Application of tabhlh27 gene in improving nitrogen utilization efficiency of plants

Abstract

This invention discloses a TabHLH27 The application of genes in improving nitrogen use efficiency in plants, the TabHLH27 The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022214.1, CM022215.1, and CM022216.1 in NCBI, respectively. This invention constructs... TabHLH27 overexpression vector ， Wheat KN199 was overexpressed by Agrobacterium infection; wheat KN199 was then directionally edited using CRISPR-Cas9 technology to obtain... TabHLH27 Loss-of-function mutant material. Transient nitrogen signal induction indicates that... TabHLH27 It can be induced to express by nitrogen; hydroponic experiments showed that the root system of the overexpression material was more developed compared to the wild type KN199. TabHLH27 The loss-of-function mutant exhibits weaker root development and loses its response to low nitrogen levels. This means the TabHLH27 gene can respond to changes in nitrogen levels and promote wheat root development, thus providing genetic resources for nitrogen-efficient crop breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving TabHLH27 Application of genes in improving nitrogen use efficiency in plants. Background Technology

[0002] Nitrogen is an essential nutrient for crop growth and development. Nitrogen fertilizer can significantly increase crop yield. However, in wheat and rice, the application of nitrogen fertilizer can significantly increase plant height, leading to lodging and reduced yield. To overcome this problem, breeders have developed dwarf, nitrogen-insensitive cultivars. Reduced height-1 ( Rht-1 Mutations in certain genes have endowed wheat varieties with dwarf characteristics, meaning that nitrogen fertilizer application does not significantly increase plant height, thus improving wheat yield. However, these dwarf varieties have lower nitrogen use efficiency (NUE), meaning that higher nitrogen fertilizer inputs only yield limited increases. Only 40% to 50% of the applied nitrogen fertilizer is absorbed and utilized by the crop, resulting in significant nitrogen loss. This lost nitrogen undergoes a series of reactions, producing harmful gases such as NH3 and N2O, severely damaging the ecological environment and causing severe soil acidification and eutrophication of water bodies. Therefore, while ensuring high crop yields, reducing nitrogen fertilizer use and improving crop NUE are crucial for green and sustainable agricultural development.

[0003] Under conditions of reduced nitrogen fertilizer application, nitrogen uptake efficiency (NUpE) significantly impacts NUE. As the primary site for nitrogen absorption in crops, the root system's ability to absorb nitrogen ultimately determines NUE, affecting crop yield. Well-developed root systems typically exhibit higher nitrogen use efficiency. Crop roots can respond to nitrate signals, thereby regulating root development. Crop roots exhibit adaptive changes in root morphology under different nitrogen environments, responding to the form, content, and distribution of nitrogen in the soil, as well as the nitrogen status within the plant. This adaptation is particularly pronounced due to the uneven distribution of nitrogen in the soil. Nitrate nitrogen promotes root elongation; in severe nitrogen deficiency, the growth of both taproots and lateral roots is inhibited. Conversely, in mild nitrogen deficiency, root length increases to enhance nitrogen uptake. Root hair length and density are also regulated by nitrogen, further optimizing the root system's ability to search for nutrients.

[0004] Previous studies have reported that some plant hormone-related components can regulate root structure in crops under different nitrogen levels. The interaction between OsNAR2.1, a chaperone protein of the high-affinity nitrate transporter in rice, and OsNIT1 and OsNIT2, which promote the biosynthesis of major auxins, affects the growth of primary and lateral roots in rice. RNR10 negatively regulates the root response to nitrogen in rice by stabilizing the auxin biosynthesis inhibitor DNR1. Under different nitrogen application treatments, rnr10 enhances the root response to nitrogen and increases grain yield. In rice, the transcription factor Nhd1 not only regulates flowering time but also promotes root growth and nitrogen use by activating OsNRT2.4 and OsAMT1.3. In wheat, the homolog of Arabidopsis TAR2... TaTAR2.1 Lateral root growth can be altered by regulating auxin synthesis. Under different nitrogen conditions, TaTAR2.1 Overexpression of these substances significantly promoted lateral root growth and grain yield. Furthermore, mutants of the nitrate transporter TaNPF2.12, the bZIP family transcription factor OsbZIP1, and ZmTGA in wheat, rice, and maize all exhibited increased root length under low nitrogen conditions.

