An engineered bacterium for synthesizing n-acetylglucosamine, a construction method and application thereof

Abstract

The application belongs to the technical field of microorganisms, and particularly relates to a strain for synthesizing N-acetylglucosamine, a construction method and application thereof. The engineering bacteria are obtained by the following multi-level metabolic engineering modification of an Escherichia coli as a starting strain: (1) knocking out gene clusters nagE BACD and gene cluster manX YZ ; (2) integrating a target gene expression cassette driven by a constitutive promoter at a stable expression site of a genome; (3) knocking out poxB, ldhA, manA and murQ ; (4) improving the expression level of an endogenous gene acs by promoter engineering, and introducing a gene glf . The application realizes self-stable expression of key metabolic genes under the premise of avoiding the use of IPTG, lactose or xylose and other exogenous inducers, thereby reducing production cost, simplifying fermentation process and improving controllability and batch stability of the fermentation process.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain that synthesizes N-acetylglucosamine, its construction method, and its applications. This strain involves introducing exogenous genes and knocking out some metabolic pathway genes in the host bacteria through gene editing, thereby obtaining an engineered bacterium that efficiently synthesizes N-acetylglucosamine without the need for an inducing agent, and its applications. Background Technology

[0002] N-acetylglucosamine (GlcNAc) is an important functional monosaccharide and a basic structural unit of chitin and various amino sugar polymers (such as hyaluronic acid and chondroitin sulfate). It is widely found in bacteria, yeast, molds, plants, and animals. Clinical studies have shown that GlcNAc has significant effects on bone and joint repair and health maintenance, and can be used to relieve symptoms of osteoarthritis and rheumatoid arthritis. Meanwhile, GlcNAc is widely used as an active ingredient in health supplements, food additives, cosmetics, and pharmaceuticals, thus having a huge market demand.

[0003] Currently, the main methods for industrial production of GlcNAc include chemical and enzymatic methods. Chemical methods typically involve acid hydrolysis of chitin in shrimp and crab shells to obtain glucosamine, which is then acetylated to obtain GlcNAc. However, this method suffers from problems such as harsh reaction conditions, highly corrosive equipment, severe wastewater pollution, limited raw material sources, and potential allergen residues. Enzymatic methods utilize glucosamine-6-phosphate synthase (GlmS) and acetyltransferase (GNA1) for biocatalysis. These methods offer mild reaction conditions and high selectivity, but suffer from long production cycles, high enzyme costs, and low conversion efficiency, making them unsuitable for large-scale industrial production.

[0004] With the rapid development of metabolic engineering and synthetic biology technologies, microbial fermentation has gradually become the mainstream method for producing GlcNAc. This method uses glucose as a raw material and modulates the metabolic pathways of the host bacteria to convert endogenous glucose-6-phosphate or fructose-6-phosphate into GlcNAc. In recent years, numerous patents have disclosed methods for increasing GlcNAc yield under different engineering strategies:

[0005] CN104293724A discloses a high-yield Escherichia coli strain that achieves a yield of approximately 120 g / L by knocking out the nagDCABE gene cluster and integrating a glmS mutant driven by a T7 or Trc promoter and the gna1 gene. However, this strain relies on IPTG-induced expression of key enzymes, increasing production costs and operational risks during industrial scale-up.

[0006] CN120310717A further knocked out the above-mentioned strain. gatY, ibaG, bfr, pfkA, wecC, pdxB, rfe, gntT, acrA, proV, proW, ygaZ, treB, pck and yciW By knocking out multiple metabolic genes, an engineered strain, H1-6-T8-5, with improved fermentation performance was obtained, achieving a yield of up to 165 g / L. However, this approach still relies on exogenous inducers, and the knockout of multiple genes affects the stability of the strain.

[0007] CN114574410A By knockout poxB and ldhA To reduce the accumulation of byproducts acetic acid and lactic acid, while overexpressing glmS and exogenous gna1 Furthermore, IPTG or lactose were used as induction methods, which further increased the yield. However, the complex induction system places higher demands on the controllability of industrial fermentation.

[0008] CN117645985A, building upon the previous approach, introduced a mutant of glucosamine-6-phosphate phosphatase. By further improving dephosphorylation efficiency, the engineered strain achieved a yield of 224 g / L, a 49.3% increase compared to the starting strain. However, according to research in the literature DOI: 10.1002 / advs.202309852, this mutant still maintains high catalytic activity towards glucose-6-phosphate, leading to the consumption of glucose-6-phosphate by non-target metabolism, causing an imbalance in cellular energy and carbon metabolism, which can easily inhibit strain growth or even lead to death. Therefore, this strategy is quite demanding in terms of fermentation control conditions, and the strain lacks stability, making it difficult to adapt to long-cycle industrial fermentation.

[0009] CN112430562A employs a different strategy, knocking out the 6-phosphofructokinase gene. pfkA This weakens glycolysis capacity, while using xylose to induce the expression of T7 RNA polymerase and using glycerol as the main carbon source for growth, thereby improving the utilization efficiency of carbon flux and achieving a GlcNAc yield of 107.8 g / L.

[0010] Building on this, CN119662684A further knocked out the glucose-6-phosphate dehydrogenase gene. zwfThis method blocks the entry of glucose-6-phosphate into the pentose phosphate pathway, allowing the precursor to be more concentrated for GlcNAc synthesis, thus increasing the yield to 240 g / L, making it one of the highest-yielding strains reported to date. Despite achieving high yields, this strategy still faces several limitations in practical application: First, the fermentation process requires a large amount of glycerol as a carbon source, significantly increasing industrial production costs; second, the fermentation system requires xylose as an inducer, which is difficult to completely remove from the target product GlcNAc during subsequent separation and purification, affecting product purity and quality.

[0011] CN112342230A constitutively integrates the key enzyme glmS into the chromosome and expresses it on a plasmid. gna1 GlcNAc synthesis was achieved by combining with a self-inducing culture medium; simultaneously, the nagEBACD gene cluster and pyruvate kinase gene were knocked out. pykF The glycolysis pathway was weakened, and nitrogen metabolism regulators (such as glnE or glnB) were modulated to improve product synthesis, resulting in a yield of approximately 112 g / L. However, this method relies on a plasmid expression system, which is prone to plasmid loss or expression fluctuations during industrial fermentation; furthermore, the self-inducible medium is mainly suitable for shake-flask culture, according to this patent... Figure 2 As shown, additional inducers are still required in 2 L high-density fermentation, which increases the complexity of fermentation control and production costs.

