Use of isca2 in the preparation of drugs for preventing and treating peritoneal fibrosis and related products and methods

Abstract

This invention discloses the application of ISCA2 in the preparation of drugs for the prevention and treatment of peritoneal fibrosis, as well as related products and methods, belonging to the field of biomedical technology. The key technical point is: the application of ISCA2 protein in the preparation of drugs for the prevention and / or treatment of peritoneal fibrosis. This invention provides a novel application of ISCA2. Experiments have shown that the expression of ISCA2 protein in mouse peritoneal tissue is inhibited under high glucose conditions. Overexpression of ISCA2 protein by intraperitoneal injection of ISCA2 adeno-associated virus in mice can promote iron-sulfur cluster enzyme activity, thereby improving peritoneal fibrosis. Based on the experimental results, it can be seen that overexpression of ISCA2 can have a therapeutic effect on peritoneal fibrosis, thus showing good application prospects in the field of related drug preparation.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically, to the application of ISCA2 in the preparation of drugs for the prevention and treatment of peritoneal fibrosis, as well as related products and methods. Background Technology

[0002] Currently, the global prevalence of chronic kidney disease (CKD) is approximately 10.8%, making it a common chronic disease that severely impacts human health. Peritoneal dialysis (PD) is the primary treatment for patients with end-stage renal disease (ESRD), widely used in clinical practice due to its ease of operation, high cost-effectiveness, and better preservation of residual renal function. However, with the continuous extension of peritoneal dialysis duration, the peritoneal structure undergoes progressive changes, and its function gradually declines until ultrafiltration failure occurs. Once ultrafiltration failure occurs, it directly leads to peritoneal dialysis failure, increasing hospitalization rates and even mortality in PD patients.

[0003] However, there are currently no drugs available in clinical practice to treat peritoneal structural damage and functional decline caused by long-term peritoneal dialysis. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide the application of ISCA2 in the preparation of drugs for the prevention and treatment of peritoneal fibrosis, as well as related products and methods. In a high-glucose environment, the expression of ISCA2 protein in mouse peritoneal tissue is inhibited. By injecting ISCA2 adeno-associated virus into mice via intraperitoneal injection, ISCA2 protein overexpression is achieved, thereby improving peritoneal fibrosis.

[0005] The above-mentioned technical objective of the present invention is achieved through the following technical solution: In one aspect, the use of ISCA2 protein in the preparation of drugs for the prevention and / or treatment of peritoneal fibrosis is provided.

[0006] Secondly, the invention provides the application of the nucleic acid encoding the ISCA2 protein in the preparation of drugs for the prevention and / or treatment of peritoneal fibrosis.

[0007] Thirdly, this invention provides the application of adeno-associated virus that enhances ISCA2 protein expression levels in the preparation of drugs for the prevention and / or treatment of peritoneal fibrosis.

[0008] Fourthly, a pharmaceutical composition for the prevention and / or treatment of peritoneal fibrosis is provided, comprising a therapeutically effective amount of an active ingredient and a pharmaceutically acceptable carrier, said active ingredient being selected from ISCA2 protein, nucleic acid encoding said ISCA2 protein, or adeno-associated virus containing said nucleic acid.

[0009] Fifthly, an adeno-associated virus is provided, comprising a vector backbone and a target gene fragment encoding the ISCA2 protein.

[0010] Sixthly, a method for constructing an adeno-associated virus as described in the fifth aspect is provided, comprising the following steps: S1: Construct an adeno-associated virus vector. The primer sequences used to amplify the target gene fragment during vector construction are shown in SEQ ID No:2 and SEQ ID No:3. S2: Adeno-associated virus packaging.

