A molecular marker associated with oat lodging index and use thereof

Abstract

The application discloses a molecular marker related to oat lodging index and application thereof, and belongs to the technical field of molecular biology. In order to solve the problems of time and labor consumption and low accuracy of a traditional single plant selection method for breeding of new oat varieties with lodging resistance, the application provides a molecular marker related to oat lodging index, and specific information of the molecular marker is as follows: chromosome: chr7D; position: 104407598; SNP typing: G / T. The application also designs a primer combination for the molecular marker, and the primer combination can directly distinguish and detect G or T bases of the SNP mutation site. The method has good application value, can realize pre-selection and molecular assisted breeding of the oat lodging index trait, and has important theoretical and practical significance for accelerating the genetic improvement process of breeding of materials with suitable lodging index and improving selection efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker related to the lodging index of oats and its application. Background Technology

[0002] Oats are an annual crop belonging to the genus *Avena* of the Poaceae family, used for both food and forage. The lodging resistance of oats is determined by multiple factors, among which the lodging index (LOI) is a comprehensive reflection of plant weight, center of gravity height, and stem mechanical strength, and is an important reference for judging the lodging resistance of oat plants. Studies have shown that a lower LOI indicates stronger lodging resistance, while a higher LOI indicates weaker lodging resistance.

[0003] Currently, oat breeding in my country is still in the conventional breeding stage, and the identification and analysis of important indicators such as lodging index are not yet in-depth. By studying genes related to lodging index and their regulatory mechanisms, molecular markers closely linked to lodging index can be developed for marker-assisted breeding, thereby improving breeding efficiency and accuracy.

[0004] Traditional breeding of new oat varieties with low lodging index relies on evaluation and selection based on the lodging index of the offspring. This method is time-consuming, labor-intensive, and inaccurate. Developing specific molecular markers to assist selection by utilizing base differences in target genes is the best way to improve selection efficiency. Competitive allele-specific PCR (KASP) molecular markers are a novel SNP genotyping method based on allele-specific amplification (ARMS) and highly sensitive fluorescence detection. The principle involves designing a forward primer and a reverse primer for each allele SNP site. Each pair of forward and reverse primers has a specific sequence that can bind to different fluorescent markers. PCR amplification of the DNA of the sample using forward and reverse primers with sequences that bind to different fluorescent markers allows allelic variations to be reflected by different fluorescence signals (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145:75-86).

[0005] Therefore, developing KASP markers closely linked to the oat lodging index for early selection in breeding is crucial for reducing breeding workload and accelerating oat lodging resistance breeding, while also yielding significant economic benefits. Summary of the Invention

[0006] To address the problems of time-consuming, labor-intensive, and inaccurate traditional methods for breeding lodging-resistant oat varieties, this invention provides a molecular marker associated with the oat lodging index. The specific information of this molecular marker is: chromosome: chr7D; location: 104407598; SNP genotype: G / T. This invention also designs a primer combination for this molecular marker, which can directly and specifically distinguish and detect the G or T bases at the SNP mutation site. The method in this invention has significant application value, enabling pre-selection and molecular-assisted breeding of the oat lodging index trait. It has important theoretical and practical significance for accelerating the genetic improvement process of breeding suitable lodging index materials and improving selection efficiency.

[0007] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide a molecular marker associated with the lodging index of oats, with the following specific information: chromosome: chr7D; location: 104407598; SNP genotype: G / T.

[0008] Furthermore, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0009] The second objective of this invention is to provide a primer combination for amplifying the molecular marker, the nucleotide sequence of which is shown in SEQ ID No. 3 to SEQ ID No. 4.

[0010] A third objective of this invention is to provide a kit comprising the aforementioned primer combination.

[0011] The fourth objective of this invention is to provide a molecular marker chip, including the primer combination.

[0012] A fifth objective of this invention is to provide the application of the molecular marker, the primer combination, the kit, and / or the molecular marker chip in any of the following: a. Predicting the lodging index of oats; b. Identification and screening of oats with different lodging indices; c. Molecular marker-assisted breeding of oat materials with different lodging indices; d. Oat breeding of oat materials with different lodging indices; e. Prepare oat breeding products with different lodging indices; Furthermore, if the classification result is GG, it indicates an oat material with a high lodging index; if the classification result is GT, it indicates an oat material with a low lodging index.