[0005] Given the adverse effects of excessive nitrogen fertilizer use on the ecological environment, this study aims to identify key genes involved in nitrogen-responsive root development and create transgenic materials using transgenic technology for in-depth research into the gene functions and mechanisms by which wheat responds to nitrogen signals and regulates root development. This will provide a solid research foundation for the creation and breeding of nitrogen-efficient wheat varieties. Summary of the Invention

[0006] The purpose of this invention is to provide TabHLH27 Application of genes in improving nitrogen use efficiency in plants.

[0007] To achieve the above objectives, the technical solution adopted by this invention is summarized as follows: The present invention adopts TabHLH27 The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022214.1, CM022215.1, and CM022216.1 in NCBI, respectively. TabHLH27-2A The messenger RNA (mRNA) sequence of the gene is 2,740 bp in length. TabHLH27-2A The coding sequence of the gene is 837 bp in length, and the nucleotide sequence is shown in SEQ ID NO.1, which includes 278 amino acids, and the amino acid sequence is shown in SEQ ID NO.4. TabHLH27-2B The messenger RNA (mRNA) sequence of the gene is 2,598 bp in length. TabHLH27-2BThe coding sequence of the gene is 837 bp in length, and the nucleotide sequence is shown in SEQ ID NO.2, which includes 278 amino acids, and the amino acid sequence is shown in SEQ ID NO.5. TabHLH27-2D The messenger RNA (mRNA) sequence of the gene is 2,519 bp in length. TabHLH27-2D The coding sequence of the gene is 837 bp in length, and the nucleotide sequence is shown in SEQ ID NO.3, which includes 278 amino acids, and the amino acid sequence is shown in SEQ ID NO.6.

[0008] The present invention also provides the above. TabHLH27 Application of genes in improving nitrogen use efficiency in plants.

[0009] The present invention also constructs a series of plant expression vectors, and the functions of expression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in improving the nitrogen efficiency of plants also fall within the protection scope of the present invention.

[0010] The functions of the genes protected by this invention include not only those described above. TabHLH27 Genes, including those related to TabHLH27 Homologous genes with high homology (up to 99%) have functions in nitrogen-efficient utilization.

[0011] The present invention discloses TabHLH27 The biological function of the gene in improving nitrogen use efficiency in plants is specifically manifested in the following ways: compared to the wild type KN199, under high-nitrogen hydroponic conditions, TabHLH27 The root system of plants that overexpress this substance is more developed.

[0012] Based on their function, plants with high nitrogen use efficiency can be obtained through genetic modification. Specifically, this can be achieved by... TabHLH27 Genes are introduced into target plants to obtain transgenic plants, which have higher nitrogen utilization efficiency than the target plants.

[0013] Specifically, TabHLH27 The gene can be introduced into the target plant via the recombinant expression vector. In this method, the recombinant expression vector can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0014] To improve the desirable traits of plants, this invention also protects a novel plant breeding method that can improve plant traits by "regulating the growth of certain plant components". TabHLH27 The method of "gene expression" is used to obtain plants with altered nitrogen use capacity. Among them, "regulating the expression of nitrogen in plants" is used to obtain plants with altered nitrogen use capacity. TabHLH27Gene expression can occur through overexpression, silencing, gene editing, or directed mutation. TabHLH27 Genes. Regulation of gene expression levels includes using DNA homologous recombination technology, virus-mediated gene silencing technology, and Agrobacterium-mediated transformation systems to regulate the aforementioned... TabHLH27 Expression was used to obtain transgenic plant lines.

[0015] More specifically, the method may be one of the following (1), (2), or (3): (1) By increasing the content of the target plant TabHLH27 To improve the activity of proteins and obtain plants with higher nitrogen utilization efficiency than the target plant. (2) By promoting the growth of target plants TabHLH27 Gene expression was used to obtain plants with higher nitrogen use efficiency than the target plant. (3) By inhibiting the target plant TabHLH27 Gene expression was used to obtain plants with nitrogen use efficiency lower than that of the target plant.

