An ippcas9 rice editor and its application in rice herbicide-resistant bio-breeding
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-02
- Publication Date
- 2026-08-11
AI Technical Summary
[0007]3.植物Cas9编辑产物随机性强,通常难以实现碱基替换
Smart Images

Figure CN122038464B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, specifically to an iPpCas9 rice editor and its application in herbicide-resistant rice biobreeding. Background Technology
[0002] The CRISPR-Cas9 system, as the most rapidly developing genome editing tool in recent years, has been widely used in plant gene function research and crop genetic improvement. Among them, SpCas9, derived from Streptococcus pyogenes, is currently the most widely used nuclease in plants. However, the system still faces the following technical bottlenecks and limitations in practical applications:
[0003] 1. PAM sequence dependence limits the range of target selection.
[0004] SpCas9 recognizes target DNA only if a conserved 5'-NGG-3' protospacer adjacent motif (PAM) is present downstream of the target sequence. Although NGG sequences occur relatively frequently in plant genomes (an average of one potential target site every 8-12 bp), they still cannot cover all ideal editing sites. This is especially true for applications requiring precise editing of specific nucleotide sites (such as point mutation repair or regulatory element modification), where the lack of suitable PAM sequences in the target region often prevents editing. To address this issue, current technologies primarily rely on isolating and identifying Cas9 homologous systems with different PAM preferences from microorganisms, such as SaCas9 (R = A or G) which recognizes NNG PAM, ScCas9 which recognizes NNG PAM, and GeoCas9 which recognizes N4GAAA. PpCas9, which recognizes N4RTN PAM, has also been isolated from Pasteurella pneumotropica, but its editing activity is low. However, although the above variants have broadened the target range to some extent, their editing capabilities vary depending on the target sequence and plant species. Currently, no Cas9 homolog has been found that can achieve efficient editing at any site in rice without sequence limitations.
[0005] 2. Only a few Cas9 homologs possess highly efficient editing activity in plants.
[0006] While various Cas9 homologs exist in nature, the number of those capable of efficient cleavage and stable genetic editing within plant cells remains limited after plant codon optimization and nuclear localization signal modification. The activity differences of Cas9 proteins from different sources in plants are influenced by various factors, including protein structure, thermostability, interaction with endogenous plant factors, and expression system adaptability. Currently, SpCas9 and its derivatives remain the mainstream tools for plant gene editing. Other homologs, such as StCas9 and FrCas9, have undergone plant tool-like modifications, but their editing efficiency in rice is generally low. PpCas9 and similar homologs have only been reported to have editing capabilities in animal cells, and their ability to edit in plants is unknown. To address the issue of insufficient activity, existing technologies attempt to improve editing efficiency by fusing exonucleases (such as T5E, SbcB, and Trex2) to promote microhomology-mediated end-joint repair pathways.
[0007] 3. Plant Cas9 editing products exhibit strong randomness, making base substitutions difficult to achieve.
[0008] In plants, when the CRISPR-Cas9 system cuts target DNA, its HNH domain cleaves the target strand and its RuvC domain cleaves the non-target strand, resulting in a double-strand break (DSB). Non-homologous end joining (NHEJ), the most important repair pathway in plants, directly joins the ends of the breaks caused by Cas9, typically resulting in 1-20 bp random insertions or deletions at the target site. Reports indicate that SpCas9 tends to create 1-3 bp deletions at positions -4 to -6 of the rice genome target (with the first base near the PAM side of the guide RNA sequence designated as -1, sequentially moving distally). These small insertions and deletions can disrupt the open reading frame, achieving gene knockout. However, most important traits in rice are caused by single-base substitutions at key positions, which cannot be obtained through direct Cas9 editing alone. Base editing tools developed by fusing deaminases to Cas9, which has impaired shearing ability, can mediate base substitutions. However, these tools have limited editability (e.g., T-to-A editing is difficult in plants), and the deaminases in the editors are prone to off-target effects, posing potential safety risks in breeding.
[0009] This invention aims to establish an efficient PpCas9 gene editing tool in rice, and based on this tool, to develop a new system to achieve effective base substitution at specific sites in the rice genome, creating herbicide-resistant rice germplasm and providing a new pathway for plant breeding. Summary of the Invention
[0010] To address the aforementioned technical problems, this invention provides an iPpCas9 rice editor and its application in herbicide-resistant rice biobreeding. The iPpCas9 rice editor comprises a PpCas9-RRA sequence and an isgRNA sequence. The PpCas9-RRA sequence is based on a mutant of highly active PpCas9, which is a mutation of W590R, K846R, and D849A in PpCas9. This variant is named PpCas9-RRA. Simultaneously, the 116nt wild-type PpCas9 sgRNA scaffold is truncated to 96nt by deleting 10nt each at positions 16-25 and 30-39, and this is named the isgRNA sequence. The gene editing system constructed by using PpCas9-RRA and isgRNA in combination (named iPpCas9) can efficiently achieve N4VTN PAM (V is C, A, or G) target site editing in rice, and its edited product has a tendency to insert a 1nt T at position -5.