[0011] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a novel application for ISCA2. Experiments have shown that ISCA2 protein expression is inhibited in mouse peritoneal tissue under high glucose conditions. Overexpression of ISCA2 protein via intraperitoneal injection of ISCA2 adeno-associated virus in mice can promote iron-sulfur cluster enzyme activity, thereby improving peritoneal fibrosis. Based on these experimental results, it is evident that ISCA2 overexpression can treat peritoneal fibrosis, thus demonstrating promising application prospects in the preparation of related drugs. Attached Figure Description

[0012] The accompanying drawings, which are included to provide a further understanding of embodiments of the invention and form part of this application, do not constitute a limitation thereof. In the drawings: Figure 1 This is a Western blotting result of ISCA2 protein in mouse peritoneal tissue after treatment with peritoneal dialysis fluid in Example 1. Figure 2 The diagram shows the mRNA results of ISCA2 protein knockdown in RPMC in Example 2, and the expression and quantification of FN and αSMA proteins in RPMC treated with ISCA2 protein knockdown and high glucose medium. Figure 3 Immunofluorescence and quantitative images of FN and Vimentin proteins in RPMCs treated with ISCA2 knockdown and high-glucose medium in Example 2 are shown. Figure 4 This is a verification image of ISCA2 protein expression in the peritoneal tissue of mice after ISCA2-AAV overexpression of ISCA2 protein was injected via the tail vein in Example 3. Figure 5 This is a Masson staining image of mouse peritoneal tissue after treatment with ISCA2 protein expression and peritoneal dialysis fluid in Example 3; Figure 6This is a bar chart showing the peritoneal ultrafiltration capacity and glucose transport capacity of mice treated with ISCA2 expression and peritoneal dialysis fluid in Example 4. Figure 7 Immunohistochemical and quantitative images of FN and Collagen I proteins in mouse peritoneal tissue after treatment with ISCA2 expression and peritoneal dialysis fluid in Example 5; Figure 8 The images show the expression and quantification of FN protein in the peritoneal tissue from Example 5. Figure 9 The images show the expression and quantification of E-cadherin protein in the peritoneal tissue from Example 5. Figure 10 The graph shows the oxygen consumption rate (OCR) results of RPMC in Example 6. Detailed Implementation

[0013] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0014] Peritoneal dialysis fluid contains a high concentration of glucose. Studies have found that mesothelial-to-mesenchymal transition (MMT) induced by high-concentration peritoneal dialysis fluid is a significant cause of peritoneal structural damage and functional decline. This involves the gradual loss of polarization in peritoneal mesothelial cells, the loss of tight junctions between cells, and their transformation into myofibroblast-like, mobile, and invasive interstitial cells. This is accompanied by a decrease in the expression of mesothelial cell marker proteins such as E-cadherin, and an increase in the expression of interstitial cell marker proteins such as vimentin, α-smooth muscle actin (α-SMA), and fibronectin (FN).

[0015] Iron-sulfur cluster assembly 2 (ISCA2) is a highly conserved iron-sulfur cluster (ISC) assembly protein, primarily located in mitochondria, playing a central role in the biosynthesis and transport of iron-sulfur clusters. As a key component of the iron-sulfur cluster assembly system, ISCA2 catalyzes the transfer of iron-sulfur clusters from the initial scaffold protein to the target protein in synergy with chaperone proteins such as ISCA1, NFU1, and IBA57, and participates in their maturation process. Iron-sulfur clusters are essential cofactors for electron transport chain complexes (such as complexes I, II, and III) and DNA repair enzymes (such as DNA polymerase and helicase), and their normal assembly is crucial for mitochondrial energy metabolism, redox homeostasis, and genome stability. Mutations or interferences in the ISCA2 gene can affect iron-sulfur cluster assembly, leading to mitochondrial respiratory chain dysfunction, mitochondrial DNA loss, and ultimately, neurodegenerative (white matter) lesions. Furthermore, functional studies of ISCA2 in other physiological or pathological processes remain very limited.

[0016] The specific operational steps of Western blot, real-time quantitative PCR, siRNA, Masson staining, immunohistochemistry, immunofluorescence, seahorse hippocampus assay, and statistical analysis in this invention are as follows: Western blot: Total protein was extracted from peritoneal tissue / cells using RIPA lysis buffer (Beyotime) and cocktail (Merck), and protein concentration was determined using the BCA method. 20 μg of protein sample was loaded onto a PVDF membrane and subjected to 7% or 10% polyacrylamide gel electrophoresis (SDS-PAGE) at 300 mA for 2 hours. The membrane was blocked with 5% BSA at room temperature for 1 hour, eluted with TBST, and then incubated overnight at 4°C with the following primary antibodies: ISCA2 (Proteintech), FN (Abcam), E-cadherin (BD), β-actin (Cell Signaling Technology), Gapdh (Huabio), and α-SMA (Abcam). The membrane was washed three times with TBST for 10 minutes each time, incubated with the corresponding secondary antibody at room temperature for 1 hour, and then eluted three times with TBST for 10 minutes each time. Antigen-antibody complexes were visualized using enhanced chemiluminescence (ECL), and protein bands were exposed using a ChemiD MP imaging system. Image J software was used to perform quantitative analysis of the target band, and the relative expression level of the target protein was expressed as the gray value of the target band / β-actin or the gray value of the target band / Gapdh gray value.