[0016] "Promote the target plant" TabHLH27 The expression of genes can be achieved in the following ways: (1) or (2) or (3): (1) TabHLH27 Genes are introduced into the target plant; (2) Introduce strong promoters and / or enhancers; (3) Other common methods in the field, such as overexpression.

[0017] "Inhibit the target plant" TabHLH27 The expression of the gene can be achieved by obtaining a gene loss mutant using CRISPR / Cas9 technology.

[0018] The target plant of this invention is wheat.

[0019] In this invention, there are no particular limitations on the plants suitable for gene transformation, as long as they are suitable for gene transformation operations, such as various crops, flowering plants, or forestry plants. The plants may be (but are not limited to): dicotyledons, monocotyledons, or gymnosperms.

[0020] As a preferred approach, the term "plant" includes, but is not limited to, wheat and Arabidopsis thaliana; any plant possessing the gene or a homologous gene is applicable.

[0021] The term "plant" as used in this invention includes the whole plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain our target gene or nucleic acid. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores; similarly, each of these objects contains the target gene / nucleic acid.

[0022] This invention includes any plant cell, or any plant obtained or obtainable by the methods described herein, as well as all plant parts and their propagules. This invention also includes transfected cells, tissues, organs, or whole plants obtained by any of the foregoing methods. The only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that offspring obtained using the methods of this invention have identical characteristics.

[0023] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0024] Advantages of this invention: (1) This invention uses multi-omics joint analysis to innovatively explore wheat ( Triticum aestivum L.) regulates root development TabHLH27 In wild-type wheat KN199, a [synthetic / ... TabHLH27 Analysis of the mutant plants showed that, compared to the wild type, in hydroponic experiments under different nitrogen conditions, TabHLH27 Gene mutations can inhibit root development in wheat under low nitrogen conditions, providing gene resources for nitrogen-efficient crop breeding. Furthermore, overexpression... TabHLH27 Gene analysis revealed that overexpressed plants had better root development than wild-type plants, indicating that TabHLH27 can promote root development and thus improve nitrogen utilization efficiency.

[0025] (2) Plants with high nitrogen use efficiency can be obtained through genetic modification. Specifically, this can be achieved by... TabHLH27 Genes were transferred into target plants to obtain transgenic plants. These plants had higher nitrogen use efficiency than wild control plants, providing a new approach for high-efficiency nitrogen breeding in plants. Attached Figure Description

[0026] Figure 1 yes TabHLH27 The nucleotide and amino acid sequences of homologous genes from the three subgenomes of the gene. Among them, Figure 1A, 1B, and 1C correspond to respectively TabHLH27-2A ,yes TabHLH27-2B ,yes TabHLH27-2D nucleotide sequence; Figure 1 D, 1E, and 1F correspond to respectively TabHLH27-2A ,yes TabHLH27-2B ,yes TabHLH27-2D The amino acid sequence.

[0027] Figure 2 This is a set of potential candidate genes coordinating H3K27ac in the nitrogen response process. Among them, Figure 2 A represents the coordinated change pattern between the transcriptome and H3K27ac during the nitrogen response; Figure 2 B is a family of transcription factors enriched in the dynamic H3K27ac region; Figure 2 C represents the transcriptional level of target genes from different transcription factor families.

[0028] Figure 3 It represents the transcriptional level of different genes in the bHLH family during the dynamic changes in nitrogen.

[0029] Figure 4 yes TabHLH27 Gene responses to nitrogen and overexpression phenotypes. Among them, Figure 4 A is TabHLH27 Transcriptional levels of genes after being affected by nitrate signaling; Figure 4 B is TabHLH27 Protein expression levels; Figure 4 C is TabHLH27 Hydroponic phenotype of gene overexpression materials.

[0030] Figure 5 yes TabHLH27 Statistical results of root indexes of overexpression materials.

