Application of EiABCG1 gene in improving the ability of rice to resist glufosinate
By introducing the EiABCG1 gene into rice, constructing an overexpression vector, and increasing its expression level, the problem of rice's sensitivity to glufosinate was solved, achieving efficient resistance and stable expression in rice, enhancing glufosinate efflux capacity, and improving rice's stress resistance and yield.
Patent Information
- Application Number
- CN202610409575.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-11-06
- Estimated Expiration
- 2046-03-31
AI Technical Summary
Existing rice varieties are sensitive to glufosinate, lack diverse glufosinate-resistant gene resources, have unstable expression efficiency, and are at risk of resistance drift. Furthermore, current technologies are insufficient to improve resistance while ensuring rice yield and quality.
The EiABCG1 gene was introduced, and an overexpression vector was constructed and transformed into rice to increase the expression level of the EiABCG1 gene, thereby enhancing the rice's resistance to glufosinate.
It significantly improved rice resistance to glufosinate, enhanced the efflux rate of glufosinate, reduced the content of glufosinate in protoplasts, and improved the stress resistance and yield of rice.
Smart Images
Figure CN122038463B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more particularly to... EiABCG1 Application of genes in improving rice's resistance to glufosinate. Background Technology
[0002] Weed control is one of the core challenges in rice production. Paddy fields are home to a wide variety of weeds, with noxious weeds such as barnyard grass, goosegrass, sedge, and crabgrass competing with rice for light, water, and nutrients, severely impacting rice yield and quality. Among numerous herbicides, glufosinate, as a broad-spectrum, non-selective, highly effective, and environmentally friendly herbicide, is widely used globally for weed control due to its unique mechanism of action (inhibition of glutamine synthase, leading to ammonium ion accumulation), rapid degradation, short residual period, and high safety for non-target organisms. However, glufosinate also has a significant killing effect on rice, and traditional rice varieties do not possess natural glufosinate resistance, which greatly limits its direct application in rice production.
[0003] To leverage the high herbicidal efficiency of glufosinate, existing technologies primarily address rice susceptibility through two main approaches. One is by breeding glufosinate-resistant rice varieties, using transgenic technology to introduce exogenous resistance genes into the rice genome. Currently, the most widely used glufosinate-resistant gene originates from *Streptomyces hygroscopicus* (…). Streptomyces hygroscopicus )of bar The gene may have originated from *Streptomyces viridans* ( Streptomyces viridochromogenes )of pat The gene encodes glufosinate acetyltransferase ( Phosphinothricin acetyltransferase, PAT One approach involves acetylifying glufosinate molecules, rendering them ineffective as herbicides and thus protecting rice from herbicide damage. Based on this technology, glufosinate-resistant transgenic rice has been commercially approved for cultivation in several countries and regions, demonstrating significant advantages in weed control. Another approach utilizes herbicide safener technology, where a safener (such as glufosinate-methyl or bis(oxazolyl)) is applied simultaneously with or before the glufosinate application. This induces the activity of detoxification enzymes in rice, selectively protecting the rice from herbicide damage. However, this technology suffers from high costs, the need for precise mixing of the safener and herbicide, and poor stability in field application.
[0004] However, existing glufosinate-resistant technologies still have significant problems or shortcomings in practical applications. Firstly, existing glufosinate-resistant gene resources are relatively limited, and current commercial applications almost entirely rely on… bar Gene or patGenes and their derivatives. Long-term, large-scale cultivation of rice varieties carrying single resistance genes carries the potential risk of resistance gene drift. Furthermore, if microorganisms or weeds capable of degrading acetylated glufosinate emerge in the field, resistance will be lost, resulting in significant production losses. Secondly, the expression efficiency of some existing resistance genes in rice needs improvement. Under adverse conditions such as high temperature and drought, the expression stability of exogenous genes may be affected, leading to a decrease in resistance levels and an increase in the risk of herbicide damage. Thirdly, public acceptance and commercial approval barriers for transgenic crops remain important factors restricting the widespread application of this technology. Developing novel glufosinate-resistant gene resources from different species with different mechanisms of action can not only enrich the resistance gene pool but also provide possibilities for gene stacking strategies, helping to delay the emergence of weed resistance. Finally, existing technologies mostly focus on "how to make rice tolerant to glufosinate", but lack systematic optimization of the expression regulation, translation efficiency and compatibility with rice endogenous metabolism of the resistance gene itself. How to ensure high resistance without affecting rice yield, quality and stress resistance is still a technical problem that needs to be solved.