[0017] Real-time quantitative PCR (qPCR): RNA was extracted and purified from peritoneal tissue / cells using an RNA extraction kit (Vazyme), and RNA concentration and purity were determined by UV spectrophotometry. 1 μg of RNA was reverse transcribed into cDNA using a reverse transcription kit (Vazyme), and changes in different genes were detected according to the reaction system described below.

[0018] a. Reaction system: SYBR qPCR master mix 5μL; primer mix 3μL; cDNA 2μL.

[0019] b. qPCR thermal cycling parameters: 1.95℃, 10 min; 2.95℃, 15 min; 3.60℃, 1 min; 4. GOTO 2, 39 loops.

[0020] siRNA: Log-phase rat peritoneal mesothelial cell lines were seeded in 12-well plates. When cell confluence reached 70%, the original culture medium was removed, and the cells were starved in serum-free DMEM F12 for 6-8 hours. siRNA and transfection reagent were mixed according to the instructions using Lipofectamine RNAiMAX (Invitrogen) transfection reagent, and after incubation, the mixture was added to the cell culture medium. After further incubation at 37°C for 24 hours, RNA was extracted using an RNA extraction kit; protein was extracted after 48 hours of incubation.

[0021] Masson staining: Tissue was fixed with 4% paraformaldehyde for 24-48 hours, dehydrated and cleared with graded ethanol, embedded in paraffin, and dewaxed to water. The tissue was then rinsed three times with tap water and distilled water. The nuclei were stained with hematoxylin and eosin for 5-10 minutes, followed by rinsing with running water for 10 minutes. The nuclei were then stained with Masson's Ponceau Acid Flavescent Solution for 5-10 minutes. The tissue was briefly rinsed with 2% glacial acetic acid solution. Differentiation was performed with 1% phosphomolybdic acid solution for 3-5 minutes. Without rinsing, the tissue was directly stained with aniline blue or light green solution for 5 minutes. The tissue was then briefly rinsed with 0.2% glacial acetic acid solution. The tissue was cleared with 95% ethanol, anhydrous ethanol, and xylene, and then mounted with neutral resin.

[0022] Immunohistochemistry: Tissues were fixed with 4% paraformaldehyde for 24-48 hours, dehydrated and cleared with graded ethanol, embedded in paraffin, sectioned, and dewaxed to water; boiled in a microwave oven at medium heat for 10 minutes with sodium citrate (10 mM, pH 6.0); cooled to room temperature, blocked with goat serum at room temperature for 1 hour, and then incubated overnight at 4°C with FN (Abcam) and Collagen I (Abcam) antibodies; washed three times with PBS for 10 minutes each time, stained with DAB, counterstained with hematoxylin, dehydrated, and mounted with neutral resin; observed under a microscope and images were acquired.

[0023] Immunofluorescence: In vitro, rat peritoneal mesothelial cells were selected and seeded in 12-well plates during the logarithmic growth phase. When the cell confluence was 60-70%, ISCA2 was knocked down using IMAX transfection reagent (Invitrogen). The cells were then treated with 138 mM high glucose medium for 48 h, washed three times with PBS, fixed with 4% PFA for 20 min, washed three times with PBS for 5 min each time, permeabilized with 5% Triton for 30 min, washed three times with PBS for 5 min each time, blocked with 5% BSA for 1 h, and then incubated overnight at 4 °C with FN (Abcam) and Vimentin (Abcam) antibodies. The cells were washed three times with PBS for 10 min each time, incubated with the corresponding fluorescent secondary antibody at room temperature for 1 h, washed three times with PBS, mounted with DAPI, and observed and images were acquired under a microscope.