[0011] Specifically, this invention provides an iPpCas9 rice editing system. In the experiment, the inventors evolved three key amino acid sites of PpCas9 and constructed a PpCas9-RRA expression cassette driven by the constitutive promoter ZmUBI1 in a codon-optimized sequence of rice; simultaneously, an isgRNA expression cassette driven by the OsU3 promoter was constructed. The two expression cassettes were integrated into the iPpCas9 plant expression vector to construct the corresponding targeting vector, and then effective gene editing of rice was achieved through rice genetic transformation.
[0012] Therefore, the present invention provides the following technical solution:
[0013] In a first aspect, the present invention provides an iPpCas9 rice editor in an optional embodiment, the iPpCas9 rice editor comprising a PpCas9-RRA sequence and an isgRNA sequence;
[0014] The nucleotide sequence of the PpCas9-RRA sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the isgRNA sequence is shown in SEQ ID NO.2.
[0015] Secondly, in an optional embodiment, the present invention provides a method for preparing the above-mentioned iPpCas9 rice editor, comprising the following steps:
[0016] S1: Obtain the iPpCas9 mutant sequence and clone it into a vector. Add the Kozak sequence to the 5' end of the sequence, and then add nuclear localization signal sequences to the 5' and 3' ends to obtain the iPpCas9 plasmid. Point mutations occur at the W590R, K846R and D849A positions of the iPpCas9 mutant sequence.
[0017] S2: Delete 10nt each from positions 16-25 and 30-39 of the 116nt PpCas9 wild-type sgRNA scaffold to shorten it to 96nt, thus obtaining the isgRNA expression cassette;
[0018] S3: Linearize the pHUC SpR backbone vector using PstI / SacI enzyme, recover the large fragment of the pHUC vector, and ligate the iPpCas9 plasmid and pHUC using T4 ligase to obtain the plant intermediate expression vector pHUC-iPpCas9.
[0019] S4: In the pHUC-iPpCas9, the OsU3 promoter is introduced through the HindIII restriction site to drive the isgRNA expression cassette, thus obtaining the iPpCas9 rice editor.
[0020] The nucleotide sequence of the 116nt PpCas9 wild-type sgRNA scaffold is shown in SEQ ID NO.3.
[0021] Thirdly, in an optional embodiment, the present invention provides an iPpCas9 rice editing system, including the aforementioned iPpCas9 rice editor.
[0022] Fourthly, in an optional embodiment, the present invention provides an application of the above-mentioned iPpCas9 rice editor in realizing the N4VTN PAM target editing of rice, wherein V is C, A or G.
[0023] Preferably, the target edited product has a tendency to insert a 1nt T at the -5 position.
[0024] Fifthly, in an optional embodiment, the present invention provides a rice iPpCas9-SpCas9 orthogonal vector, including the aforementioned iPpCas9 rice editor and SpCas9 rice editor.
[0025] Preferably, the preparation method of the SpCas9 rice editor is as follows:
[0026] S1: The PpCas9 coding sequence was cloned into the vector, and the Kozak sequence was added to the 5' end of the sequence. Then, nuclear localization signal sequences were added to the 5' and 3' ends to obtain the PpCas9 plasmid.
[0027] S2: Synthesize a 116nt PpCas9 wild-type sgRNA scaffold to obtain the sgRNA expression cassette;
[0028] S3: Linearize the pHUC SpR backbone vector using PstI / SacI enzyme, recover the large fragment of the pHUC vector, and ligate the PpCas9 plasmid and pHUC using T4 ligase to obtain the plant intermediate expression vector pHUC-PpCas9.
[0029] S4: In the pHUC-PpCas9, the OsU3 promoter is introduced through the HindIII restriction site to drive the sgRNA expression cassette, thus obtaining the PpCas9 rice editor.
[0030] In a sixth aspect, the present invention provides, in optional embodiments, a method for achieving accurate base substitution in the rice genome using the aforementioned rice iPpCas9-SpCas9 orthogonal vector, comprising the following steps:
[0031] By constructing gRNA1 fused with sgRNA scaffold in the aforementioned iPpCas9-SpCas9 orthogonal vector, SpCas9 is guided to generate a 1 nt or 1-3 nt deletion at positions -4 to -6 of the target sequence upstream of PAM. Using the target mutant sequence generated by SpCas9-gRNA1 as a template, gRNA2 is designed and fused with isgRNA scaffold in the aforementioned iPpCas9-SpCas9 orthogonal vector. Since this sequence only contains the sequence generated in the first round of SpCas9 editing, iPpCas9 does not edit the wild-type sequence but only edits specific SpCas9 products, utilizing iPpCas9's tendency to insert an A base at position -5. Through cyclic editing, base substitutions at positions -4 to -6 are achieved, resulting in A bases.