[0005] Therefore, discovering and developing novel, efficient, and stably expressed glufosinate-resistant genes, especially those derived from different microbial species with varying enzymatic properties or higher catalytic efficiencies, and applying them to rice genetic improvement, is of great significance for enriching herbicide-resistant germplasm resources, ensuring safe rice production under glufosinate application, and achieving green and efficient weed control in paddy fields. This invention, based on this background, provides a novel glufosinate-resistant gene and its application in rice. Summary of the Invention
[0006] In order to solve the technical problems existing in the prior art, the purpose of this invention is to provide... EiABCG1 The application of genes in improving rice's resistance to glufosinate (glufosinate resistance) aims to solve the aforementioned technical problems.
[0007] According to a first aspect of the present invention, the present invention provides EiABCG1 The application of genes in improving rice resistance to glufosinate, EiABCG1 The nucleotide sequence of the gene is shown in SEQ ID NO:1. EiABCG1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2. EiABCG1 Genes can enhance rice's resistance to glufosinate and can serve as new targets for improving rice's resistance to glufosinate.
[0008] According to a second aspect of the invention, the invention provides EiABCG1 The application of the gene in the genetic breeding of glufosinate-resistant rice or in the preparation of glufosinate-resistant rice, the aforementioned EiABCG1The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0009] In some implementations, by improving EiABCG1 Increasing gene expression levels enhances rice's resistance to glufosinate.
[0010] In some implementations, the improvement EiABCG1 Gene expression levels include: by... EiABCG1 The gene was linked to an overexpression vector and then transformed into rice to construct glufosinate-resistant rice.
[0011] In some embodiments, the overexpression vector is pC2300.
[0012] According to a third aspect of the present invention, the present invention provides a method for regulating the resistance of rice to glufosinate, comprising: Will EiABCG1 Gene transfer into rice, making EiABCG1 The gene is expressed in rice to regulate the rice's resistance to glufosinate; EiABCG1 The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0013] In some implementations, EiABCG1 Gene transfer into rice, making EiABCG1 Overexpression of the gene in rice can enhance its resistance to glufosinate; or... EiABCG1 Gene-overexpressing plants were hybridized with other rice plants to breed glufosinate-resistant rice.
[0014] According to a fourth aspect of the present invention, the present invention provides a recombinant expression vector having an inserted nucleotide sequence as shown in SEQ ID NO:1.
[0015] According to a fifth aspect of the present invention, the present invention provides a transgenic rice line comprising the above-described recombinant expression vector.
[0016] In some embodiments, the rice is japonica rice.
[0017] In some embodiments, the rice variety is Zhonghua 11.
[0018] The transgenic rice line provided by this invention is EiABCG1 Overexpression in rice plants.
[0019] Compared with wild-type rice plants, the transgenic rice lines provided by this invention have enhanced resistance to glufosinate, significantly increased GR50, increased glufosinate efflux rate, and significantly reduced glufosinate content in protoplasm.
[0020] In this invention, EiABCG1The nucleotide sequence and corresponding amino acid sequence of the gene were obtained from the International Weed Genomics Consortium website (https: / / www.weedgenomics.org).
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Compared with the wild type, the overexpression provided in the embodiments of the present invention EiABCG1 -OE rice plants showed significantly enhanced resistance to glufosinate, with a significantly higher GR50 value, suggesting that... EiABCG1 Positively regulates rice glufosinate resistance.
[0022] (2) Compared with the wild type, the overexpression provided in the embodiments of the present invention EiABCG1 -OE rice plants exhibit a significantly increased rate of glufosinate excretion and a significantly reduced glufosinate content within the protoplast, thereby enhancing the plant's resistance to glufosinate. Attached Figure Description
[0023] Figure 1 This is an electrophoresis diagram of the target gene amplification product.
[0024] Figure 2 for EiABCG1 A map of gene overexpression vector construction.
[0025] Figure 3 Electrophoretic identification diagram of the target gene for genetic transformation.