[0012] Although the engineered bacteria reported in these patents have achieved high yields to varying degrees, they still share common limitations: (1) they all rely on inducers (such as IPTG, lactose, xylose or arabinose) to drive the expression of key metabolic genes; (2) inducers are expensive, and the timing and dosage of addition must be accurately controlled during fermentation, resulting in poor batch stability during industrial scale-up; (3) some strategies require the use of expensive carbon sources such as glycerol to compensate for the metabolic burden, increasing the overall production cost; (4) multiple gene knockout or strong induction plasmid expression brings a large metabolic burden, which can easily lead to a decrease in the genetic stability of the strain.

[0013] In microbial fermentation systems, GlcNAc synthesis uses glucose-6-phosphate or fructose-6-phosphate as precursors. These intermediate metabolites simultaneously participate in cell growth metabolism and energy supply, easily leading to metabolic competition and limiting the synthesis efficiency of the target product. Meanwhile, traditional high-yield strains generally rely on external inducers such as IPTG, complicating the fermentation process and increasing operating costs and strain uncertainty. Therefore, there is an urgent need to develop a highly efficient engineered strain for GlcNAc production that can stably express key enzymes without external inducers, exhibits high genetic stability, lower cost, and is suitable for industrial scale-up. Such strains will significantly simplify fermentation processes, reduce production costs, improve batch stability, and provide crucial technical support for the green biomanufacturing of GlcNAc. Summary of the Invention

[0014] The purpose of this invention is to provide an engineered strain capable of stably and efficiently producing N-acetylglucosamine without the addition of external inducers (i.e., no inducers are needed during fermentation), its construction method, and its applications. By rationally designing and regulating the host bacterial metabolic pathways, key metabolic genes are expressed autonomously and stably without the use of exogenous inducers such as IPTG, lactose, or xylose. This reduces production costs, simplifies the fermentation process, and improves the controllability and batch stability of the fermentation process. Simultaneously, by reducing unnecessary metabolic burden and byproduct generation, the conversion efficiency of carbon sources to the target product is improved, enhancing the genetic stability and long-term fermentation performance of the engineered strain, thus meeting the demands for green, low-cost, and industrial-scale production of N-acetylglucosamine as much as possible.

[0015] The present invention adopts the following technical solution:

[0016] An engineered bacterium that efficiently synthesizes N-acetylglucosamine (GlcNAc) without the need for an inducing agent, wherein the engineered bacterium is obtained by multi-level metabolic engineering modification of Escherichia coli as the starting strain:

[0017] (1) Knockout of gene clusters related to N-acetylglucosamine transport and degradation nagEBACD and the gene cluster that mediates the intracellular transport of GlcNAc. manXYZ ;

[0018] (2) Integrating a target gene expression cassette driven by a constitutive promoter at a stable expression site in the genome, wherein the target gene includes a gene encoding glucosamine 6-phosphate synthase and a gene encoding glucosamine 6-phosphate acetyltransferase;

[0019] (3) Knockout of pyruvate oxidase gene poxB lactate dehydrogenase gene ldhA mannose-6-phosphate isomerase gene manAand N-acetylmuramic acid-6-phosphatase gene murQ ;

[0020] (4) Enhance the endogenous acetyl-CoA synthase gene through promoter engineering acs The expression level of glucose transporter gene was determined, and glucose transporter gene was introduced. glf .

[0021] Preferably, the target gene expression cassette is integrated at at least one stable expression site in the genome, or is repeatedly integrated at multiple different stable expression sites in the genome.

[0022] Preferably, in step (2), the stable expression site includes the yjiP site.

[0023] Preferably, the starting strain is Escherichia coli W3110.

[0024] Preferably, in step (2), the gene encoding 6-phosphate-glucosamine synthase is a codon-optimized mutant gene of 6-phosphate-glucosamine synthase, glmS54.

[0025] Preferably, in step (2), the constitutive promoter is the Pxk25 promoter.

[0026] Preferably, in step (4), the specific operations include:

[0027] (i) Endogenous acetyl-CoA synthase gene acs The natural promoter was replaced with the constitutive promoter Pxk25;

[0028] (ii) Introduce a glucose transporter gene driven by the constitutive promoter Pxk25 at the proV site of the genome. glf .

[0029] The present invention also provides a method for constructing the above-mentioned engineered bacteria, comprising the following steps:

[0030] S1. Provide the starting strain of Escherichia coli;

[0031] S2. Knockout of gene clusters using gene editing technology nagEBACD and manXYZ ;

[0032] S3. Construct an expression cassette containing a constitutive promoter, a gene encoding glucosamine 6-phosphate synthase, and a gene encoding glucosamine 6-phosphate acetyltransferase, and integrate it into a stable expression site in the genome of the starting strain;

[0033] S4. Using gene editing technology to knock out genes poxB , ldhA , manA and murQ ;

[0034] S5. Inherited genes acs The natural promoter is replaced with a constitutive promoter, and a glucose transporter gene driven by the constitutive promoter is integrated at a specific site in the genome. glf .

[0035] Preferably, in step S3, the stable expression site is the yjiP site; in step S5, the genome-specific site is the proV site; and the constitutive promoter is Pxk25.

[0036] The present invention also provides the application of the above-mentioned engineered bacteria for the synthesis of N-acetylglucosamine (GlcNAc) under conditions without the addition of an external inducer.

[0037] The present invention also provides a method for producing N-acetylglucosamine (GlcNAc) by fermentation using the above-mentioned engineered bacteria. The engineered bacteria are inoculated into a fermentation medium for cultivation, and no exogenous chemical inducers are added during the fermentation process. The yield of GlcNAc reaches more than 160 g / L.

[0038] Compared with the closest prior art, the beneficial effects of the present invention are as follows:

[0039] Compared with existing engineered N-acetylglucosamine bacteria that rely on exogenous inducers to regulate the expression of key metabolic genes, the present invention has at least the following beneficial effects:

[0040] 1. No external inducing agents are required, significantly reducing production costs.