[0013] The sixth objective of this invention is to provide a method for screening oat materials with different lodging indices or predicting the lodging index of oats, comprising the following steps: extracting genomic DNA from the oat material to be tested, amplifying molecular markers using the primer combination described in SEQ ID No. 3~SEQ ID No. 4, sequencing the amplified products, and screening by typing; the typing screening criteria are as follows: if the typing result is GG, it is a material with a high lodging index; if the typing result is GT, it is a material with a low lodging index.

[0014] Furthermore, the amplification program is as follows: 94 ℃ for 15 min; 95 ℃ for 20 sec, 65~56 ℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8 ℃ in each cycle; 94 ℃ for 20 sec, 57 ℃ for 60 sec, 30 cycles.

[0015] The seventh objective of this invention is to provide a method for cultivating oats with different lodging indices, comprising the following steps: identifying oat genotypes using the method for screening oat materials with different lodging indices or predicting oat lodging indices, screening target individual plants based on genotypes, and propagating the screened target individual plants to obtain oats with different lodging indices.

[0016] Furthermore, the screening method for the target individual plant is as follows: if it is necessary to obtain oats with a low lodging index, then select individual plants with the genotype GT; if it is necessary to obtain oats with a high lodging index, then select individual plants with the genotype GG.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention identifies a locus (chr7D_104407598) near chromosome 7D at 104.41 Mb that is significantly associated with the lodging index of oats, with a LOD value of 5.40 and an explainable phenotypic contribution of 4.14%. A primer set was designed for this locus. This KASP primer set can directly and specifically distinguish and detect the G or T bases at SNP mutation sites, demonstrating significant application value. It enables pre-selection of oat lodging index and molecular-assisted breeding, which is of important theoretical and practical significance for accelerating the genetic improvement process of breeding materials with suitable lodging index and improving selection efficiency. Attached Figure Description

[0018] Figure 1 This is the GWAS analysis result in Embodiment 1 of the present invention.

[0019] Figure 2 This is the KASP reaction system in Example 3 of the present invention.

[0020] Figure 3 The KASP marker genotyping results are shown in Example 3 of this invention. Red represents the GG genotype and blue represents the GT genotype.

[0021] Figure 4 This is a comparison of the lodging index between different genotypes of materials in Example 3 of the present invention. Detailed Implementation

[0022] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.

[0023] The experiment of this invention includes two populations. Population 1 consists of 567 oat germplasm materials for marker screening. These materials include core germplasm, germplasm from different regions, and germplasm with different phenotypes (Table 1). Population 2 consists of 36 oat germplasm materials for subsequent validation (Table 2).

[0024] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0025] Example 1: Obtaining Molecular Markers Marker screening was conducted using population 1 (567 oat germplasm materials, Table 1). Oat materials were sown in experimental fields in Zhangjiakou, Hebei Province and Datong, Shanxi Province in mid-to-late April 2024, with a randomized block design and three replicates at both sites. Each germplasm resource was planted in a single row with a row spacing of 60 cm and an intra-row spacing of 5 cm, with 30 plants per resource. Sowing was done manually at a depth of 3-5 cm. No fertilization or irrigation was applied during the growing season; appropriate pesticides were used as needed to control pests, diseases, and weeds.

[0026] Table 1. List of 567 oat germplasm materials

[0027] During the milk stage, the lodging index of each oat germplasm was statistically analyzed using manual methods. After obtaining the lodging index for different replicates and environments for each material, the mean was calculated. This mean was used for subsequent GWAS analysis.