[0026] Figure 4 Wild-type ZH11 and overexpressed rice EiABCG1-OE At 0, 50, 100, 200, 400, 800g aiha -1 Phenotypic analysis diagram after 10 days of treatment at glufosinate concentration.
[0027] Figure 5 Wild-type ZH11 and overexpressed rice EiABCG1-OE A graph showing the in vitro glufosinate rate analysis.
[0028] Figure 6 Wild-type ZH11 and overexpressed rice EiABCG1-OE Graph showing the content analysis of glufosinate in protoplasts. Detailed Implementation
[0029] To better understand the technical solution of the present invention, the embodiments of the present invention are described in detail below. It should be understood that the described embodiments are merely some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0030] Plant materials: The goosegrass used in this study was from the AUS population (provided by the Weed Resistance Research Centre, University of Western Australia), and the rice was japonica rice as the background. Oryza sativa L The wild-type plant (WT) was Zhonghua 11 (ZH11, provided by Wuhan Boyuan Biotechnology Co., Ltd.). EiABCG1 The genetic transformation of the genetic material was accomplished by Wuhan Boyuan Biotechnology Co., Ltd.
[0031] The main reagents and consumables used in the following examples are shown in Table 1 below.
[0032] Table 1
[0033] Example 1: Overexpression plants EiABCG1-OE Construction 1. pC2300- EiABCG1 Construction of overexpression vectors (1) Amplification of the target gene RNA was extracted from leaves of *Eleusine indica* AUS population (using an RNA extraction kit, detailed instructions provided by Tiangen Biotech (Beijing) Co., Ltd., DP452), and reverse transcribed into cDNA (using a reverse transcription kit, detailed instructions provided by Yisheng Biotechnology (Shanghai) Co., Ltd., 11149ES10). Using the cDNA as a template, RNA was extracted according to the target gene (as shown in SEQ ID NO:1). EiABCG1 Gene-specific primers were designed (using Primer Premier 6). Restriction endonuclease sites (such as BamHI and SpeI) corresponding to those in the vector MCS, as well as the protective bases GGATCC and ACTAGT, were introduced at the 5' ends of the forward and reverse primers, respectively. The primer sequences are shown in Table 2. After PCR amplification of the target gene fragment, the product was purified by gel electrophoresis to obtain the PCR amplification product. The PCR amplification reaction system is shown in Table 3.
[0034] Table 2: Primers for PCR amplification of the target fragment
[0035] Table 3: PCR reaction system for the target gene
[0036] The first step in PCR amplification is denaturation, set at 94℃. This high temperature breaks the hydrogen bonds between the double-stranded DNA template (dsDNA), dissociating it into two single-stranded DNA molecules (ssDNA), allowing primers to bind to the template. Since this is the first denaturation step, the time is set to 5 minutes to ensure complete template dissociation. This is followed by 32 cycles of denaturation at 98℃ for 10 s, annealing at 58℃ for 30 s, and extension at 68℃ for 90 s; a final extension at 68℃ for 5 min, followed by a hold at 16℃ for 1 min. After the reaction, 50 μL of the amplification product is added to a 1 wt% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel is illuminated under UV light to detect whether bands have been amplified (results are shown in Figure 1). Figure 1 As shown, Figure 1 In the diagram, M stands for marker, and 1 and 2 are both target genes. The amplification of the target band indicates that the amplified fragment contains the target gene. The target band is then cut, and the product is further purified by gel electrophoresis and its concentration determined.
[0037] (2) Preparation of linearized carriers Take 3 µg each of the overexpression vector pC2300 and the target gene (according to the plasmid extraction kit instructions). Add the corresponding restriction endonuclease to both reaction systems and double-digest at 37℃ for 30 min. The reaction systems for the overexpression vector pC2300 and the target gene are shown in Table 4: Table 4: Enzyme digestion reaction system
[0038] 50 μL of the reaction product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was imaged under UV light. After the target band was separated, it was cut and the product was further purified by gel extraction and concentration determination to obtain the insert fragment and linearized vector.