[0032] In a seventh aspect, the present invention provides, in optional embodiments, the application of the above-mentioned rice iPpCas9-SpCas9 orthogonal vector in the improvement of herbicide resistance.
[0033] On the other hand, the present invention also provides a mutant protein, the sequence of which is shown in SEQ ID NO.5 in the sequence listing.
[0034] On the other hand, the present invention provides a PpCas9 mutant with a mutation at position W590R / K846R / D849A, which is named PpCas9-RRA.
[0035] Preferably, the application includes the following steps:
[0036] Targeting the resistance-related nucleic acid sequences in rice herbicide target genes, gRNA1 was designed for SpCas9-mediated editing, and gRNA2 was designed for iPpCas9 second-round editing. Based on the PAM specificity principle of the CRISPR editing system, gRNA1 and gRNA2 were introduced into the iPpCas9-SpCas9 orthogonal vector as described in claim 6, and then introduced into Agrobacterium for genetic transformation. The OsACC1-I2314N mutant gene and protein, as described in SEQ ID NO.4 and SEQ ID NO.5, were induced in rice plants to obtain resistance to aryloxyphenoxypropionic acid herbicides such as quizalofop-p-ethyl and haloxyfop-methyl.
[0037] The nucleotide sequence shown in SEQ ID NO.1 is as follows:
[0038]
[0039] The nucleotide sequence shown in SEQ ID NO.2 is as follows:
[0040] GTTGTAGCTCCTTTGAAAAAACGTTGTTACAATAAGAGATGAATTTCTCGCAAAGCTCTGCCTCTTGAAATTTCGGTTTCAAGAGGCATCTTTTT.
[0041] The nucleotide sequence shown in SEQ ID NO.3 is as follows:
[0042] GTTGTAGCTCCCTTTTTCATTTCGCGAAAGCGAAATGAAAAACGTTGTTACAATAAGAGATGAATTTCTCGCAAAGCTCTGCCTCTTGAAATTTCGGTTTCAAGAGGCATCTTTTT.
[0043] The SEQ ID NO.4 is shown below:
[0044]
[0045] The SEQ ID NO.5 is shown below:
[0046]
[0047] Compared with the prior art, the present invention has one of the following beneficial effects:
[0048] 1. The iPpCas9 rice editor provided by this invention includes a PpCas9-RRA sequence and an isgRNA sequence. The PpCas9-RRA sequence is based on a mutant of highly active PpCas9, which is a mutation of W590R, K846R, and D849A in PpCas9. This variant is named PpCas9-RRA. At the same time, the 116nt wild-type PpCas9 sgRNA scaffold is shortened to 96nt by deleting 10nt each at positions 16-25 and 30-39. This is named the isgRNA sequence. The gene editing system (named iPpCas9) constructed by using PpCas9-RRA and isgRNA in combination can efficiently achieve N4VTN PAM (V is C, A, or G) target site editing in rice, and its editing product has a tendency to insert 1nt T at position -5. By fusing iPpCas9 and SpCas9 to construct an orthogonal editing vector, sgRNAs and isgRNAs were designed targeting sites with NGGNVTN or NNGGVTN PAM. Through recurrent editing, base substitutions at positions -4 to -6, producing A, were achieved. In the rice herbicide target gene OsACC1, sgRNA1 and sgRNA2, designed for specific sites, combined with iPpCas9-SpCas9 recurrent editing, efficiently obtained a T-to-A substitution at position 6941, resulting in the I2314N mutation, without requiring deamination or reverse transcription by the base editor. This resulted in rice exhibiting resistance to aryloxyphenoxypropionic acid herbicides such as quizalofop-P-ethyl and haloxyfop-R-methyl, exceeding fourfold. Attached Figure Description
[0049] Figure 1 This is a schematic diagram of the pHUC411-iPpCas9 carrier prepared in Example 1 of the present invention.
[0050] Figure 2 This is a schematic diagram showing the editing efficiency detection results of the PpCas9 rice editing system and the iPpCas9 rice editing system in rice genes SLR1, NAL1, BADH2 and IPA1 in Embodiment 2 of the present invention;
[0051] Figure 3 This is a schematic diagram showing the insertion method, size of the insertion mutation, location of the insertion mutation, and base type of the iPpCas9 rice editing system in Embodiment 2 of the present invention.
[0052] Figure 4This is a schematic diagram showing the selectivity results of the iPpCas9 rice editing system for the 5th base type in N4RTN PAM in Embodiment 2 of the present invention;
[0053] Figure 5 This is a schematic diagram illustrating the iPpCas9-SpCas9 orthogonal carrier and replacement editing strategy results in Embodiment 3 of the present invention. Figure 5 A is a schematic diagram of the orthogonal vector pHUC411-iPpCas9-SpCas9, which is constructed by simultaneously inserting iPpCas9 and SpCas9 system sequences into the pHUC vector. Figure 5 B represents the strategy of iPpCas9-SpCas9 to generate base substitution products through multiple edits at the same site. The example is the mutation of NGGNVTN PAM at position -5 to A.