[0024] Seahorse: Rat peritoneal mesothelial cells were used in vitro. Cells in the logarithmic growth phase were seeded in 96-well plates. Different groups of cells were treated accordingly. When cell confluence reached 80%, the cell culture medium was replaced with pre-warmed basal medium, ensuring a consistent volume per well (usually 180 μL). The cell culture plates were pre-incubated in a CO2-free incubator for 1 hour, and the baseline OCR value was recorded using a Seahorse XF analyzer. The following injection solutions were added sequentially: Oligomycin: wait 3 minutes, record OCR. FCCP: wait 3 minutes, record OCR. Rotenone / Antimycin A: wait 3 minutes, record OCR. Statistical analysis: All experimental data were expressed as mean ± SEM. Comparisons among multiple groups were performed using analysis of variance (ANOVA). p < 0.05 was considered statistically significant; p < 0.05 was marked as *; p < 0.01 was marked as **; p < 0.001 was marked as ****.

[0025] Example 1: ISCA2 protein expression was inhibited in peritoneal fibrosis induced by peritoneal dialysis solution (PDS) in mice.

[0026] Establishment of a peritoneal dialysis mouse model: Male C57BL / 6J mice weighing 25-27g were injected intraperitoneally with 4.25% peritoneal dialysis fluid (100 mL / kg body weight) daily for 6 weeks, after which they were euthanized and peritoneal tissues were collected.

[0027] Mice were randomly divided into a control group (CTR) and a peritoneal dialysis model group (PDS). The model group was induced as described above, while the control group was injected with an equal volume of physiological saline.

[0028] Peritoneal tissues from the above groups were collected, proteins were extracted, and Western blot analysis was performed to detect changes in ISCA2 protein expression. The results... Figure 1 As can be seen from A, compared with the control group, the ISCA2 protein level in mice decreased significantly after injection of peritoneal dialysis fluid. Figure 1 B is a statistical chart of WB band grayscale values, and its results are... Figure 1 The results are consistent with analysis A in the previous studies. These results validate, at the animal level, that ISCA2 levels significantly decrease after peritoneal dialysis.

[0029] Example 2: Knockdown of ISCA2 exacerbates high glucose-induced RPMC fibrosis.

[0030] ISCA2 protein expression was successfully knocked down by transfecting ISCA2 siRNA into the rat peritoneal mesothelial cell (RPMC) line using liposomes. Subsequently, fibrosis was induced using 138 mM high-glucose medium, and the knockdown efficiency was verified by qRT-PCR. Western blotting and immunofluorescence techniques were used to assess changes in the expression of fibrosis-related proteins. Figure 2 Western blot results for B showed that high-glucose culture medium led to increased expression of fibrosis-related proteins FN and α-SMA in RPMCs. Knockdown of ISCA2 further increased the expression of FN and α-SMA. Figure 2 C and D are statistical graphs of WB band grayscale values, and their results are consistent with... Figure 2 This is consistent with the analysis in section B. Figure 3 Immunofluorescence results also showed that high-glucose culture medium led to increased expression of the fibrosis-associated protein FN, and knockdown of ISCA2 further enhanced FN expression. Figure 3 C is a quantitative graph of FN fluorescence intensity. Similarly, vimentin shows a similar trend, as shown in the immunofluorescence graph. Figure 3 As shown in B, the fluorescence quantitative chromatogram is as follows: Figure 3 As shown in D.

[0031] In summary, these results consistently indicate that knocking down ISCA2 exacerbates high-glucose-induced RPMC fibrosis.

[0032] Example 3: ISCA2 overexpression protects peritoneal fibrosis caused by peritoneal dialysis.

[0033] A) Preparation of adeno-associated virus vector: The pHBAAV-CMV-MCS-3flag-T2A-ZsGreen vector was selected, and the nucleotide sequence of the target gene fragment is shown in SEQ ID No:1: atggcggcctccagggccttgtccctaactgccgaggcggtcagggctgtcattcctaggcgctcgggaaggctcctcgccgtctttcccaggcttttgacccgctgggaaacaaca tcttccattccagaggctggcgagggacagatccgcctcacagacagctgcgtccagaggcttctggaaatcaccgaagggtcagaattcctcaggctgcaagtagagggaggtgga tgctccggattccaatacaaattttcactggatacagttattaaccccgacgacagggtatttgaacagggtggggcaagagtggtggttgactctgatagcttggccttcgttaag ggagcccaggtggacttcagccaagaactgatccgaagctcattccaagtgttgaataaccctcaagcccagcaaggctgctcctgtgggtcatccttctctgtcaaagtctga (seq ID No:1).