[0039] (3) Recombination reaction The insert fragment and vector were recombined in a specific ratio using 2×Hieff Clone® MultiS Enzyme Premix (from a multi-fragment one-step rapid cloning kit, purchased from Shanghai Yisheng Biotechnology Co., Ltd.) homologous recombinase to obtain pC2300- EiABCG1 Overexpression vectors (such as Figure 2 (As shown in Table 5). The optimal vector to insert molar ratio is 1:(2-3). The DNA mass corresponding to these molar numbers can be calculated using the following formulas: Optimal vector usage X = [0.02 × vector base pairs] ng (0.03 pmol), optimal insert usage Y = [0.04 × insert base pairs] ng (0.06 pmol). The recombination reaction system is shown in Table 5.
[0040] Table 5: Recombination Reaction System
[0041] After the system is prepared, use a pipette to mix the components in Table 5 to obtain the reaction solution. Centrifuge to collect the reaction solution to the bottom of the tube, and place it at 50℃ for 20 min to obtain the recombinant product. The recombinant product can be directly converted or stored at -20℃ and thawed for conversion when needed.
[0042] (4) Recombinant product conversion and coating Thaw the cloned competent cells DH5α on ice. Take 10 μL of the recombinant product (containing pC2300- EiABCG1 Add the overexpression vector to 100 μL of competent cells, gently tap the tube wall a few times to mix, and incubate on ice for 30 min; heat shock at 42℃ for 60 s, incubate on ice for 2 min, add 900 μL of LB medium, and shake at 37℃ and 200 rpm for 30 min, centrifuge at 5000 rpm for 3 min, and discard the supernatant. Resuspend the bacterial culture in LB medium and spread evenly on a plate containing Kan resistance using a sterile spreader. After the bacterial culture is absorbed, invert the plate and incubate overnight (12 hours) at 37℃.
[0043] (5) Cloning identification The most convenient and quickest method is colony PCR. Specifically, use a sterile pipette tip to pick a single colony and transfer it to 500 μL of LB medium. Mix well, then directly use 1 μL as a PCR template for the PCR reaction (primers for the PCR process can be found in Table 2). The remaining bacterial culture is used for subsequent sequencing identification. The PCR reaction system is shown in Table 6.
[0044] Table 6: Colony PCR Reaction System
[0045] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 25 cycles; 72℃ total extension for 5 min, 16℃ hold for 1 min. After the reaction, 20 μL of the amplification product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis; after electrophoresis, the gel was irradiated with UV light to detect whether bands were amplified. After the bands were amplified, the amplified products were sent to a sequencing company for sequencing (sequencing was performed by Guangzhou Qingke Biotechnology Co., Ltd., using the Sanger sequencing method). The sequencing primers were: pC2300-F:GAAGACGTTCCAACCACGTCTTC; pC2300-R:CTGGACGTAGCCTTCGGG; 2. Genetic transformation and identification of transgenic plants The constructed pC2300- EiABCG1 The overexpression vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for genetic transformation. The transformed variety was Zhonghua 11, resulting in T0 generation plants. The transgenic plants were identified by extracting total genomic DNA from the leaves of the tested plants. PCR amplification was performed using primers G1 (G1-F and G1-R are shown in Table 7). The band sizes of the PCR products were determined by agarose gel electrophoresis to determine if they matched the target gene; those matching indicated transgenic plants containing the target gene (i.e.,...). EiABCG1 (Gene overexpression plants), results as follows Figure 3 As shown, Figure 3 In this diagram, M represents the marker. 1 is the negative control group, which uses the total genomic DNA of wild-type ZH11 plants and the PCR product obtained using primer G1. The negative control group did not show the target transforming gene. 2 and 3 are the results corresponding to the PCR products of total genomic DNA from T0 generation plants using primer G1. Figure 3 It can be seen that the target gene has been transformed into the T0 generation plants. The PCR amplification method is as described in Example 1, using plant pC2300- EiABCG1 The overexpression vector construction method includes step (1) the PCR reaction system (Table 3) for cloning identification and the PCR amplification program. T0 generation plants were self-crossed to obtain T1 generation plants, and T1 generation plants were self-crossed again to obtain T2 generation homozygous plants. EiABCG1 Gene overexpression plants ( EiABCG1-OE ).
