); CsUGT708AC25.1 Primer-2: 5' AATCCTTCCCCGTAAGCCCC 3' (SEQ ID NO: 20); CsUGT708AC25.1Primer-3: 5' ATCCGATGACTATGTGCACA 3' (SEQ ID NO: 21); CsUGT708AC25.1 Justice primer-4: 5' CTCGAAAAAGGAGAACAACT 3' (SEQ ID NO: 22); CsUGT708AC25.1 Primer-5: 5' GACCAGAGGGTGATTTCAGA 3' (SEQ ID NO: 23); CsUGT708AC25.1 Antisense primer-1: 5' CGGAGTCAGATGACCCATGC 3'; CsUGT708AC25.1 Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3'; CsUGT708AC25.1 Antisense primer-3: 5' TGTGCACATAGTCATCGGAT 3'; CsUGT708AC25.1 Antisense primer-4: 5' AGTTGTTCTCCTTTTTCGAG 3'; CsUGT708AC25.1 Antisense primer-5: 5' TCTGAAATCACCCTCTGGTC 3'; (2) CsUGT708AC25.2 Related primers CsUGT708AC25.2 Justice primer-1: 5' CATGGGTCATCTGACTCCGG 3' (SEQ ID NO: 24); CsUGT708AC25.2 Primer-2: 5' AATCCTTCCCCGTAAGCCCC 3' (SEQ ID NO: 25); CsUGT708AC25.2 Primer-3: 5' ATTACGTTCTCTCCGTTACC 3' (SEQ ID NO: 26); CsUGT708AC25.2 Primer-4: 5' ATCCGATGACTATGTGCACA 3' (SEQ ID NO: 27); CsUGT708AC25.2 Primer-5: 5' GTCTTAAGTAACCTCCCACC 3' (SEQ ID NO: 28); CsUGT708AC25.2 Antisense primer-1: 5' CCGGAGTCAGATGACCCATG 3'; CsUGT708AC25.1Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3'; CsUGT708AC25.1 Antisense primer-3: 5' GGTAACGGAGAGAACGTAAT 3'; CsUGT708AC25.1 Antisense primer-4: 5' TGTGCACATAGTCATCGGAT 3'; CsUGT708AC25.1 Antisense primer-5: 5' GGTGGGAGGTTACTTAAGAC 3'.
[0058] for CsUGT708AC25.1 The above five types CsUGT708AC25.1 Equal volumes of antisense primers were mixed and diluted with distilled water to prepare an inhibition treatment solution containing 20 μM of each primer; the five primers were then... CsUGT708AC25.1 Equal volumes of positive primers were mixed and diluted with distilled water to prepare a negative control solution containing 20 μM of each positive primer. Simultaneously, using distilled water as a blank control, one bud and one leaf from each of the spring YMX tea tree shoots were randomly placed in the blank control solution for 3 days as the blank control group (abbreviated as blank), in the inhibition treatment solution for 3 days as the inhibition group (Antisense, abbreviated as AS), and in the negative control solution for 3 days as the negative control group (sense, abbreviated as S). Figure 6 As shown in Figure A, compared with the blank control group and the negative control group (S), the gene expression level in the inhibition group (AS) was significantly decreased. P <0.05) indicates that silencing is effective, meaning the inhibition group is [missing value]. CsUGT708AC25.1 The silent strain.
[0059] Similarly, for CsUGT708AC25.2 The above five types CsUGT708AC25.2 Equal volumes of antisense primers were mixed and diluted with distilled water to prepare an inhibition treatment solution containing 20 μM of each primer; the five primers were then... CsUGT708AC25.2 Equal volumes of positive primers were mixed and diluted with distilled water to prepare a negative control solution containing 20 μM of each positive primer. Simultaneously, using distilled water as a blank control, one bud and one leaf from each of the spring shoots of JHZ tea trees were randomly placed in the blank control solution for 3 days as the blank control group (abbreviated as blank), in the inhibition treatment solution for 3 days as the inhibition group (Antisense, abbreviated as AS), and in the negative control solution for 3 days as the negative control group (sense, abbreviated as S). Figure 6 As shown in C, compared with the blank control group and the negative control group (S), the gene expression level in the inhibition group (AS) was significantly decreased. P <0.05) indicates that silencing is effective, meaning the inhibition group is [missing value]. CsUGT708AC25.2 The silent strain.