[0028] 100 mg of young oat leaves were selected, flash-frozen in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGI DNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0029] Each sample yielded approximately 30 GB of raw data. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove the adapter and filter out low-quality base sequences. The cleaned sequencing data was then aligned to the reference genome of “PepsiCo OT3098” oats using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, resulting in filtered BAM files, which were then sorted. PCR repetitive sequences were marked using the Mark Duplicates function in the Picard toolkit (version 2.23.0). Finally, the processed BAM files were used for variant detection using GATK Haplotype Caller (version 4.2.3.062). In the SNPs filtering strategy, the following parameters are set as screening criteria: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, Mapping Quality Rank Sum Test (MQ Rank Sum Test) less than -12.5, Read PosRank Sum (Read PosRank Sum) less than -8.0, Strand Odds Ratio (SOR) greater than 3.0, and Mapping Quality (MQ) less than 40.0. Subsequently, the selection criteria for a subset of oat SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a deletion rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter this basic SNP set based on linkage disequilibrium (LD), setting the LD filter window size to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2, to obtain a core SNP marker set. The missing genotypes in the LD-filtered SNP marker set were then filled using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a deletion rate less than 20% and a MAF greater than 0.05%.

[0030] GWAS analysis was performed using 12,525,734 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, various software and statistical models were employed: TASEEL 5.0 (GLM and MLM) (Bradbury PJ et al., 2007), BLINK (v1.01) (Huang et al., 2019), and GEMMA. QQ plots (quantile-quantile plots) were used to measure the reliability of the model. By comparing QQ plots generated by different models, this invention found that the MLM model in GEMMA performed better. Therefore, the MLM model in GEMMA was selected to present the final results. The Manhattan plot visualization was performed using the R package qqman (Yin et al., 2021). Linkage disequilibrium (LD) analysis of associated SNPs was calculated and visualized using LDBlockShow (Dong et al., 2021). The results showed that a locus (chr7D_104407598) significantly associated with oat lodging index was found near chromosome 7D at 104.41 Mb, with a LOD value of 5.40 and an explainable phenotypic contribution of 4.14%. Figure 1 ).

[0031] Example 2: Development of KASP marker at the chr7D_104407598 locus The chr7D_104407598 locus is located near 104.41 Mb on chromosome 7D. Specific information: Chromosome: chr7D; Location: 104407598; SNP type: G / T.

[0032] The reference genome “PepsiCo OT3098” yielded approximately 200 bp of sequences upstream and downstream of the chr7D_104407598 site: SEQ ID No. 1, where lowercase letters represent SNP sites: AAACTACCGAAGATAGAGCTGGATCCAAATGCGGAGGATCCAGTTGAGGACACCTTAGAACATGGGAGAGCCATGGAGGCTAAGGTCAGGGAGTGGGCTATGAAGAAGATGGCCCAGTGTTTCACCAACTAGAAGAAAAGATTGCACCTTCACTATGTCGTGAAAGAGACGACTCCGGATTTCAAGAAGATTTAGTTTCAtAAGATAGAACCATTCTGGGCCGAGTTTGTGAATTACAAGACATCAGAAAAAGCTAAGAAAATGTCTTCAACGAATAAGCTGAATGCTGCTAACAAGAAGTATCACCATACTATGGGGCAAGGTGGCTACAAGGCTGGCATTCCTAAGTGGGAGAAACTTGAGAATGTACTGCGTGCTAAAAAGATCATCCCAGAGACAGA SEQ ID No. 2, wherein the lowercase letter represents the SNP site: AAACTACCGAAGATAGAGCTGGATCCAAATGCGGAGGATCCAGTTGAGGACACCTTAGAACATGGGAGAGCCATGGAGGCTAAGGTCAGGGAGTGGGCTATGAAGAAGATGGCCCAGTGTTTCACCAACTAGAAGAAAAGATTGCACCTTCACTATGTCGTGAAAGAGACGACTCCGGATTTCAAGAAGATTTAGTTTCAgAAGATAGAACCATTCTGGGCCGAGTTTGTGAATTACAAGACATCAGAAAAAGCTAAGAAAATGTCTTCAACGAATAAGCTGAATGCTGCTAACAAGAAGTATCACCATACTATGGGGCAAGGTGGCTACAAGGCTGGCATTCCTAAGTGGGAGAAACTTGAGAATGTACTGCGTGCTAAAAAGATCATCCCAGAGACAGA KASP primers were designed for the chr7D_104407598 site and its flanking sequences (SEQ ID No. 1 and SEQ ID No. 2) using Bacthprimer 3 software. Each KASP marker consisted of two specific primers, with fluorescent adapter sequences (ggagtgagtacggtgtgc is the FAM fluorescent adapter sequence SEQ ID No. 6; gagtggatgctggatgg is the HEX fluorescent adapter sequence SEQ ID No. 7) ligated to the 5' end of the specific primers.