[0041] The engineered bacteria constructed in this invention can stably express key enzymes in the N-acetylglucosamine synthesis pathway without the addition of exogenous inducers such as IPTG, lactose, or xylose during fermentation. This avoids the additional costs associated with the purchase and use of inducers, reduces raw material costs for industrial production, and minimizes the potential impact of inducer residues on product quality and safety.

[0042] 2. Simplified fermentation control improves process controllability

[0043] Since it does not rely on precise control of the timing and dosage of inducer addition, the fermentation process of this invention is more simplified, reducing the impact of human error on the fermentation results. This facilitates the standardization and automation of the fermentation process and improves the controllability during industrial scale-up.

[0044] 3. The stability and repeatability of fermentation batches were significantly improved.

[0045] By stably integrating key synthetic genes at the chromosome level and adopting a constitutive expression approach, this invention effectively avoids metabolic fluctuations and genetic instability caused by strong inducible expression, enabling engineered bacteria to maintain stable production performance during multiple batches of fermentation, thereby improving process reproducibility and production reliability.

[0046] 4. Possesses good production performance and industrial application potential.

[0047] The engineered strain, when cultured in a 50L fermenter for 60 hours, achieved a yield of 162 g / L of N-acetylglucosamine, with a specific yield of 2.7 g / L / h and a sugar-acid conversion rate of 56%. The high yield and conversion efficiency achieved without the addition of an external inducer indicate that this strain has promising prospects for industrial application. Attached Figure Description

[0048] Figure 1 This is a schematic diagram of the metabolic modification pathway for N-acetylglucosamine (GlcNAc).

[0049] Figure 2 Physical maps of pEcCas and pTargetF plasmids.

[0050] Figure 3 The fermentation results are for strain SXK206 at 50L.

[0051] Figure 4 The fermentation results are for 50L of SXK210 strain.

[0052] Figure 5 The fermentation results are for strain SXK212 at 50L.

[0053] Figure 6 These are the fermentation results of the first batch of SXK213 strain 50L.

[0054] Figure 7 This is the fermentation result of the second batch of SXK213 strain 50L.

[0055] Figure 8 This is the fermentation result of the third batch of 50L of SXK213 strain. Detailed Implementation

[0056] The technical solution of the present invention will be further described below with reference to specific embodiments. Unless otherwise specified, the technical means used in the present invention are all methods known to those skilled in the art.

[0057] like Figure 1As shown, based on the metabolic pathway diagram of the entire strain modification process and the aforementioned technical solution, the strains were modified to obtain Escherichia coli strains SXK201~SXK213.

[0058] The sequences of the relevant genes involved in the following examples are as follows:

[0059] The Ppxk25 promoter has the nucleotide sequence shown in SEQ ID NO.1.

[0060] The gene expression cassette Ppxk25-glmS54-Ter-Ppxk25-GNA1 has the nucleotide sequence shown in SEQ ID NO.2.

[0061] nagEBACD The gene operon has the nucleotide sequence shown in SEQ ID NO.3.

[0062] manXYZ The gene operon has the nucleotide sequence shown in SEQ ID NO.4.

[0063] yjip The gene has the nucleotide sequence shown in SEQ ID NO.5.

[0064] dadX The gene has the nucleotide sequence shown in SEQ ID NO.6.

[0065] ykgH The gene has the nucleotide sequence shown in SEQ ID NO.7.

[0066] fucI The gene has the nucleotide sequence shown in SEQ ID NO.8.

[0067] treB The gene has the nucleotide sequence shown in SEQ ID NO.9.

[0068] IdhA The gene has the nucleotide sequence shown in SEQ ID NO.10.

[0069] poxB The gene has the nucleotide sequence shown in SEQ ID NO.11.

[0070] acs The gene has the nucleotide sequence shown in SEQ ID NO.12.

[0071] manA The gene has the nucleotide sequence shown in SEQ ID NO.13.

[0072] murQ The gene has the nucleotide sequence shown in SEQ ID NO.14.

[0073] proV The gene has the nucleotide sequence shown in SEQ ID NO.15.

[0074] glf The gene has the nucleotide sequence shown in SEQ ID NO.16.

[0075] The experimental materials and methods involved in the following embodiments

[0076] (1) For details of the strains involved in the following examples, their main characteristics, uses, etc., please refer to Table 1.

[0077] Table 1. Engineered strains used

[0078]

[0079] (2) For details on the plasmids used in the following examples, their main characteristics, uses, etc., please refer to Table 2.

[0080] Table 2. Plasmids used

[0081]

[0082] (3) Details of the primers and their sequences used in the following examples are shown in Table 3.