[0054] Figure 6 This is a schematic diagram illustrating the results of herbicide resistance production in rice OsACC1 gene edited using the iPpCas9-SpCas9 orthogonal vector in Example 4 of the present invention. Figure 6 A is a schematic diagram showing the results of inducing herbicide resistance in rice using the iPpCas9-SpCas9 orthogonal system, the iPpCas9 single system, and the SpCas9 single system. Figure 6 B represents the resistant regenerated plants of the iPpCas9-SpCas9 orthogonal system, all of which contain a T-to-A substitution at position 6941 of the OsACC1 gene coding region, resulting in the I2314N mutation. Figure 6 The OsACC1-I2314N mutant rice line generated by the iPpCas9-SpCas9 orthogonal system developed normally under treatment with 4 times the concentration of quizalofop-P-ethyl and high-efficiency glyphosate, and showed significant resistance to aryloxyphenoxypropionic acid herbicides compared to the wild type. Detailed Implementation
[0055] The embodiments of the present invention are described below with reference to the accompanying drawings. It should be noted that the following embodiments are merely illustrative of exemplary implementations of the present invention and are not intended to limit the invention in any way. Those skilled in the art can make certain equivalent modifications and obvious improvements to the present invention.
[0056] Unless otherwise specified, the operations described in the following embodiments are performed using conventional practices common in the art. Those skilled in the art can readily obtain instruction on such conventional practices from existing technologies, for example, by referring to textbooks such as Sambrook and David Russell, *Molecular Cloning: A Laboratory Manual*, 3rd ed., Vols 1, 2; and Charles Neal Stewart, Alisher Touraev, Vitaly Citovsky and Tzvi Tzfira, *Plant Transformation Technologies*. Unless otherwise specified, the medicinal materials, reagents, and other ingredients used in the following examples are commercially available products.
[0057] Example 1
[0058] iPpCas9 plasmid construction
[0059] This invention first used a multi-point mutation kit from TransGen Biotech (Beijing) to perform W590R / K846R / D849A point mutations on PpCas9. After verification by Sanger sequencing from Shanghai Sangon Biotech Co., Ltd., the iPpCas9 coding sequence (as shown in SEQ ID NO.1) was obtained and cloned into the pUC57 vector. A Kozak sequence of GCCACC was added to the 5' end of the gene to facilitate efficient gene expression. Simultaneously, nuclear localization signals bpNLS were added to the 5' and 3' ends, respectively, to facilitate gene nuclear entry. At the same time, a 116nt wild-type sgRNA scaffold (as shown in SEQ ID NO.3) and a 96nt truncated isgRNA scaffold (as shown in SEQ ID NO.2) driven by the OsU3 promoter were synthesized. The pHUC SpR backbone vector (laboratory-preserved) was linearized using PstI / SacI enzymes. The large fragment of the pHUC vector (SpR gene removed by PstI / SacI) was recovered. The PpCas9 or iPpCas9 fragment and the pHUC fragment were ligated using T4 ligase (purchased from NEB) to obtain the plant intermediate expression vectors pHUC-PpCas9 or pHUC-iPpCas9. Further, an OsU3 promoter-driven sgRNA expression cassette was introduced into pHUC-PpCas9 via a HindIII restriction site, and an isgRNA expression cassette was introduced into pHUC-iPpCas9 using the same procedure, yielding the pHUC411-PpCas9 and pHUC411-iPpCas9 vectors (pHUC411-iPpCas9 vector is shown below). Figure 1 (As shown).
[0060] Example 2
[0061] The iPpCas9 system efficiently mediates rice gene editing.
[0062] 20nt guide RNAs (gRNAs) were designed for four rice genes (OsSLR1, LOC_Os03g49990; NAL1, LOC_Os04g52479; OsBADH2, LOC_Os08g32870; IPA1, LOC_Os08g39890) based on N4RTN PAM target sites. The target sequences (PAM is indicated by underscores) and the oligonucleotide sequences used for gRNA insertion are as follows (where underscores are adapter sequences used in cloning):
[0063] SLR1-T: TCCCAGCCGCTGCCGACTCG TCGAGTA
[0064] SLR1-T FP: GCAA TCCCAGCCGCTGCCGACTCG
[0065] SLR1-T RP: AAAC CGAGTCGGCAGCGGCTGGGA
[0066] NAL1-T: CTTTGGAAACCTTCAGAAAG GATTGTT
[0067] NAL1-T FP: GCAA CTTTGGAAACCTTCAGAAAG
[0068] NAL1-T RP: AAAC CTTTCTGAAGGTTTCCAAAG
[0069] BADH2-T: CCCTGGTGTAGACAAGGTAC AGCTATT
[0070] BADH2-T FP: GCAA CCCTGGTGTAGACAAGGTAC
[0071] BADH2-T RP: AAAC GTACCTTGTCTACACCAGGG
[0072] IPA1-T: GAGGAGGCCGCAAACCCCTT TGGCATC
[0073] IPA1-T FP: GCAA GAGGAGGCCGCAAACCCCTT
[0074] IPA1-T RP: AAAC AAGGGGTTTGCGGCCTCCTC
[0075] The FP and RP of each oligonucleotide pair were annealed to form double strands. The annealed products were then ligated to pHUC411-PpCas9 and pHUC411-iPpCas9 using T4 ligase, respectively. After Sanger sequencing verification, eight gene editing vectors were generated. These eight vectors were transformed into *Agrobacterium tumefaciens* strain EHA105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) using liquid nitrogen freeze-thaw conversion. After PCR sequencing verification, they were used for genetic transformation.