[0031] Figure 6 yes TabHLH27 Genotyping results of CRISPR mutants of the gene.

[0032] Figure 7 yes TabHLH27 Phenotypic analysis of mutant plants under high-nitrogen and low-nitrogen hydroponic conditions. In the figure, KN199 is the wild-type control, and TabHLH27-cr1 and TabHLH27-cr2 are... TabHLH27 The mutant strains; HN represents a high-nitrogen environment, and LN represents a low-nitrogen environment. Detailed Implementation

[0033] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be more thorough in understanding and will fully convey the scope of the invention to those skilled in the art.

[0034] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0036] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the gene editing methods, gene editing vector construction methods, and gene-edited plant acquisition methods employed in this invention, except for those used in the following embodiments, can all be implemented using methods already disclosed in existing literature.

[0037] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0038] biomaterials Wheat KN199 seeds were preserved in the laboratory; Primer synthesis and sequencing were completed by BGI Genomics Co., Ltd. The CRISPR genetic transformation materials were provided by Weimi Biotechnology Co., Ltd.

[0039] Example 1 TabHLH27 Acquisition of genes Adopted TabHLH27The homologous genes of the three subgenomes of the gene correspond to GenBank numbers CM022214.1, CM022215.1, and CM022216.1 in NCBI, respectively. TabHLH27-2A The messenger RNA (mRNA) sequence of the gene is 2,740 bp in length. TabHLH27-2A The coding sequence of the gene is 837 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in Figure A, it includes 278 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in D. TabHLH27-2B The messenger RNA (mRNA) sequence of the gene is 2,598 bp in length. TabHLH27-2B The coding sequence of the gene is 837 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in B, it includes 278 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in E. TabHLH27-2D The messenger RNA (mRNA) sequence of the gene is 2,519 bp in length. TabHLH27-2D The coding sequence of the gene is 837 bp in length, and the nucleotide sequence is as follows: Figure 1 As shown in C, it includes 278 amino acids, and the amino acid sequence is as follows: Figure 1 As shown in F. Specifically, the key genes regulating the H3K27ac-mediated nitrogen response were identified using the following methods.

[0040] The expression of H3K27ac transcriptome and histone modifications in the roots of nitrogen-efficient cultivar KN9204 and nitrogen-inefficient cultivar J411 was determined by measuring their expression under high-nitrogen and low-nitrogen conditions at different growth stages (A: one leaf and one bud; B: two leaves and one bud; C: three leaves and one bud; D: four leaves and one bud). It was found that genes highly expressed under low-nitrogen conditions at stage D... bHLH27 The correlation between gene expression and H3K27ac was higher. Figure 2 A) indicates that H3K27ac mediates the expression of more nitrogen-responsive genes during period D. To detect recruitment factors mediating dynamic H3K27ac changes, we downloaded the plant motif position weight matrix from the JASPAR database and scanned transcription factor binding motifs in these H3K27ac regions within a dynamic range using FIMO (4.11.2). We then performed enrichment tests on the detected motifs using Fisher's test in R. The results showed that transcription factor families such as bHLH, ERF, and LBD were enriched in regions with low nitrogen transcriptional changes and dynamic H3K27ac changes. Figure 2 B). The bHLH transcription factor family exhibits stronger transcriptional activation activity against target genes in KN9204 and J411 compared to the ERF and LBD families. Figure 2C). Further analysis of the bHLH family genes revealed that the TabHLH27 gene and its homologs were significantly overexpressed during the low-nitrogen period in stage D. Figure 3 This suggests that it is a key gene that may regulate the nitrogen response mediated by H3K27ac.