[0083] Table 3 Primers and Sequences

[0084] nagEBACD-UP-F atatggccaatttcaccgac (SEQ ID NO.30) nagEBACD-UP-R gagaaagtatgacaccaggcg (SEQ ID NO.31) nagEBACD-DN-F tgtccgcctggtgtcatactttctctctgctttatgcctgatgcgac (SEQ ID NO.32) nagEBACD-DN-R ttgccagtctggtggtgttc (SEQ ID NO.33) manXYZ-UP-F ccaaatgagggcgcaaccttaac (SEQ ID NO.34) manXYZ-UP-R gagcaggaaaacgtcatcggtatcgctggttacgcttg (SEQ ID NO.35) manXYZ-DN-F gataccgatgacgttttcctgctcgcctaacagc (SEQ ID NO.36) manXYZ-DN-R gttttggcggcagtttgtcagc (SEQ ID NO.37) yjiP-UP-F aacaaacaactccttgtccggag (SEQ ID NO.38) yjiP-UP-R gtaaaatagtcaacacgcacggtgttaagctatcgagatcgcacagttca (SEQ ID NO.39) yjiP-DN-F gcgtggaaatgcaaattagaaaatagatgctattttatcacggtagccgtagtc (SEQ ID NO.40) yjiP-DN-R ttagctcttgagccatgaatagc (SEQ ID NO.41) dadX-UP-F cgtacacagcaactggcagctc (SEQ ID NO.42) dadX-UP-R accgccagaggtaaaataagtcacacgcacttacaccgtcacaaccgggacg (SEQ ID NO.43) dadX-DN-F gcaggtgttgaatgcagatccgtaaataatagatcagcttcctcttcagccac (SEQ ID NO.44) dadX-DN-R cttccgcggtttcaatctgcgtg(SEQ ID NO.45) ykgH-UP-F atcggtgcggagtggctgtttg(SEQ ID NO.46) ykgH-UP-R acattactccctgatgtgatgcccggtcatttttcgctctcaccggcat(SEQ ID NO.47) ykgH-DN-F ccgccagaggtaaatagtcaacacgcacatgcgtgaacaatcaaaaacaagata (SEQ ID NO.48) ykgH-DN-R tgcccagagttttgttggtattcat(SEQ ID NO.49) fucI-UP-F actggtcgccctgctgatcatgc(SEQ ID NO.50) fucI-UP-R ccgccagaggtaaatagtcaacacgcactacagattcctcactttattcggaaaata (SEQ ID NO.51) fucI-DN-F acattactccctgatgtgatgcccggtacattactccctgatgtgatgcc (SEQ ID NO.52) fucI-DN-R tggatatccagcatctggctggt(SEQ ID NO.53) treB-UP-F gtggccccgtcggtgtagaagc (SEQ ID NO.54) treB-UP-R gccagaggtaaatagtcacacgcactttctcttcggggcgcaattgcg (SEQ ID NO.55) treB-DN-F acgcaggcgtggaaatgcaattagaaaatagaaagccccatggcagatgacatt (SEQ ID NO.56) treB-DN-R acagaagaaatgttagcccactggc (SEQ ID NO.57) IdhA-UP-F gcatccaccagtgacggttc(SEQ ID NO.58) IdhA-UP-R aagactttctccagtgatgttgaatcac(SEQ ID NO.59) IdhA-DN-F attcaacatcactggagaaagtcttagaagctctgaccagtatttctcagac (SEQ ID NO.60) IdhA-DN-R tagtgaacctgttcagcaggc(SEQ ID NO.61) poxB-UP-F ttcaggtattcccgcggcaacac(SEQ ID NO.62) poxB-UP-R atggagaaccaaagggtggcatttcccgtcaataag (SEQ ID NO.63) PoxB-DN-F tgccaccctttggttctccatctcctgaatgtgataac (SEQ ID NO.64) PoxB-DN-R gcggcccggctccgtatatggattg(SEQ ID NO.65) eyes-UP-F ccagataaccgccggtagtatg(SEQ ID NO.66) eyes-UP-R ctgtgaatgttgtgtgcgtgttgactattttacctctggcggtgataatggttgcatgtaaagagagaaatactagccatgagccaaattcacaacacacc (SEQ ID NO.67) eyes-DN-F cgccagaggtaaaatagtcacacgcacacaatcacagtgtggttatttgttaca (SEQ ID NO.68) eyes-DN-R gactttcatgccgtcatcccac(SEQ ID NO.69) andA-UP-F gcagattggtgccggtattcac(SEQ ID NO.70) andA-UP-R cagtaagctcgatcaatccctgttttaatgtggaaatt (SEQ ID NO.71) andA-DN-F cagggattgatcgagcttactgaaaaaattaacatctcttg (SEQ ID NO.72) andA-DN-R gcgtctatccgaccactttgc(SEQ ID NO.73) murQ-UP-F gtaatggcaatcaccgttgccc(SEQ ID NO.74) murQ-UP-R ctgatctctttggccatgggcggtggtgaccttactatttacgatca (SEQ ID NO.75) murQ-DN-F cccatggccaaagagatcagc (SEQ ID NO.76) murQ-DN-R ccgataatattgccgcgcgg (SEQ ID NO.77)

[0085] Example 1: Specific methods of gene editing

[0086] The gene editing method used in this embodiment is based on the reference (doi:10.1093 / abbs / gmab036), and the physical maps of the key tool plasmids pEcCas and pTargetF are as follows: Figure 2 As shown, the pEcCas plasmid carries the Cas9 protein-coding gene for achieving DNA double-strand cutting; it also contains a regulated gRNA element, a Lambda Red recombination system to improve editing efficiency, and a reverse selection marker gene. sacB . sacBThe gene produces a toxic product in the presence of sucrose, facilitating subsequent plasmid removal. This plasmid also employs the temperature-insensitive replicon pSC101 to ensure stable replication at 37°C and carries a kanamycin resistance marker (working concentration: 50 mg / L) for host cell selection. The pTargetF plasmid is a gRNA expression plasmid driven by a pMB1 replicon. Its sgRNA construction region allows for the insertion of a 20 nt sequence (called N20) designed for the target gene. This plasmid also contains a spectinomycin resistance marker (working concentration: 50 mg / L). In the CRISPR system, pTargetF is primarily used to express gRNA that guides Cas9 to directionally cleave target DNA.

[0087] The specific operating procedure is as follows:

[0088] (1) Construction of pTargetF plasmid

[0089] N20 sequences were designed for the target genes using the CHOPCHOP online platform (https: / / chopchop.cbu.uib.no / ), with a downstream PAM sequence (5′-NGG-3′). The specific N20 sequences of the genes involved in this study are listed in Table 2. Subsequently, the pTarget plasmid was constructed: primers were synthesized based on the designed N20 sequences. The forward primer sequence was 5′-N20 sequence-gttttagagctagaaatagc (vector sequence 1, SEQ ID NO.78)-3′, and the reverse primer was 5′-N20 sequence-actagtattatacctaggac (vector sequence 2, SEQ ID NO.79)-3′. PCR amplification was performed using the pTargetF plasmid as a template. The obtained PCR products were digested and purified using DpnI enzyme and then introduced into *E. coli* Top10 chemicompetent cells (Shanghai Weidi Biotechnology Co., Ltd., catalog number: DL1010) for screening of positive transformants. After purifying and culturing the positive colonies, the culture was expanded in shake flasks, and the desired recombinant plasmids were finally obtained using a plasmid extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number DP103), namely pTargetF-nagEBACD, pTargetF-manXYZ, pTargetF-yjip, pTargetF-dadX, pTargetF-ykgH, pTargetF-fucI, pTargetF-treB, pTargetF-IdhA, pTargetF-poxB, pTargetF-acs, pTargetF-manA, pTargetF-murQ, and pTargetF-proV.