[0034] Primers were designed for PCR amplification of the ISCA2 gene. The upstream primer was 3'-TGACCTCCATAGAAGACACCGGGATCCGCCACCATGGCGGCCTCCAG-5' (SEQ ID No:2), and the downstream primer was 3'-ATCCTTGTAGTCGTTAATTAAGGTACCGACTTTGACAGAGAAGGATG-5' (SEQ ID No:3).

[0035] The vector was digested with restriction endonucleases BamHI and MIuI, and the purified linearized vector was recovered by agarose gel electrophoresis. PCR of the target gene fragment was performed using designed primers, and the correctly sized target gene fragment was recovered by agarose gel electrophoresis. The linearized vector and the target gene fragment were ligated using the HBinfusion™ one-step cloning ligation system. The ligation product was transformed into DH5α competent cells, plated, and cultured for 12-16 hours. Single colonies were selected for colony verification. Positive colonies with correct verification results were selected. Clones are sequenced; clones with correct sequencing are then amplified and purified by plasmid extraction.

[0036] B) Adeno-associated virus packaging and quality testing: The viral packaging process was carried out using a three-plasmid adeno-associated virus (AAV) system, which includes the following plasmids: a vector plasmid carrying the ISCA2 gene, a pAAV-RC vector plasmid, and a pHelper vector plasmid. After high-purity, endotoxin-free extraction of the three plasmid vectors, they were transfected using Hanheng's Lipofiter™ transfection reagent.

[0037] AAV-293 cells were co-transfected with the three plasmids; cell pellet was collected 72 hours after transfection; cells were lysed, cell debris was removed, and the lysate supernatant containing adeno-associated virus particles was collected; the virus was purified using the Biomiga Adeno-Associated Virus Purification Kit V1469-01, and the purified virus solution was collected and stored at -80°C.

[0038] Male C57BL / 6J mice weighing 25-27 g were randomly divided into three groups: control group (CTR), peritoneal dialysis group (PDS), and ISCA2 overexpression group (PDS+ISCA2).

[0039] Control group (CTR): One month after intraperitoneal injection of control virus (130 μL per mouse), mice were injected intraperitoneally with physiological saline (100 mL / kg body weight) daily for 6 weeks.

[0040] Peritoneal dialysis group (PDS): One month after intraperitoneal injection of control virus (130 μL per mouse), mice were injected intraperitoneally daily with 4.25% peritoneal dialysis fluid (100 mL / kg body weight) for 6 weeks.

[0041] ISCA2 overexpression group (PDS+ISCA2): One month after intraperitoneal injection of ISCA2 adeno-associated virus (130 μL per mouse), mice were intraperitoneally injected with 4.25% peritoneal dialysis fluid (100 mL / kg body weight) daily for 6 weeks.

[0042] Depend on Figure 4Figures A and B show that ISCA2 was successfully overexpressed in mouse peritoneal tissue. Figure 5 A shows the Masson staining results after high-glucose dialysate modeling and ISCA2 overexpression. Compared with the control group, high-glucose dialysate caused significant peritoneal thickening; while ISCA2 overexpression significantly reduced peritoneal thickening. Figure 5 B is a statistical graph of Masson staining, and the results are consistent with... Figure 5 A is consistent.

[0043] These results validated at the animal level that overexpression of ISCA2 protein can protect against peritoneal fibrosis induced by peritoneal dialysis.

[0044] Example 4: ISCA2 improves peritoneal ultrafiltration and solute transport dysfunction induced by high glucose dialysis fluid, with the same grouping as in Example 3.

[0045] like Figure 6 As shown in Figure A, ISCA2 overexpression significantly inhibited the decrease in peritoneal ultrafiltration in mice induced by high-glucose dialysate. Figure 6 As shown in B, high-glucose dialysate leads to a decrease in glucose transport capacity in mice, while ISCA2 overexpression significantly improves this phenomenon. Therefore, ISCA2 can improve high-glucose-induced peritoneal dysfunction.