[0060] Subsequently, UHPLC-Q Exactive-MS was used for detection. CsUGT708AC25.1 and CsUGT708AC25.2 The contents of vitexin and isovitexin in the silent strain were detected using the same UHPLC-Q Exactive-MS analytical conditions as in Example 3. Figure 6 As shown in B, CsUGT708AC25.1 The levels of vitexin, isovitexin, and total vitexin and isovitexin in the silent strain (AS) were all lower than those in the blank control group and the negative control group (S). Figure 6 As shown in D, CsUGT708AC25.2 The content of vitexin, isovitexin, and the total amount of vitexin and isovitexin in the silent strain (AS) were all lower than those in the blank control group and the negative control group (S). In vivo experiments confirmed that inhibiting CsUGT708AC25.1 / 2 reduces the content of vitexin and isovitexin, indicating that CsUGT708AC25.1 / 2 has the function of catalyzing the formation of vitexin and isovitexin.
[0061] Example 5: Construction of CsUGT708AC25.1 / 2 transgenic material 1. Construct pBWA(V)HS-3xflag -CsUGT708AC25.1 / 2 plasmid The conventional homologous recombination method was employed: PCR amplification of the target gene was performed using homologous arm primers; the vector pBWA(V)HS-3xflag (Boyuan Biotechnology, patent number US10144936B2) was double-digested with restriction endonucleases BsaⅠ (Biorun) and Eco31Ⅰ (Biorun); and then recombination was carried out using 2×EasyClone Mix (Biorun). CsUGT708AC25.1 / 2 Recombinant plasmids ( Figure 7 Transformed Escherichia coli DH5α, plated on solid LB medium containing kanamycin, incubated at 37°C for 12 h, and colony PCR was performed for identification and sequencing.
[0062] CsUGT708AC25.1 Homologous arm primers: Primer F: ATAAAGATGATGATGATAAAatgggtgatcaaaaaatagtttccgcgtcac (SEQ IDNO: 29); Primer R: TGAAGACAGAGCTAGTTACAttaggcagtctctgcaagcctcaac (SEQ ID NO: 30); CsUGT708AC25.2 Homologous arm primers: Primer F: ATAAAGATGATGATGATAAAatgsgtgatcaaaaaatagtttccgcatcacc (SEQ IDNO: 31); Primer R: TGAAGACAGAGCTAGTTACAttaggcagtctctgcaagcctcaac (SEQ ID NO: 32); Thus, pBWA(V)HS-3xflag- is obtained accordingly. CsUGT708AC25.1 / 2 Recombinant plasmid.
[0063] 2. CsUGT708AC25.1 / 2 Overexpression of 84K poplar 1µl pBWA(V)HS-3xflag- CsUGT708AC25.1 / 2 The recombinant plasmid was added to 50 µl of EHA105 Agrobacterium competent cells, mixed thoroughly, and then transferred to an electroporation cuvette. After electroporation, 1 mL of LB liquid medium was added, and the cells were incubated at 30 °C and 180 rpm for 30 min. 50 µl of the activated Agrobacterium culture was then inoculated onto LB solid medium and incubated in the dark at 30 °C for 48 h. Colony PCR was performed to verify the colony, and sequencing was used for confirmation.