[0090] (2) Preparation of donor DNA fragments

[0091] The donor DNA fragment consists of the upstream and downstream homologous arms of the integration site, and the target gene fragment to be integrated located between them (if only gene knockout is performed, the target gene fragment does not need to be inserted). First, using the upstream primer of the upper homologous arm and the downstream primer of the lower homologous arm of the gene to be knocked out or integrated as overlapping primers, and using the *E. coli* genome as a template, the DNA fragment containing the homologous arm or target gene is obtained according to the PCR reaction system shown in Table 4 and the amplification procedure shown in Table 5. To construct a complete donor DNA fragment containing the target gene, the same overlapping primers are used, using a plasmid or linear DNA fragment containing the target gene to be integrated as a template, and amplification is performed using the PCR system shown in Table 4 to finally obtain a complete donor DNA fragment. The homologous arm primers involved are listed in Table 3.

[0092] Table 4 High-fidelity PCR reaction system

[0093]

[0094] Table 5 High-fidelity PCR reaction amplification program

[0095]

[0096] (3) Transformation of plasmid and donor DNA fragment

[0097] a) Transformation of pEcCas plasmid

[0098] First, the pEcCas plasmid was introduced into electrotransformable competent cells of the target strain using electrotransformation. The transformed cells were then revived and cultured on LB agar containing kanamycin (50 mg / L) at 37°C for 12 h. Single colonies were picked from the antibiotic plates and verified by colony PCR using appropriate primers. Positive transformants were screened to obtain the target strain containing the pEcCas plasmid.

[0099] b) Preparation of electrocompetent cells containing pEcCas strain

[0100] Select the above-mentioned positive single colonies and inoculate them into LB liquid medium containing kanamycin (50 mg / L) and arabinose (10 mM, used to induce the expression of recombinase on the pEcCas plasmid). The OD of the culture is... 600 When the bacterial cell density reaches 0.5–0.6, collect the cells and prepare electrocompetent cells according to the standard method described in Molecular Cloning: A Laboratory Manual (3rd Edition) (J. Sambrook, DW Russell, translated by Huang Peitang et al., Science Press, 2002).

[0101] c) Co-transformation of pTargetF plasmid with donor DNA fragment

[0102] Transformation was performed using electroporation cuvettes with an electrode spacing of 0.1 cm and an electroporation condition of 18 kV / cm. 120 ng of pTargetF plasmid and 500 ng of donor DNA fragment were added to the transformation system. After transformation, cells were revived and cultured, then plated on LB agar plates containing kanamycin (50 mg / L) and spectinomycin (50 mg / L) for screening of positive clones.

[0103] d) Plasmid elimination

[0104] The obtained positive clones were inoculated into LB liquid medium containing kanamycin (50 mg / L) and 10 mM rhamnose to induce the expression of gRNA targeting the origin of replication (ori) of the pTarget plasmid, thereby eliminating the pTarget plasmid. The culture was incubated overnight. Subsequently, the bacterial culture was streaked onto LB solid plates containing kanamycin (50 mg / L) and 10 mM rhamnose, and induction was continued to complete the elimination of the pTarget plasmid. The culture was incubated for 18–24 h. Single colonies were picked from the plates and streaked onto kanamycin (50 mg / L) LB plates and kanamycin-spectinomycin (50 mg / L each) double-antibiotic plates for verification. Colonies that grew only on the kanamycin plate and not on the double-antibiotic plate were considered clones that successfully eliminated the pTarget plasmid.

[0105] Next, single colonies that tested positive were selected and inoculated into LB liquid medium containing 0.5% glucose and 1% sucrose. Under these conditions, the expression product of the sacB gene carried by the pEcCas plasmid catalyzes the decomposition of sucrose and accumulates toxic fructose, thereby exerting toxicity selection pressure on strains that still retain the pEcCas plasmid, leading to the enrichment of strains that have lost the plasmid. After culturing for 18–24 h, bacterial cultures were streaked onto kanamycin (50 mg / L) LB plates and antibiotic-free LB plates for screening. Clones that grew only on antibiotic-free plates and not on kanamycin plates were considered antibiotic-free strains that had successfully eliminated the pEcCas plasmid. Thus, the target engineered strain with completely eliminated exogenous plasmid was obtained.

[0106] Example 2: Gene knockout procedure using nagEBACD gene knockout as an example

[0107] This embodiment uses Escherichia coli W3110 as the starting strain to illustrate the operation steps of knocking out the nagEBACD gene using the CRISPR-Cas9 system.

[0108] 1. Construction of the donor DNA fragment (ΔnagEBACD)

[0109] Using the genome of *E. coli* W3110 as a template, PCR amplification was performed using primer pairs nagEBACD-UP-F / nagEBACD-UP-R and nagEBACD-DN-F / nagEBACD-DN-R, following the PCR reaction systems and procedures shown in Tables 4 and 5, to obtain the upstream homologous arm fragment nagEBACD-UP and the downstream homologous arm fragment nagEBACD-DN. Subsequently, using these two homologous arm fragments as templates, fusion PCR was performed using nagEBACD-UP-F and nagEBACD-DN-R as primers to obtain the complete knockout donor DNA fragment, named ΔnagEBACD.

[0110] 2. Construction of pTargetF-nagEBACD plasmid

[0111] The construction method of this plasmid is the same as the construction process of the pTarget plasmid in Example 1.

[0112] 3. Co-transformation and positive clone screening

[0113] First, the pEcCas plasmid was introduced into E. coli W3110 to obtain the strain E. coli W3110-pEcCas containing pEcCas. Then, electrotransformation competent cells of this strain were prepared according to the method described in Example 1. The donor DNA fragment ΔnagEBACD obtained in step 1 and the pTargetF-nagEBACD plasmid constructed in step 2 were co-electrotransformed into the above competent cells. After resuscitation and culture, the transformed cells were plated on double-antibiotic LB agar plates containing kanamycin (50 mg / L) and spectinomycin (50 mg / L) and cultured at 37°C for 12 h. Transformants were picked, and colony PCR was performed using primers nagEBACD-UP-F and nagEBACD-DN-R to screen for positive clones with successful gene knockout.