[0076] Agrobacterium tumefaciens, which had been transformed into the recombinant expression vector, was used to genetically transform and determine the editing efficiency of rice callus. The steps for rice genetic transformation, sample selection, and gene editing efficiency determination followed the method proposed by Liu Xiaoshuang et al. (Liu et al., Conditional knockdown of OsMLH1 to improve plant prime editing systems without disturbing fertility in rice. Genome Biology, 2024, 25(1): 1-18). Specifically, after Agrobacterium-infected rice callus was screened with 50 mg / L hygromycin for 2 weeks, genomic DNA was extracted from a pool of >200 newly formed resistant callus for each vector as a biological replicate (three replicates per sample). The corresponding genomic loci of the transformants were amplified using high-fidelity polymerase Q5 (purchased from NBE) and the following specific primers.
[0077] SLR1 NGS FP: TATCCCGCCAGCGCCGCCGGCT
[0078] SLR1 NGS RP: CCTCGCCGAGTCAGCAGCCGAC
[0079] NAL1 NGS FP: GTTGCTTCTGGGTGCACACACA
[0080] NAL1 NGSRP: TGGAAAGCTCTTATAGTCATCA
[0081] BADH2 NGS FP:GCTGATGTGTGTAAAGAGGTTG
[0082] BADH2 NGS RP: AGAGGAATATCATTTCCATTGA
[0083] IPA1 NGS FP: ATATGACAGGTTCCACCTGCTG
[0084] IPA1 NGS RP: ACAAGAGCCTCTGATGATAACCA
[0085] Amplicon libraries were obtained through simplified library construction and sequenced using the Illumina XTen next-generation sequencing platform at Suzhou Genewiz in paired-end PE150 mode, yielding at least 0.5 Gb of amplicon sequencing data per amplicon. The CRISPResso2 method (according to Clement et al.) was then used in a locally constructed system. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat Biotechnol. 2019; 37(3):224-226. doi:10.1038 / s41587-019-0032-3 (deployment), analyzed data in Cas9 mode to obtain reads of target mutations within the target region. The proportion of mutation reads to the total number of clean reads was calculated as the editing efficiency. Figure 2 As shown in Figure A, the editing efficiency of unoptimized pHUC411-PpCas9 was less than 5% at all four target sites, while the editing efficiency of modified pHUC411-iPpCas9 was significantly higher than that of pHUC411-PpCas9, with a maximum improvement of 11.3 times (at the BADH2-T site, the editing efficiency of iPpCas9 was 13.48%, which is 11.3 times that of PpCas9's editing efficiency of 1.19%).
[0086] from Figure 2 It can be seen that the editing efficiency of iPpCas9 in rice is significantly higher than that of PpCas9. Figure 2 In A, within the transgenic rice cell population, iPpCas9 showed significantly higher editing efficiency than PpCas9; Figure 2 In section B, the comparison of the bar charts shows that the iPpCas9 system can efficiently generate rice edited lines.
[0087] Furthermore, callus was cultured under hygromycin selection pressure and transgenic plants were regenerated. Forty-eight lines were randomly selected from each vector-regenerated plant, and specific detection primers were designed according to the Hi-TOM method proposed by Sun et al. (Sun et al, Hi-TOM 2.0: animproved platform for high-throughput mutation detection, Volume 67, pages 1532–1534, 2024, https: / / doi.org / 10.1007 / s11427-024-2555-x). The underlined sequences indicate Hi-TOM sequencing library adapter sequences, and the uppercase sequences are site-specific amplification primer sequences.