[0064] The correctly sequenced strains were infected with 84K poplar trees, followed by callus induction screening, differentiation screening, and rooting screening. Finally, genomic DNA was extracted from the poplar trees using the CTAB method, and PCR detection was performed to screen for resistant seedlings (conventional method), resulting in two overexpression lines. The wild-type and transgenic materials were planted in the same greenhouse at the Tea Research Institute of the Chinese Academy of Agricultural Sciences, and photographs were taken at 175 days of growth. Figure 8 As shown, 84K represents the wild type. CsUGT708AC25.1 -OE-L7 and L3 represent CsUGT708AC25.1 Overexpression lines. CsUGT708AC25.2 -OE-L7 and L2 represent CsUGT708AC25.2 Overexpression strains. CsUGT708AC25.1 -OE strains have shorter internode lengths than CsUGT708AC25.2 -OE strains, both shorter than the control (84K and EV-1 / 2). In summary, CsUGT708AC25.1 / 2 Genes negatively regulate internode length in poplar trees.
[0065] Example 6: Exogenous application of vitexin and isovitexin to inhibit internode growth in plants 1. Exogenous application of vitexin and isovitexin leads to shortening of internodes in poplar trees. Using 84K poplar as experimental material, the first two sections of the poplar were cut under a sterile operating table and transferred with forceps to blank internode tissue culture, internode tissue culture 1, and internode tissue culture 2. The tissue culture bottles were placed in the same artificial climate chamber at the Tea Research Institute of the Chinese Academy of Agricultural Sciences (25℃, 50% humidity, 3000Lx white light, 16h; 25℃, 50% humidity, 8h darkness) to observe the growth of the poplar internodes. Figure 9 As shown, the blank (blank intersegmental culture) shows 2 biological replicates, intersegmental culture 1 shows 4 biological replicates, and intersegmental culture 2 shows 4 biological replicates.
[0066] The formula used is as follows: (1) Blank intersegmental culture: 2.215g 1 / 2MS (PhytoTech), 15g sucrose (Maclean), 101.62μl IBA (PhytoTech), 8g agar (PhytoTech), 2000μl dimethyl sulfoxide in 1L of ultrapure water; (2) Internode tissue culture 1: 2.215g 1 / 2MS (PhytoTech), 15g sucrose (Maclean), 101.62μl IBA (PhytoTech), 8g agar (PhytoTech), 2000μl 100mM vitexin in 1L of ultrapure water; (3) Internode culture 2: 2.215g 1 / 2MS (PhytoTech), 15g sucrose (Maclean), 101.62μl IBA (PhytoTech), 8g agar (PhytoTech), 2000μl 100mM vitexin in 1L of ultrapure water.
[0067] After 45 days of cultivation and growth, the experimental results are as follows: Figure 9 As shown, the internode length of poplar trees treated with internode tissue culture 1 and internode tissue culture 2 was significantly shorter than that of poplar trees treated with blank internode tissue culture, and the inhibitory effect of internode tissue culture 2 was better than that of internode tissue culture 1.
[0068] 2. Exogenous application of vitexin and isovitexin leads to shortened internodes in tea trees. Using cuttings of Longjing 43 (LJ43) and Wuyi Narcissus (WYSX) grown in a smart greenhouse (16h 26℃ light, 8h 24℃ darkness; 60% humidity) as experimental subjects, and a blank internode mixture as a control, internode spray solution 1 and internode spray solution 2 were evenly sprayed onto the entire plant, once every 2 days for 15 days, and the internode growth of new shoots was continuously observed. Figure 10As shown, the blank of Longjing 43 (i.e., the blank internode mixture) showed 2 biological replicates, the internode spray solution 1 showed 3 biological replicates, and the internode spray solution 2 showed 3 biological replicates; the blank of Wuyi Narcissus showed 1 biological replicate, the internode spray solution 1 showed 3 biological replicates, and the internode spray solution 2 showed 3 biological replicates.
[0069] The formula used is as follows: (1) Blank intersegmental mixture: 1 ml DMSO, 500 μl Tween 20 in 500 ml ddH2O; (2) Internode spray solution 1: 1 ml 100 mM vitexin, 500 μl Tween 20 in 500 ml ddH2O; (3) Internode spray solution 2: 1 ml 100 mM isovitol, 500 μl Tween 20 in 500 ml ddH2O.