[0114] 4. Plasmid elimination

[0115] The plasmid elimination method described in Example 1 was used to remove plasmids from positive clones. First, an intermediate strain with only the pTargetF-nagEBACD plasmid eliminated was obtained, named SXK201-pEcCas. Then, the pEcCas plasmid was further eliminated, ultimately obtaining a gene knockout engineered strain containing no exogenous plasmids, named SXK201. Thus, nagEBACD The gene knockout process is complete.

[0116] 5. Competent state preparation

[0117] The intermediate strain SXK201-pEcCas was prepared again as electrotransformation competent cells according to the method described in Example 1 for subsequent gene knockout.

[0118] 6. Other genes: Transport gene clusters manXYZ pyruvate oxidase gene poxB lactate dehydrogenase gene ldhA mannose-6-phosphate isomerase gene manA N-acetylmuramic acid-6-phosphatase gene murQ The above-described method and procedure are used for all knockouts.

[0119] Example 3: Gene integration procedure using the integration of expression units at the yjip gene locus as an example

[0120] This embodiment aims to illustrate how to integrate the GlmS54 mutant of 6-phosphate-glucosamine synthase and the GNA1 expression cassette of 6-phosphate-glucosamine acetyltransferase driven by the constitutive promoter Ppxk25 into the yjip gene site. The specific steps are as follows:

[0121] 1. Construction of the donor DNA fragment (Δyjip::Ppxk25-glmS54-Ter-Ppxk25-GNA1)

[0122] Using the genome of *E. coli* W3110 as a template, PCR amplification was performed using primer pairs yjip-UP-F / yjip-UP-R and yjip-DN-F / yjip-DN-R, following the PCR reaction systems and procedures shown in Tables 4 and 5, to obtain the upstream homologous arm fragment yjip-UP and the downstream homologous arm fragment yjip-DN. The insert sequence Ppxk25-glmS54-Ter-Ppxk25-GNA1 was synthesized in its entirety by Beijing Qingke Biotechnology Co., Ltd., yielding a complete linearized DNA fragment. Using the above two homologous arm fragments and the synthesized expression cassette fragment as templates, a three-fragment fusion PCR was performed using yjip-UP-F and yjip-DN-R as primers to obtain the complete donor DNA fragment, named Δyjip::Ppxk25-glmS54-Ter-Ppxk25-GNA1.

[0123] 2. Construction of pTargetF-yjip plasmid

[0124] The construction method of this plasmid is the same as the construction process of the pTarget plasmid in Example 1.

[0125] 3. Co-transformation and positive clone screening

[0126] The donor DNA fragment Δyjip::Ppxk25-glmS54-Ter-Ppxk25-GNA1 obtained in step 1 was co-transformed into SXK202-pEcCas competent cells by electroporation along with the pTargetF-yjip plasmid constructed in step 2. The transformed cells were revived and cultured on double-antibiotic LB agar plates containing kanamycin (50 mg / L) and spectinomycin (50 mg / L), and incubated at 37°C for 12 h. Transformants were picked and colony PCR was performed using primers yjip-UP-F and yjip-DN-R to verify successful gene integration and screen for positive clones.

[0127] 4. Plasmid elimination

[0128] The plasmid elimination method described in Example 1 was used to remove plasmids from positive clones. First, an intermediate strain with only the pTargetF-yjip plasmid eliminated was obtained, named SXK203-pEcCas. Then, the pEcCas plasmid was further eliminated, ultimately obtaining an engineered strain without any exogenous plasmids, named SXK203. At this point, the integration of the GlmS54 mutant driven by the constitutive promoter Ppxk25 and the GNA1 enzyme expression unit at the yjip site was completed.

[0129] 5. Other gene loci ( dadX, ykgH, fucI and treB The integration of GlmS54 mutants and GNA1 enzyme expression units driven by the constitutive promoter Ppxk25 was performed using the same method described above, integrating them at the corresponding sites. Furthermore, the expression unit fragment Ppxk25 was integrated at the acs site, and the glucose transporter gene driven by the Ppxk25 promoter was integrated at the proV site. glf (Sequence information is in the appendix). All donor DNA fragments were constructed according to the strategies described in Examples 1 and 3, and gene editing and strain screening were completed via the CRISPR-Cas9 system mediated by the corresponding pTarget plasmid.

[0130] Example 4: Shake-flask fermentation

[0131] Single clones grown on LB agar plates were inoculated into 2-3 mL of LB liquid medium and cultured at 37°C and 220 rpm for 7 h. Subsequently, 500 μL of the overnight culture was inoculated into 250 mL Erlenmeyer flasks containing 50 mL of seed culture medium and cultured for another 16 h at 30°C and 220 rpm. Next, 2.5 mL of the seed culture was inoculated into 250 mL Erlenmeyer flasks containing 25 mL of fermentation medium and fermented at 37°C and 220 rpm for 24 h. 1 mL of the fermentation broth was centrifuged at 12000 rpm, and the supernatant was used for N-acetylglucosamine product detection. Three biological replicates were performed for each strain's shake-flask fermentation experiment.

[0132] The culture medium composition is as follows:

[0133] LB medium: Tryptone 10 g / L, Sodium chloride (NaCl) 5 g / L, Yeast extract 10 g / L

[0134] Seed culture medium: Potassium dihydrogen phosphate (KH₂PO₄) 14 g / L, dipotassium hydrogen phosphate (K₂HPO₄) 16 g / L, sodium citrate dihydrate (Na₃Citrate·2H₂O) 1 g / L, ammonium sulfate ((NH₄)₂SO₄) 7.5 g / L, magnesium sulfate heptahydrate (MgSO₄·7H₂O) 0.25 g / L, calcium chloride dihydrate (CaCl₂·2H₂O) 0.015 g / L. Sterilize at 121℃ for 20 min. Before use, supplement the culture medium with 20 g / L glucose as a carbon source and add 1 ml / L of trace elements.

[0135] Fermentation medium: Potassium dihydrogen phosphate (KH₂PO₄) 6 g / L, dipotassium hydrogen phosphate (K₂HPO₄) 24 g / L, sodium citrate dihydrate (Na₃Citrate·2H₂O) 1 g / L, ammonium sulfate ((NH₄)₂SO₄) 10 g / L, magnesium sulfate heptahydrate (MgSO₄·7H₂O) 0.6 g / L, calcium chloride dihydrate (CaCl₂·2H₂O) 0.025 g / L, trace elements 1 ml / L. Sterilize at 121℃ for 20 min. Before use, supplement the medium with 25 to 35 g / L glucose as a carbon source and add 1 ml / L of trace elements.