[0046] Table 7: G1 identification primers
[0047] This embodiment utilizes PCR to clone from AUS goosegrass. EiABCG1 Genes, through genetic transformation EiABCG1 After the gene was transferred into rice, two overexpression lines were obtained through screening (labeled as follows). EiABCG1-OE14 and EiABCG1- OE23 The phenotypes of the overexpression lines were analyzed as follows.
[0048] Example 2: Phenotypic Analysis of Glufosinate Stress This invention involves sowing wild-type plants of the Japonica rice variety ZH11 at the farm of South China Agricultural University in Guangzhou, Guangdong Province (as a control group, WT). EiABCG1 Overexpression plants ( EiABCG1-OE After harvesting, glufosinate stress was applied to the seedlings in pots.
[0049] Rice varieties to be tested: wild type, EiABCG1-OE ( EiABCG1-OE14 and EiABCG1-OE23) The specific steps are as follows: Take the wild-type (ZH11) that has just started to show white. EiABCG1-OE Seeds were planted in pots containing moist soil, 3 seedlings per pot, 6 pots per variety, 3 replicates, and cultured at 28℃ under light (16 hours light / 8 hours dark). When the rice seedlings reached the 4-leaf stage, they were sprayed with glufosinate at doses of 0, 50, 100, 200, 400, and 800 g ai ha. -1 Take photos and observe after 10 days.
[0050] The results are as follows Figure 4 As shown, phenotypic analysis revealed that after glufosinate treatment, wild-type and... EiABCG1-OE All showed varying degrees of damage. Compared to WT, EiABCG1-OE The plant was only slightly damaged. Figure 4 Wild-type ZH11 in 50g ai ha -1 Yellowing has already begun to occur at glufosinate concentrations, 200g ai ha -1 Almost all of the plants below withered and died, while the overexpressing plants survived at 400 meters. -1 The obvious yellowing and wilting only appeared after the bottom, indicating EiABCG1-OE Overexpression improved rice's tolerance to glufosinate stress. Therefore, it can be inferred that... EiABCG1 It is positively regulating the ability of rice to resist glufosinate.
[0051] Example 3: Glufosinate Resistance Analysis Rice variety to be tested: Wild type (ZH11) EiABCG1-OE ( EiABCG1-OE14 and EiABCG1-OE23 ) The specific steps are as follows: Place the newly sprouted wild-type... EiABCG1-OE Seeds were planted in moist soil, 3 seedlings per pot, 6 pots per variety, 3 replicates, and cultured at 28℃ under light (16 hours light / 8 hours dark). When the rice seedlings reached the 4-leaf stage, glufosinate was sprayed at doses of 0, 50, 100, 200, 400, or 800 g. -1 Ten days later, the fresh weight of the aboveground parts was measured, and the effects of different concentrations of glufosinate on wild-type and wild-type plants were calculated. EiABCG1-OE The growth inhibition rate (i.e., fresh weight inhibition rate) of rice was calculated using the formula: Fresh weight inhibition rate (%) = (Fresh weight of control group - Fresh weight of treatment group) / Fresh weight of control group. SPSS 26.0 and GraphPad Prism 10 software were used to perform regression analysis on the glufosinate dosage x and the fresh weight inhibition rate y (y = a + bx), where b is the slope (regression coefficient). The resistance identification results are shown in Table 8. The control group was wild-type (ZH11), while the treatment group was... EiABCG1- OE Rice (respectively) EiABCG1-OE14 and EiABCG1-OE23 ); Table 8 shows the differences between wild-type ZH11 (control group, WT) and overexpressing rice. EiABCG1-OE At 0, 50, 100, 200, 400, 800g aiha -1 After 10 days of treatment at glufosinate concentration, the fresh weight of the aboveground parts was weighed and the glufosinate concentration was calculated. 50 The results table for resistance multiples.
[0052] As shown in Table 8 below, the wild-type (ZH11) GR 50 48.19g aiha -1 , EiABCG1-OE 14 and EiABCG1- OE 23 GR 50 The values are 455.67 and 460.78 g aiha. -1 Based on the wild type (ZH11), EiABCG1-OE14 Its resistance multiple is 9.46 times that of ZH11. EiABCG1-OE23 The resistance multiple of [the substance] is 9.56 times that of ZH11. According to the international resistance level classification standard (RI<2, sensitive; 2≤RI<5, low resistance; 5≤RI<10, moderate resistance; RI≥10, high resistance; RI represents the resistance multiple), this indicates... EiABCG1-OE The plants have reached a level of moderate resistance.