[0041] Example 2 TabHLH27 Gene response trends to nitrogen Seeds of wheat variety KN9204 were soaked in 0.3% H2O2 at 4℃ for 24 h. After germination, the seeds were placed in a hydroponic container and cultured in pure water for 2 days, followed by a high-nitrogen (3 mM NO3) environment. - After culturing in a low-nitrogen environment for 7 days, the samples were transferred to a low-nitrogen environment (0.04 mM NO3). - After 3 days of environmental starvation, the environment was then placed in a high-nitrogen (3 mM NO3) environment. - In an intensive environment, root tissues were collected at different time points (0h, 0.25h, 0.5h, 1h, 3h, 6h, 18h) and flash-frozen in liquid nitrogen. Total RNA was extracted from the samples using a universal plant RNA extraction kit (Huayueyang Company). Specific experimental procedures were performed according to the corresponding kit instructions. Reverse transcription and real-time quantitative PCR were then performed. The primers for the quantitative PCR were as follows: TabHLH27-2A-qPCR-F: GCTACACCCGTTTATATGTGTGG TabHLH27-2A-qPCR-R:GTCCAGAAGCATATCATGCAATGC TabHLH27-2B-qPCR-F:CATGGGGAGCCCGCCGCTTAGTT TabHLH27-2B-qPCR-R:CGACGAGTAAATCTGAATGGAGG TabHLH27-2D-qPCR-F: GATGGACCGCTTCGAGATGAAG TabHLH27-2D-qPCR-R:GCCTTGCAAAAGAGAGACTAGGTG The results revealed different subgenomes. TabHLH27 The gene can be induced in a short period of time, reaching a peak at 1 hour and then gradually declining, with no significant difference in expression levels among different subgenomes. Figure 4 A), and the classic nitrogen-responsive gene (NLP7), have a similar expression pattern, indicating that... TabHLH27 Genes can respond to changes in nitrogen levels.

[0042] Example 3 Overexpression TabHLH27 Functional identification of transgenic plants For further analysis TabHLH27 The inventor built the functionality. TabHLH27 overexpression vector LGY-OE- TabHLH27 Overexpression of wheat plants was obtained. The brief process is as follows.

[0043] First, the LGY-OE vector was digested with BamHI, and the digestion products were recovered by gel extraction.

[0044] Second, TabHLH27 The coding sequence and the enzyme-digested vector were homologously ligated to construct LGY-OE- TabHLH27 Overexpression vector.

[0045] Third, the ligation product was transformed into E. coli DH5α, and kanamycin (50 μg / mL) resistance was screened. Single clones were selected for PCR detection and sequencing. Plasmids were extracted from the bacterial cultures with correct sequencing for later use.

[0046] Fourth, the extracted plasmid was transformed into Agrobacterium competent cells GV3101.

[0047] Fifth, by using Agrobacterium to infect wild-type wheat KN199, the successfully transformed seedlings were identified and propagated to obtain T2 or even T3 generation overexpression plants.

[0048] Western blotting was used to identify the expression in overexpressing plants. TabHLH27 The protein expression levels were observed. The results showed that... TabHLH27 In overexpression lines OE1 and OE2, TabHLH27 The protein expression level was significantly higher than that of the control variety KN199. Figure 4 B). This indicates that the constructed TabHLH27 Genetically modified wheat is LGY-OE- TabHLH27 Overexpressing plants.

[0049] For wild-type KN199 and TabHLH27 Seeds of the overexpression material were soaked in 0.3% H2O2 at 4℃ for 24 h. After germination, the seeds were placed in a hydroponic box and cultured in pure water for 2 days, followed by a high-nitrogen (3 mM NO3) environment. - The plants were cultured in an environment for 14 days. Roots were scanned using an EPSON scanner, and root data were extracted from the images using WinRHIZO software. It was found that the roots of the overexpression materials OE1 and OE2 were longer and had more lateral roots than the control variety KN199. Figure 4C). Statistical analysis of specific root phenotypes revealed that the overexpressing material OE2 was greater than the control variety KN199 in total root length, root surface area, and root volume. Although OE1 did not show statistical significance, a certain trend was observed. These results indicate that... TabHLH27 Genes can promote root development ( Figure 5 (A, 5B, 5C), thereby improving nitrogen utilization efficiency.