[0136] Trace elements: Cobalt chloride hexahydrate (CoCl2·6H2O) 0.1 g / L, boric acid (H3BO3) 0.1 g / L, copper sulfate pentahydrate (CuSO4·5H2O) 0.1 g / L, ferrous sulfate heptahydrate (FeSO4·7H2O) 0.5 g / L, manganese sulfate monohydrate (MnSO4·H2O) 0.33 g / L, zinc sulfate heptahydrate (ZnSO4·7H2O) 0.38 g / L, sodium molybdate dihydrate (NaMoO4·2H2O) 0.1 g / L. Sterilization is achieved through 0.22µm filter membrane filtration.

[0137] The detection method for N-acetylglucosamine was as follows: An Agilent 1220 HPLC system equipped with a UV detector was used, with the detection wavelength set at 195 nm. The chromatographic column was a unitary NH2 (5 μm, 100 Å, 4.6 mm × 150 mm). The mobile phase was acetonitrile-phosphate buffer (75:25 v / v), which was sonicated for 10 min after mixing. The injection volume was 10 μL, the column temperature was maintained at 35℃, and the flow rate was set at 1.5 mL / min.

[0138] Example 5: Effect of expression unit copy number on N-acetylglucosamine production

[0139] This embodiment uses the fermentation method described in Example 4 to investigate multiple integrations at different chromosomal sites. yjip, dadX, ykgH, fucI, treB The effect of integrating the GlmS54 mutant and GNA1 enzyme expression unit driven by the constitutive promoter Ppxk25 on the ability of the strain to synthesize N-acetylglucosamine was investigated. The relationship between the copy number of the expression unit and product accumulation was evaluated by measuring the yield of N-acetylglucosamine in the fermentation product, and the results are summarized in Table 6.

[0140] Table 6. Effects of copy number of Ppxk25-glmS54-Ter-Ppxk25-GNA1 expression unit at different genomic loci on N-acetylglucosamine production.

[0141]

[0142] Example 6: Effects of byproduct-related gene modification on N-acetylglucosamine production

[0143] Based on the fermentation analysis results of Example 5, lactic acid and acetic acid were found to be the main byproducts in the fermentation broth. To reduce byproduct accumulation and improve the synthesis efficiency of the target product, this example further investigated the effects of the following genetic modifications on the yield of N-acetylglucosamine, building upon the high-yielding strain obtained in Example 5:

[0144] Knockout of lactate dehydrogenase gene ldhATo block the lactic acid production pathway;

[0145] Knockout of pyruvate oxidase gene poxB To reduce acetic acid synthesis;

[0146] The strong promoter Ppxk25 is integrated at the acs site to enhance acetyl-CoA synthase expression and promote acetic acid reuse.

[0147] All strains were cultured using the fermentation method described in Example 4, and the yield of N-acetylglucosamine was used as the evaluation index. The results are shown in Table 7.

[0148] Table 7. Effects of byproduct-related gene knockout and metabolic regulation on N-acetylglucosamine production.

[0149]

[0150] Example 7: The effect of optimizing carbon metabolic flow on N-acetylglucosamine production

[0151] Based on the high-yielding strain obtained in Example 6, in order to further improve precursor supply, reduce ineffective metabolic diversion, and enhance the synthesis efficiency of the target product, this example investigates its effect on N-acetylglucosamine synthesis through the following genetic modification strategy:

[0152] Knockout of mannose-6-phosphate isomerase gene manA To reduce the conversion of fructose-6-phosphate to mannose-6-phosphate, thereby increasing the accumulation of fructose-6-phosphate, a key precursor in the synthesis of N-acetylglucosamine;

[0153] Knockout of N-acetylmuramic acid-6-phosphatase gene murQ This inhibits the metabolic diversion of N-acetylglucosamine-6-phosphate to the muramic acid synthesis pathway, thereby increasing the flux of its conversion to the target product N-acetylglucosamine.

[0154] Introducing the glucose transporter glf to supplement the glucose uptake function of the phosphotransferase system (PTS) thereby reducing the consumption of phosphoenolpyruvate (PEP) and improving carbon metabolism efficiency.

[0155] All modified strains were cultured using the fermentation method described in Example 4, and the yield of N-acetylglucosamine was used as the evaluation index. The experimental results are summarized in Table 8.

[0156] Table 8: Effects of carbon metabolism pathway optimization on N-acetylglucosamine production

[0157]

[0158] Example 8: Fermentation of genetically engineered strains in a 50 L fermenter

[0159] The strain activation and shake-flask culture conditions before fermentation were the same: 4–5 single colonies were picked and inoculated into an Erlenmeyer flask containing 500 mL of medium, and cultured at 37°C and 220 rpm for 12–13 h. Subsequently, 1% of the inoculum was transferred to a 30 L seed tank and cultured at 34°C for another 12–13 h. After the cells reached the mid-to-late logarithmic growth stage, 10% of the inoculum was transferred to a 50 L fermenter for fed-batch fermentation.

[0160] The fermentation tank cultivation conditions are as follows: pH: controlled at 7.0 by automatic ammonia addition; initial temperature consistent with the seed tank temperature, and increased to 37 ℃ when OD reaches approximately 25; initial stirring speed: 250 rpm, adjusted to 600 rpm after feeding begins and maintained until completion; aeration rate: 1 vvm; dissolved oxygen control: maintained at initial conditions during the initial fermentation stage, and feeding is initiated after the initial sugar is depleted, using a "feeding-dissolved oxygen linkage" strategy to control the lower limit of dissolved oxygen level at approximately 30%, with no upper limit; residual sugar control: the residual glucose concentration in the fermentation broth is maintained below 0.5 g / L by adjusting the feeding rate.

[0161] The seed tank culture medium is as follows:

[0162] Glucose 25g / L, potassium dihydrogen phosphate 14g / L, dipotassium hydrogen phosphate trihydrate 21g / L, magnesium sulfate heptahydrate 0.25g / L, ammonium sulfate 7.5g / L, trisodium citrate 1g / L, calcium chloride 0.03g / L, trace elements 1mL / L.