[0088] SLR1 HITOM FP: ggagtgagtacggtgtgc TATCCCGCCAGCGCCGCCGGCT
[0089] SLR1 HITOM RP: gagttggatgctggatgg CCTCGCCGAGTCAGCAGCCGAC
[0090] NAL1 HITOM FP: ggagtgagtacggtgtgc TTCTTATGGCCGACATCCAA
[0091] NAL1 HITOM RP: gagttggatgctggatgg TCATCAAGTCAAGCAAGCTA
[0092] BADH2 HITOM FP: ggagtgagtacggtgtgc GTCTTCCTTCAGGTGTGCTAA
[0093] BADH2 HITOM RP: gagttggatgctggatgg AATATCATTTCCATTGATGGGG
[0094] IPA1 HITOM FP: ggagtgagtacggtgtgc TTCCACCTGCTGCCTGAATT
[0095] IPA1 HITOM RP: gagttggatgctggatgg TCTGATGATACCACCAACAG
[0096] After amplification, library construction, and sequencing, plant targeted editing was identified using a 15% threshold. For example... Figure 2As shown in Figure B, the PpCas9 system only yielded a small number of edited lines at the SLR1-T and IPA1-T sites (1 out of 48 SLR1-T transgenic lines was edited, denoted as an editing frequency of 1 / 48; the IPA1-T editing frequency was 3 / 48), while the modified iPpCas9 could stably produce targeted mutant plants at different sites, specifically with SLR1-T frequencies of 27 / 48, NAL1-T frequencies of 15 / 48, BADH2-T frequencies of 12 / 48, and IPA1-T frequencies of 33 / 48. Compared to the highest frequency of 3 / 48 for PpCas9 at the same sites, these results further demonstrate that the rice gene editing capability of iPpCas9 is stronger than that of PpCas9.
[0097] A detailed analysis of the editing products in iPpCas9 plants was conducted, and the results are as follows: Figure 3 As shown, the editing products of the iPpCas9 rice editing system are mainly base insertions, primarily 1 bp insertions. These insertions mainly occur at positions -4 to -6, with a relatively high frequency at position -5. Furthermore, the inserted bases are predominantly A, indicating a strong preference for iPpCas9 editing products. Specifically, from... Figure 3 As can be seen from A, the iPpCas9 editing products are mainly insertion mutations. Figure 3 As can be seen from B, the iPpCas9 insertion mutations are mainly 1nt mutations; from Figure 3 As can be seen from C, 1nt insertions mainly occur at positions -4 to -6 of the target sequence, with position -5 having the highest frequency. Figure 3 As can be seen from D, the 1nt insertion is mainly an A base insertion.
[0098] To elucidate the selectivity of the iPpCas9 system for the 5th base type in N4RTN PAM during rice gene editing, four pairs of forward and reverse oligonucleotide chains containing the SLR1-T target were synthesized and annealed to form 4 double strands, in which the 5th base in PAM is G, A, C, and T, respectively.
[0099] In the sequence, the black sequence is the vector homologous arm used for Gibson recombination, the blue sequence is the SLR1-T artificial target, and the red-labeled single base is the 5th nucleotide of PAM.
[0100] SLR-G-FP1: AAACACTGATAGTTTACTCCCAGCCGCTGCCGACTCGTCGAGTA
[0101] SLR-G-RP1: TCCCGCCTTCAGTTTTACTCGACGAGTCGGCAGCGGCTGGGAGT
[0102] SLR-A-FP2: AAACACTGATAGTTTACTCCCAGCCGCTGCCGACTCGTCGAATA
[0103] SLR-A-RP2: TCCCGCCTTCAGTTTTATTCGACGAGTCGGCAGCGGCTGGGAGT
[0104] SLR-C-FP3: AAACACTGATAGTTTACTCCCAGCCGCTGCCGACTCGTCGACTA
[0105] SLR-C-RP3: TCCCGCCTTCAGTTTTAGTCGACGAGTCGGCAGCGGCTGGGAGT
[0106] SLR-T-FP4: AAACACTGATAGTTTACTCCCAGCCGCTGCCGACTCGTCGATTA
[0107] SLR-T-RP4: TCCCGCCTTCAGTTTTAATCGACGAGTCGGCAGCGGCTGGGAGT
[0108] The pHUC411-iPpCas9 vector containing SLR1-T gRNA was digested with PmeI. Four artificial targets were ligated into the T-DNA region of the vector using the HiFi DNAAssembly Cloning Kit. After successful Sanger sequencing, the four vectors were introduced into Agrobacterium and transformed into rice callus. After two weeks of growth in 50 mg / L hygromycin medium, 200 newly formed resistant callus cells were collected from each vector-transformed callus to form a sample for genomic DNA extraction as a template for amplification. The artificial target regions within the T-DNA were amplified using the primers described below.