[0053] Table 8
[0054] Example 4: Analysis of glufosinate efflux rate Rice variety to be tested: Wild type (ZH11) EiABCG1-OE ( EiABCG1-OE14 and EiABCG1-OE23 ) The specific steps are as follows: Place the newly sprouted wild-type... EiABCG1-OESeeds were planted in pots containing moist soil, 3 seedlings per pot, 10 pots per variety, 3 replicates, and cultured at 28°C under light (16 hours light / 8 hours dark). Sampling was performed when the seedlings reached the four-leaf stage. Two fully expanded young leaves were collected from each plant (n = 5 plants) and surface-sterilized with 70% ethanol (v / v). Six leaf discs were sampled from the base of each leaf (avoiding the midrib) using a cork drill with a base diameter of 1 mm. Each set of 60 fresh leaf discs was vacuum-permeable using a 20 mL syringe. Specifically, the leaf discs were placed in the syringe barrel, ensuring the outlet was not blocked, and 18 mL of permeate was drawn in (leaving space for mixing). After expelling some air, the syringe tip was plugged (with a rubber stopper). The syringe was held upright, and the barrel wall was gently tapped to help the air bubbles rise. If a large number of leaves still floated, the vacuum process could be repeated 1–2 times. Pour out the permeated leaf along with the solution, remove the leaf disc with tweezers, and blot off excess liquid with filter paper. It is then ready for subsequent measurements. The syringe permeation solution contains ammonium phosphate buffer (pH 5.5), 0.1% (v / v) Tween, and 10 mmol / L sucrose. The vacuum-permeated leaf discs are stored in ammonium phosphate buffer (pH 5.5) at room temperature under light-protected conditions until use. Vacuum-permeable leaf discs were transferred to wells containing 5 mM glufosinate in ammonium phosphate buffer (pH 5.5) and incubated with shaking at 25 °C for 24 hours to ensure full uptake of glufosinate. Subsequently, the leaf discs were rapidly rinsed with fresh ammonium phosphate buffer (pH 5.5) and transferred to containers containing glufosinate-free ammonium phosphate buffer (pH 5.5). At various time intervals (2.5, 5, 10, 15, 30, 60, and 90 minutes), 1 mL of solution was removed from the containers, and the glufosinate concentration in the solution was measured using HPLC-Q-TOF-MS (High Performance Liquid Chromatography-Quadrupole-Time-of-Flight Tandem Mass Spectrometry). The efflux of glufosinate in the external medium was estimated using a modified hyperbolic model: y = at / 1 + bt. Here, y = amount of glufosinate in the medium, a = asymptotic value, b = rate of increase of glufosinate amount with respect to efflux time, and t = efflux time. The significant differences in outflow rate (b) between different treatments were tested using Prism. Three replicates were performed.
[0055] The results are as follows Figure 5 As shown, with wild-type ZH11 as the control, overexpression EiABCG1-OE The efflux rate of the plants increased significantly, and after 90 minutes of treatment, overexpression... EiABCG1-OE The plant's efflux rate was twice that of WT, indicating overexpression. EiABCG1-OE The plant can excrete more glufosinate, thus enhancing its resistance to glufosinate.
[0056] Example 5: In vivo glufosinate analysis Rice variety to be tested: Wild type (ZH11) EiABCG1-OE ( EiABCG1-OE14 and EiABCG1-OE23 ) The specific steps are as follows: Place the newly sprouted wild-type... EiABCG1-OE Seeds were planted in pots containing moist soil, 3 seedlings per pot, 10 pots per variety for each strain, with 3 replicates, and cultured at 28°C under light (16 hours light / 8 hours dark). When the seedlings reached the four-leaf stage, foliar spraying with 68 g / ha of glufosinate (one-eighth of the recommended dosage) was applied. Stem material from the aboveground parts of each rice plant was collected at 5, 10, 20, 40, 60, 80, 100, and 120 minutes after treatment and stored at -80°C. Unabsorbed glufosinate on the stem material was removed by soaking in deionized water for 3 minutes. 4 grams of stem material were used for each protoplast preparation, with three biological replicates and two technical replicates for each treatment. The protoplast preparation method includes the steps described below.