[0033] The KASP-labeled primers are as follows: Specific primer 1 (SEQ ID No. 3): ATTGCACCTTCACTATGTCG; Specific primer 2 (SEQ ID No. 4): GTAATTCACAAACTCGGCCC; Universal primer (SEQ ID No. 5): TGTTGCTACTCCTATAATTTTCCTCACTT.

[0034] Example 3: Use and Validation of Molecular Markers Another 36 oat samples (i.e., population 2 mentioned above, Table 2) were grown, sampled, and had DNA extracted using the method described in Example 1, and then analyzed using the Douglas Scientific Array Tape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0035] The PCR system was assembled using NEXAR, and the PCR reaction system was as follows: Figure 2 As shown. PCR amplification was performed using SOELLEX. The touch-down PCR amplification conditions were as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 sec, 57℃ for 60 sec, 30 cycles.

[0036] After the PCR reaction, the fluorescence signal of the reaction system was scanned using ARAYA, and then data analysis and genotyping were performed using INTELLICS. Label genotyping was as follows: Figure 3As shown in the table, red represents the GG allele and blue represents the GT allele. The allele types at this locus for the 36 materials are shown in Table 2. The lodging index of each material was also calculated. GG allele germplasm had a higher lodging index (average 1.21), while GT allele germplasm had a lower lodging index (average 0.96). Figure 4 ).

[0037] Table 2. Allelic types of 36 germplasm materials and their loci in this invention.

[0038] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer combination, characterized in that, It is used to amplify a molecular marker associated with the lodging index of oats; the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2; the nucleotide sequence of the primer combination is shown in SEQ ID No. 3~SEQ ID No.

4.

2. A reagent kit, characterized in that, This includes the primer combination described in claim 1.

3. A molecular marker chip, characterized in that, This includes the primer combination described in claim 1.

4. The use of the primer combination of claim 1, the kit of claim 2, and / or the molecular marker chip of claim 3 in any one of the following: a. Predicting the lodging index of oats; b. Identification and screening of oats with different lodging indices; c. Molecular marker-assisted breeding of oat materials with different lodging indices; d. Oat breeding of oat materials with different lodging indices; Furthermore, if the classification result is GG, it indicates an oat material with a high lodging index; if the classification result is GT, it indicates an oat material with a low lodging index.

5. A method for screening oat materials with different lodging indices or predicting the lodging index of oats, characterized in that, Includes the following steps: Genomic DNA was extracted from the oat material to be tested and amplified using the primer combinations described in SEQ ID No. 3~SEQ ID No.

4. The molecular markers described in claim 1 are used to sequence the amplification products and perform genotyping screening; the genotyping screening criteria are as follows: if the genotyping result is GG, it is a material with a high lodging index; if the genotyping result is GT, it is a material with a low lodging index.

6. The method according to claim 5, characterized in that, The amplification program was as follows: 94 ℃ for 15 min; 95 ℃ for 20 sec, 65~56 ℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8 ℃ per cycle; 94 ℃ for 20 sec, 57 ℃ for 60 sec, 30 cycles.

7. A method for cultivating oats with different lodging indices, characterized in that, Includes the following steps: The oat genotype is identified using the method described in claim 5, target plants are screened based on the genotype, and the screened target plants are propagated to obtain oats with different lodging indices.

8. The method according to claim 7, characterized in that, The screening method for the target individual plants is as follows: if it is necessary to obtain oats with a low lodging index, then select individual plants with the genotype GT; if it is necessary to obtain oats with a high lodging index, then select individual plants with the genotype GG.

Images