[0109] T-DNA NGS FP: CTCTTAGGTTTACCCGCCAAT
[0110] T-DNA NGS RP: CATACGGGAAGAAGTGATGCAC
[0111] Library construction was performed using the amplified products, followed by sequencing in PE150 mode, yielding at least 0.5 Gb of amplicon sequencing data per amplicon. Reads containing the target mutation within the target region were analyzed using CRISPResso2. The editing efficiency was calculated as the proportion of mutated reads to the total clean reads. Results are as follows: Figure 4As shown, the iPpCas9 system can effectively edit targets with A, G, and C at the 5th position of the PAM (A, G, and C nucleic acids are degenerate into V, with an average efficiency greater than 15%), and the preference is G>C>A; however, the efficiency for targets with T at the 5th position of the PAM is significantly limited (average efficiency of 2.62%). Therefore, the preferred PAM for editing by the rice iPpCas9 system is N4VTN, which has a wider editable range than the NGG PAM of the commonly used SpCas9 system.
[0112] Example 3
[0113] Construction of rice iPpCas9-SpCas9 orthogonal vector and design of base substitution strategy
[0114] Using pHUC411-iPpCas9 as a template, the following primers were designed to amplify the OsU3-isgRNA-ZmUBI-iPpCas9 sequence using Q5 high-fidelity polymerase.
[0115] In the sequence, the black sequence is the vector homologous arm used for Gibson recombination, and the blue sequence is the iPpCas9 amplification sequence.
[0116] iPpCas9 FP:AAACACTGATAGTTTAAGCTTAAGGGATCTTTAAACA
[0117] iPpCas9 RP: TCCCGCCTTCAGTTTAGGTCACTGGATTTTGGTTTTTA
[0118] PmeI digestion of the pHUC411 vector containing SpCas9 and its corresponding sgRNA expression cassette (Li et al, Genomeediting mediated by SpCas9 variants with broad non-canonical protospacer-adjacent motif compatibility in plants. Molecular Plant. 2021, 14: 352-360). https: / / doi.org / 10.1016 / j.molp.2020.12.017 Using the HiFi DNA Assembly Cloning Kit, iPpCas9 and its isgRNA expression cassette were recombined into pHUC411 to obtain the pHUC411-SpCas9-iPpCas9 orthogonal vector (e.g., ...). Figure 5 (As shown in A).
[0119] Based on the characteristics of the products of SpCas9 and iPpCas9 gene editing in rice, this invention proposes a precise editing strategy that utilizes an SpCas9-iPpCas9 orthogonal vector to simultaneously edit two sgRNAs at NGGNVTN or NNGGVTN PAM sites, generating target base substitutions. Specifically, as... Figure 5 As shown in B: gRNA1, fused with SpCas9 sgRNA scaffold, was constructed on an orthogonal vector of SpCas9-iPpCas9, guiding SpCas9 to generate a 1 nt or 1-3 nt deletion at positions -4 to -6 of the upstream target sequence of PAM; gRNA2 was designed using the target mutant sequence generated by SpCas9-gRNA1 as a template, and fused with PpCas9 isgRNA scaffold to construct an orthogonal vector. Since this sequence only exists in the sequence generated by the first round of editing by SpCas9, iPpCas9 does not edit the wild sequence but only edits the specific SpCas9 product, taking advantage of the characteristic of iPpCas9 to insert an A base at position -5; base substitution at positions -4 to -6 was achieved through cyclic editing.
[0120] Example 4
[0121] The iPpCas9-SpCas9 orthogonal vector mediates the T-to-A mutation in the rice OsACC1 gene to induce herbicide resistance.
[0122] To target the resistance-related nucleic acid sequence gatctttttgaaggaattcttcaggctg in the rice herbicide target gene OsACC1, gRNA1 with tctttttgaaggaattcttc was designed for SpCas9-mediated editing; gRNA2 with gatctttttgaaggaatctt (an artificial sequence with a 1-base deletion at position -5 compared to the wild-type ACC1 sequence, used to select the SpCas9 editing product) was designed for iPpCas9 second-round editing.
[0123] Based on the PAM specificity principle of the CRISPR editing system, this application introduced gRNA1 into the SpCas9 vector, gRNA2 into the iPpCas9 vector (the above are control vectors), and simultaneously introduced gRNA1 and gRNA2 into the iPpCas9-SpCas9 orthogonal vector. The three vectors were introduced into Agrobacterium for rice genetic transformation. After 21 days of selection of infected callus with 50 mg / L hygromycin, 600 new callus cells (independent transformation events) from each vector were transferred to differentiation medium containing 9 µmol of methomyl herbicide-resistant medium for selection and regeneration of seedlings. After 4 weeks of culture, for the SpCas9-gRNA1 vector, only 2 callus cells showed minimal growth and no plant regeneration; for the iPpCas9-sgRNA2 vector, no callus growth or plant regeneration occurred; for the iPpCas9-SpCas9-sgRNA1-sgRNA2 orthogonal vector callus, 148 callus cells (independent transformation events) showed significant growth and regenerated 55 plants (partial selection and regeneration results are shown in the figure). Figure 6 (As shown in A).