[0057] The preparation of reagents shall be carried out in accordance with Tables 9 and 10; Table 9
[0058] Preparation of enzymatic hydrolysate: According to the components shown in Table 9 above, cellulase and ionizing enzyme were dissolved in a solution containing mannitol and MES. The solution was heated in a water bath at 55°C for 10 min to fully dissolve the enzymes. After cooling, CaCl2 and BSA were added to obtain the enzymatic hydrolysate.
[0059] Table 10
[0060] Prepare W5 solution according to the information shown in Table 10, and set aside. (2) Preparation of protoplast samples: Cut the leaves and leaf sheaths into 0.5 mm strips, transfer the strips to an Erlenmeyer flask, add 20 mL of enzymatic hydrolysis solution, and then perform enzymatic hydrolysis by shaking in the dark (temperature: 25-28℃, shaking at 50 rpm for 4 hours). After the enzymatic hydrolysis by shaking in the dark, filter the solution (using a 75 μm nylon mesh, manufactured by Shanghai Solarbio Co., Ltd., model YA1078) to remove undigested tissue fragments. Take the filtrate and centrifuge it at 100 × g and 4℃ for 4 min. Discard the supernatant and take the precipitate. Resuspend the precipitate in 10 mL of W5 solution to obtain a resuspended solution. Let it stand on ice for 30 min (to allow the protoplasts to settle naturally). Centrifuge the resuspended solution again at 100 × g and 4℃ for 3 min. Discard the supernatant to obtain a protoplast suspension. Take a small amount of protoplast suspension, add 0.01% FDA (fluorescein diacetate, Shanghai Solarbio Science & Technology Co., Ltd., IC5260), and then observe it under a fluorescence microscope (live cells fluoresce green, dead cells do not fluoresce). Count and calculate viability under the fluorescence microscope: viability = number of fluorescent cells / total number of cells × 100%. Viability ≥ 80% is required for subsequent experiments. Use the protoplast suspension with viability ≥ 80% as the test sample, reflux in 1N sulfuric acid at 90°C for 2 hours, then centrifuge at 10000g, and collect the supernatant. The supernatant is used for glufosinate content determination analysis using HPLC-Q-TOF-MS.
[0061] The results are as follows Figure 6 As shown, with wild-type (ZH11) as the control (WT), overexpression EiABCG1-OE plant ( EiABCG1- OE14 and EiABCG1-OE23 The glufosinate content in protoplasts was significantly reduced. After 90 minutes of treatment, the glufosinate content in the protoplasts of wild-type (ZH11) protoplasts was significantly lower than that of overexpressed protoplasts. EiABCG1-OE The 2.5-fold increase in plant density indicates overexpression. EiABCG1-OE The plant excretes more glufosinate, increasing its resistance to it.
[0062] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. EiABCG1 The application of genes in improving rice resistance to glufosinate is characterized by, The EiABCG1 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. EiABCG1 The application of genes in the genetic breeding of glufosinate-resistant rice or in the preparation of glufosinate-resistant rice is characterized by, The EiABCG1 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
3. The application according to claim 1 or 2, characterized in that, By improving EiABCG1 The expression level of the gene is increased to enhance the resistance of rice to glufosinate; this is achieved by increasing the expression level of the gene. EiABCG1 Gene expression levels include: by... EiABCG1 The gene was linked to an overexpression vector and then transformed into rice to construct glufosinate-resistant rice.
4. The application according to claim 3, characterized in that, The overexpression vector is pC2300.
5. A method for regulating the resistance of rice to glufosinate, characterized in that, include: Will EiABCG1 Gene transfer into rice, making EiABCG1 The gene is expressed in rice to regulate the rice's resistance to glufosinate; EiABCG1 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
6. The method according to claim 5, characterized in that, Will EiABCG1 Gene transfer into rice, making EiABCG1 Overexpression of the gene in rice can enhance its resistance to glufosinate; or... EiABCG1 Gene-overexpressing plants were hybridized with other rice plants to breed glufosinate-resistant rice.
7. A recombinant expression vector, characterized in that, A nucleotide sequence as shown in SEQ ID NO:1 was inserted.