[0046] Example 5: ISCA2 protein improves peritoneal fibrosis in mice induced by peritoneal dialysis fluid, with the same grouping as in Example 3.

[0047] Immunohistochemistry and Western blotting were used to detect the expression of peritoneal fibrosis-related proteins FN, E-cadherin, and Collagen I in mouse peritoneal tissue. Figure 7 A, B, and C show that peritoneal dialysis fluid significantly increased the area of ​​FN and Collagen I positive staining in mouse peritoneal tissue, while overexpression of ISCA2 significantly reduced the area of ​​FN and COL1A1 positive staining. Figure 8 A and 9A represent the expression results of FN and E-cadherin proteins in mouse peritoneum, respectively. Figure 8 B and 9B represent their respective statistical quantitative results. High-glucose dialysis fluid treatment significantly increased FN protein expression, while ISCA2 overexpression significantly decreased FN protein levels. High-glucose dialysis fluid treatment led to a significant decrease in E-cadherin protein levels in peritoneal tissue, while ISCA2 overexpression significantly restored E-cadherin protein expression levels. These results indicate that ISCA2 overexpression can significantly inhibit the expression of high-glucose dialysis fluid-induced fibrosis markers FN and Collagen I, and restore E-cadherin expression, thereby effectively improving high-glucose dialysis fluid-induced peritoneal mesothelial-mesenchymal transition (MMT) and thus improving peritoneal fibrosis.

[0048] Example 6: ISCA2 can improve mitochondrial metabolic disorders in rat peritoneal mesothelial cells induced by high glucose culture medium.

[0049] In vitro, rat peritoneal mesothelial cells were selected and seeded in 6-well plates at logarithmic growth phase. The cells were divided into four groups: control group (CTR): cultured in basal medium for 48 hours; high glucose model group (HG): treated with 138 mM high glucose medium for 48 hours; high glucose treatment with ISCA2 knockdown group (HG + siISCA2): ISCA2 knocked down 6-8 hours using iMax transfection reagent, followed by treatment with 138 mM high glucose medium for 48 hours; ISCA2 knockdown group alone (siISCA2): ISCA2 knocked down 6-8 hours using iMax transfection reagent, followed by treatment with basal medium for 48 hours.

[0050] Figure 10 AC represents the oxygen consumption rate (OCR) of rat peritoneal mesothelial cells. Under basal conditions, the oxygen consumption rate of the HG group was significantly lower than that of the control group. Knockdown of ISCA2 further reduced the oxygen consumption rate of the HG + siISCA2 group, and the oxygen consumption rate of the ISCA2 knockdown group alone was also lower than that of the control group. Basal oxygen consumption ( Figure 10 B) and maximum oxygen demand ( Figure 10 C) All of these changes are the same. The above results indicate that ISCA2 can improve mitochondrial dysfunction induced by high glucose culture medium in rat peritoneal mesothelial cells and effectively alleviate mitochondrial functional damage under high glucose environment by maintaining mitochondrial oxygen consumption rate.

[0051] Working Principle: This invention provides a novel application for ISCA2. Experiments have shown that ISCA2 protein expression is inhibited in mouse peritoneal tissue under high glucose conditions. Overexpression of ISCA2 protein by intraperitoneal injection of ISCA2 adeno-associated virus in mice can maintain mitochondrial function, thereby improving peritoneal fibrosis. Based on the experimental results, it can be concluded that overexpression of ISCA2 can treat peritoneal fibrosis, thus showing good application prospects in the field of related drug preparation.

[0052] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The use of an ISCA2 protein in the preparation of a drug for the prevention and / or treatment of peritoneal fibrosis caused by peritoneal dialysis.

2. The use of a nucleic acid encoding an ISCA2 protein in the preparation of a drug for the prevention and / or treatment of peritoneal fibrosis caused by peritoneal dialysis.

3. The use of an adeno-associated virus that enhances ISCA2 protein expression in the preparation of a drug for the prevention and / or treatment of peritoneal fibrosis caused by peritoneal dialysis.

Images