[0124] Design the following detection primers:
[0125] ACC-I2314 FP:GTGTGGTTTCCAGATTCTGC
[0126] ACC-I2314 RP:CCTCGTAGCTCTGCAGCCAT
[0127] Genomic DNA was extracted and amplified from 10 randomly selected iPpCas9-SpCas9 regenerated plants. Sanger sequencing revealed that all regenerated plants had a mutation from a T base to an A base at position 6941 of the OsACC1 sequence (SEQ ID NO.4). Figure 6 B), resulting in a mutation of isoleucine (I) at position 2314 of the OsACC1 protein (SEQ ID NO.5) into asparagine (N). Further, six randomly selected regenerated plants were transplanted into the soil and grown for three weeks. They were then sprayed with either 4 ml / L quizalofop-P-ethyl or 480 mg / L glyphosate herbicide (three plants of each herbicide, four times the recommended concentration). After 15 days, the iPpCas9-SpCas9 edited ACC1-I2314N line showed normal green color and no significant growth inhibition, while the unedited wild-type control plants at the same time showed yellowing leaves and plant death (e.g., ...). Figure 6 As shown in Figure C), this demonstrates that the iPpCas9-SpCas9 orthogonal system can effectively edit the OsACC1-I2314N mutation to produce herbicide resistance in rice.
Claims
1. An iPpCas9 rice editor, characterized in that, The iPpCas9 rice editor includes a PpCas9-RRA sequence and an isgRNA sequence; The nucleotide sequence of the PpCas9-RRA sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the isgRNA sequence is shown in SEQ ID NO.
2.
2. A method for preparing the iPpCas9 rice editor according to claim 1, characterized in that, Includes the following steps: S1: Obtain the PpCas9-RRA sequence and clone it into a vector. Add the Kozak sequence to the 5' end of the sequence, and then add nuclear localization signal sequences to the 5' and 3' ends to obtain the iPpCas9 plasmid. Point mutations occur at the W590R, K846R and D849A positions of the PpCas9-RRA sequence. S2: Delete 10nt each from positions 16-25 and 30-39 of the 116nt PpCas9 wild-type sgRNA scaffold to shorten it to 96nt, thus obtaining the isgRNA expression cassette; S3: Linearize the pHUC SpR backbone vector using PstI / SacI enzyme, recover the large fragment of the pHUC vector, and ligate the iPpCas9 plasmid and pHUC using T4 ligase to obtain the plant intermediate expression vector pHUC-iPpCas9. S4: In the pHUC-iPpCas9, the OsU3 promoter is introduced through the HindIII restriction site to drive the isgRNA expression cassette, thus obtaining the iPpCas9 rice editor.
3. An iPpCas9 rice editing system, characterized in that, Including the iPpCas9 rice editor as described in claim 1.
4. The application of the iPpCas9 rice editor as described in claim 1 in the editing of rice N4VTN PAM targets, wherein, V can be C, A, or G.
5. A rice iPpCas9-SpCas9 orthogonal vector, characterized in that, Includes the iPpCas9 rice editor and SpCas9 rice editor as described in claim 1.
6. A method for achieving accurate base substitution in the rice genome using the rice iPpCas9-SpCas9 orthogonal vector as described in claim 5, characterized in that, Includes the following steps: By constructing gRNA1 fused with sgRNA scaffold on the iPpCas9-SpCas9 orthogonal vector as described in claim 5, SpCas9 is guided to generate a 1 nt or 1-3 nt deletion at position -4 to -6 of the upstream target sequence of PAM; gRNA2 was designed using the target mutant sequence generated by SpCas9-gRNA1 as a template and fused with isgRNA scaffold to construct the iPpCas9-SpCas9 orthogonal vector as described in claim 5. Since this sequence only exists in the first round of editing by SpCas9, iPpCas9 does not edit the wild sequence but only edits the specific SpCas9 product. Taking advantage of the characteristic of iPpCas9 to insert an A base at position -5, base substitutions at positions -4 to -6 are achieved through cyclic editing.
7. The application of the rice iPpCas9-SpCas9 orthogonal vector as described in claim 5 in the improvement of herbicide resistance.
8. The application according to claim 7, characterized in that, The application includes the following steps: Targeting the resistance-related nucleic acid sequences in rice herbicide target genes, gRNA1 was designed for SpCas9-mediated editing, and gRNA2 was designed for iPpCas9 second-round editing. Based on the PAM specificity principle of the CRISPR editing system, gRNA1 and gRNA2 were introduced into the iPpCas9-SpCas9 orthogonal vector as described in claim 5, and then introduced into Agrobacterium for genetic transformation. The OsACC1-I2314N mutant gene and protein, as described in SEQ ID NO.4 and SEQ ID NO.5, were induced in rice plants to obtain resistance to aryloxyphenoxypropionic acid herbicides such as quizalofop-p-ethyl and haloxyfop-methyl.
Citation Information
Patent Citations
High-efficiency wide-window single-base editing gene, application thereof and breeding method thereof
CN110878305A
Pacas9 nuclease
CN113272425A