[0070] Experimental results are as follows Figure 10 As shown, Longjing 43 ( Figure 10 A in the middle) and Wuyi narcissus ( Figure 10 In B), the same experimental results were observed: the internode length corresponding to internode spray solution 2 ≤ the internode length corresponding to internode spray solution 1 < the internode length corresponding to the blank.
[0071] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. A method for identifying whether a plant belongs to a short-internode plant using molecular markers at the seedling stage, characterized in that... Includes the following steps: 1) Extract RNA from the plants to be tested and reverse transcribe it into cDNA. The plant in question is a tea tree; 2) Amplification using molecular marker primers Marker0927 and Marker1125 CsUGT708AC25 Encoding area; Marker0927: 5'-TTATTTTTCTAAAACAAAATGCCAC-3' Marker1125: 5'-CAAACTTCAAATTGGAAATTACAAA-3'; When the amplification result is Cs UGT708AC25.1 If the genotype is determined, the plant to be tested is identified as a short-internode plant; When the amplification result is Cs UGT708AC25.2 If the genotype is determined, the plant to be tested is identified as a long-internode plant; Cs UGT708AC25.1 The nucleotide sequence of the gene is as described in SEQ ID NO: 1, Cs UGT708AC25.2 The nucleotide sequence of the gene is as described in SEQ ID NO:
2. 2.Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 The uses of genes are characterized by: Overexpression of Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 Genes negatively regulate internode length in plants; Cs UGT708AC25.1 The nucleotide sequence of the gene is as described in SEQ ID NO: 1, Cs UGT708AC25.2 The nucleotide sequence of the gene is as described in SEQ ID NO: 2; The plant in question is a poplar.
3. The Cs according to claim 2 UGT708AC25.1 Genes, Cs UGT708AC25.2 The uses of genes are characterized by: Cs UGT708AC25.1 Genes, Cs UGT708AC25.2 All genes reduce internode length in poplar trees, and CsUGT708AC25.1 The inhibitory effect is stronger than CsUGT708AC25.2 .
4. A method for inhibiting the content of vitexin and isovitexin in tea plants, characterized in that: The CsUGT708AC25.1 and CsUGT708AC25.2 genes in the silent tea plant; The nucleotide sequence of the CsUGT708AC25.1 gene is as described in SEQ ID NO:1, and the nucleotide sequence of the CsUGT708AC25.2 gene is as described in SEQ ID NO:
2.
5. The method according to claim 4, characterized in that: CsUGT708AC25.1 The relevant primers are: CsUGT708AC25.1 Antisense primer-1: 5' CGGAGTCAGATGACCCATGC 3' CsUGT708AC25.1 Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3' CsUGT708AC25.1 Antisense primer-3: 5' TGTGCACATAGTCATCGGAT 3' CsUGT708AC25.1 Antisense primer-4: 5' AGTTGTTCTCCTTTTTCGAG 3' CsUGT708AC25.1 Antisense primer-5: 5' TCTGAAATCACCCTCTGGTC 3' CsUGT708AC25.2 The relevant primers are: CsUGT708AC25.2 Antisense primer-1: 5' CCGGAGTCAGATGACCCATG 3' CsUGT708AC25.2 Antisense primer-2: 5' GGGGCTTACGGGGAAGGATT 3' CsUGT708AC25.2 Antisense primer-3: 5' GGTAACGGAGAGAACGTAAT 3' CsUGT708AC25.2 Antisense primer-4: 5' TGTGCACATAGTCATCGGAT 3' CsUGT708AC25.2 Antisense primer-5: 5' GGTGGGAGGTTACTTAAGAC 3'.
Citation Information
Patent Citations
Application of tea tree UGT708AC25 gene
CN118048390A
Method of assembling multi-fragment DNA molecule and use thereof
US10144936B2
Plants with useful traits and related methods
CN103796508A
Tea tree flavonoid glycosyl transferase and application thereof
CN116004563A