[0050] Example 4 TabHLH27 Functional identification of transgenic plants with gene loss of function one, TabHLH27 Identification of transgenic plants with gene loss of function CRISPR target design was performed using a high-throughput CRISPR-Cas9 target design program developed by VimiBio. A single-gene, dual-target design was employed, with the target design as follows: Target1: 5'-AGGAAGAAGAACGTCTACCGCGG-3' Target2: 5'-CGAGCCACTTGCGCACCGCGCGG-3' The DNA sequence of the target gene region was amplified by PCR, and the CRISPR editing was identified after first-generation sequencing. Two types of CRISPR editing were identified in this way. TabHLH27 Editing types: Editing type 1 (cr1) manifests as 72 bp deletion, 4 bp deletion, and 4 bp deletion in wheat subgenomes A, B, and D, respectively, with corresponding transcriptional effects of 24 amino acid deletion, premature stop, and premature termination. Editing type 2 (cr2) manifests as 81 bp, 73 bp deletion, and 2 bp deletion in wheat subgenomes A, B, and D, respectively, with corresponding transcriptional effects of premature stop, premature stop, and premature termination. Figure 6 This indicates that the obtained mutant lines produced effective gene editing.

[0051] two, TabHLH27 The effect of gene loss of function on wheat nitrogen use efficiency For wild-type KN199 and TabHLH27 Seeds of loss-of-function mutant materials were soaked in 0.3% H2O2 at 4℃ for 24 h. After germination, the seeds were sown in vermiculite and grown in a greenhouse with 16 h light / 8 h darkness at 22℃. When the seedlings reached one leaf and one bud, the endosperm was removed, and the seedlings were allowed to acclimate in pure water for 1 day. Subsequently, they were grown in a high-nitrogen (3 mM NO3) environment. - ) and low nitrogen (0.04 mM NO3) -Hydroponic culture was carried out for 3 weeks under two nitrogen levels (greater than 1 mM NO3). - For high-nitrogen environments, NO3 levels are less than 0.5 mM. - (For a low-nitrogen environment). The roots were scanned using an EPSON scanner, and root data were extracted from the obtained images using WinRHIZO software.

[0052] The results showed that at high nitrogen levels, TabHLH27 The mutant plants showed significantly lower total root length, root surface area, root volume, and root tip number compared to the wild-type control KN199. Under low-nitrogen conditions, the wild-type KN199 exhibited increased total root length, root surface area, and root volume, consistent with the common knowledge that roots enlarge under low-nitrogen conditions, demonstrating the effectiveness of low-nitrogen treatment. Under low-nitrogen conditions, TabHLH27 The mutant plants exhibited significant developmental defects in total root length, root surface area, root volume, and number of root tips, showing almost no difference from those grown under high-nitrogen conditions. Figure 7 (A, 7B and 7C), please explain. TabHLH27 When the function is lost, the plant is unable to respond to low nitrogen stress by adjusting root morphology, thereby reducing nitrogen absorption efficiency.

[0053] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the present invention.

Claims

1. TabHLH27 The application of genes in improving nitrogen use efficiency in wheat is characterized by, The TabHLH27 Homologous genes of three subgenomic of the gene TabHLH27-2A, TabHLH27-2B, TabHLH27-2D The nucleotide sequences of the three subgenomic of the gene are shown in SEQ ID NO. 1~3, respectively.

2. The application according to claim 1, characterized in that, By building TabHLH27 Overexpression vectors were used to obtain overexpression plants with high nitrogen use efficiency.

3. The application according to claim 2, characterized in that, The high nitrogen utilization efficiency is reflected in: TabHLH27 Plants that overexpress the gene have better root development than wild-type plants.

4. The application according to claim 3, characterized in that, TabHLH27 Genes participate in the regulation of nitrogen use efficiency by influencing the absorption and utilization of nutrients by the root system.

5. A plant breeding method, characterized in that, The method is as follows: through overexpression TabHLH27 Gene-promoting target plants TabHLH27 Gene expression yielded plants with higher nitrogen use efficiency than the target plant; the target plant was wheat. TabHLH27 Homologous genes of the three subgenomes of a gene TabHLH27-2A, TabHLH27-2B, TabHLH27- 2D The nucleotide sequences are shown in SEQ ID NO.1~3 respectively.

Images