[0163] The fermenter culture medium is as follows:

[0164] Glucose 5g / L, yeast powder 1.5g / L, urea 1g / L, potassium dihydrogen phosphate 6.67g / L, citric acid monohydrate 3.55g / L, magnesium sulfate heptahydrate 2.5g / L, ammonium sulfate 0.44g / L, calcium chloride 0.03g / L, trace elements 1mL / L.

[0165] The fed-batch culture medium during fermentation is a solution of 650 g / L glucose and 5 g / L potassium dihydrogen phosphate.

[0166] The experimental results of SXK206, SXK210, SXK212 and SXK213 strains in a 50 L fermenter are as follows: Figure 3 to Figure 6 As shown, the highest N-acetylglucosamine yields during fermentation were observed in strains SXK206, SXK210, and SXK212, at 126, 136, and 149 g / L, respectively, while the N-acetylglucosamine yield of strain SXK213 remained essentially consistent across the three fermentation processes (see [reference]). Figure 6 to Figure 8The strain achieved an average yield of 162 g / L within a 60-hour fermentation period, with an average specific production rate of approximately 2.7 g / (L·h) and a glucose-to-product conversion rate of approximately 56%. These results indicate that the strain possesses high yield stability and good process reproducibility, demonstrating significant potential for industrial application.

[0167] In summary, this invention has constructed an engineered strain capable of efficiently synthesizing N-acetylglucosamine without the addition of exogenous inducers, and its stable production performance has been verified through fermentation. Future research can further optimize synthetic biological elements and metabolic regulation strategies to enhance the production potential and application value of this strain.

Claims

1. An engineered bacterium, SXK213, for synthesizing N-acetylglucosamine, characterized in that, It was obtained through the following multi-level metabolic engineering modifications: (1) Using Escherichia coli W3110 as the starting strain, the gene cluster was knocked out. nagEBACD The strain SXK201 was obtained; (2) Based on strain SXK201, knock out gene clusters manXYZ The strain SXK202 was obtained; (3) Based on strain SXK202, a target gene expression cassette driven by the constitutive promoter Pxk25 was integrated into the stable expression site of yjiP in the genome to obtain strain SXK203; (4) Based on strain SXK203, the target gene expression cassette was integrated into the dadX site of the genome to obtain strain SXK204; (5) Based on strain SXK204, the target gene expression cassette was integrated into the ykgH site of the genome to obtain strain SXK205; (6) Based on strain SXK205, the lactate dehydrogenase gene was knocked out. ldhA The strain SXK208 was obtained; (7) Based on strain SXK208, the pyruvate oxidase gene was knocked out. poxB The strain SXK209 was obtained; (8) Based on strain SXK209, the endogenous acetyl-CoA synthase gene was added. acs The natural promoter was replaced with the constitutive promoter Pxk25 to obtain strain SXK210; (9) Based on strain SXK210, the mannose-6-phosphate isomerase gene was knocked out. manA The strain SXK211 was obtained; (10) Based on strain SXK211, the N-acetylmuramate-6-phosphatase gene was knocked out. murQ The strain SXK212 was obtained; (11) Based on strain SXK212, a glucose transporter gene driven by the constitutive promoter Pxk25 was introduced into the proV site of the genome. glf The final strain SXK213 was obtained; The target gene expression cassette is Ppxk25-glmS54-Ter-Ppxk25-GNA1, with the nucleotide sequence shown in SEQ ID NO. 2, which includes a codon-optimized 6-phosphate-glucosamine synthase mutant encoding gene. glmS54 and the gene encoding 6-phosphate-glucosamine acetyltransferase GNA1 The nucleotide sequence of the constitutive promoter Pxk25 is shown in SEQ ID NO.

1.

2. The method for constructing the engineered bacterium SXK213 as described in claim 1, characterized in that, It includes the following steps: S1. Using Escherichia coli W3110 as the starting strain, the gene cluster was knocked out. nagEBACD The strain SXK201 was obtained; S2. Based on strain SXK201, knock out gene clusters manXYZ The strain SXK202 was obtained; S3. Based on strain SXK202, a target gene expression cassette driven by the constitutive promoter Pxk25 was integrated into the stable expression site of yjiP in the genome to obtain strain SXK203; S4. Based on strain SXK203, the target gene expression cassette was integrated into the dadX site of the genome to obtain strain SXK204; S5. Based on strain SXK204, the target gene expression cassette was integrated into the ykgH site of the genome to obtain strain SXK205; S6. Based on strain SXK205, the lactate dehydrogenase gene was knocked out. ldhA The strain SXK208 was obtained; S7. Based on strain SXK208, knock out the pyruvate oxidase gene. poxB The strain SXK209 was obtained; S8. Based on strain SXK209, the endogenous acetyl-CoA synthase gene was... acs The natural promoter was replaced with the constitutive promoter Pxk25 to obtain strain SXK210; S9. Based on strain SXK210, the mannose-6-phosphate isomerase gene was knocked out. manA The strain SXK211 was obtained; S10. Based on strain SXK211, the N-acetylmuramate-6-phosphatase gene was knocked out. murQ The strain SXK212 was obtained; S11. Based on strain SXK212, a glucose transporter gene driven by the constitutive promoter Pxk25 was introduced into the proV site of the genome. glf The final strain SXK213 was obtained; The target gene expression cassette is Ppxk25-glmS54-Ter-Ppxk25-GNA1, with the nucleotide sequence shown in SEQ ID NO. 2, which includes a codon-optimized 6-phosphate-glucosamine synthase mutant encoding gene. glmS54 and the gene encoding 6-phosphate-glucosamine acetyltransferase GNA1 The nucleotide sequence of the constitutive promoter Pxk25 is shown in SEQ ID NO.

1.

3. The application of the engineered bacterium SXK213 as described in claim 1, characterized in that, Used to synthesize N-acetylglucosamine under conditions without added inducing agents.

4. A method for producing N-acetylglucosamine by fermentation using the engineered bacteria SXK213 as described in claim 1, wherein the engineered bacteria are inoculated into a fermentation medium for cultivation, and no exogenous chemical inducers are added during the fermentation process.

Images