Molecular marker for wheat alkylresorcinol content and application thereof
Patent Information
- Application Number
- CN202610251604.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-03
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2046-03-03
AI Technical Summary
[0005]本发明所要解决的问题是如何鉴定或辅助鉴定小麦烷基间苯二酚含量,并进行小麦育种。
Smart Images

Figure FT_1 
Figure SMS_7 
Figure SMS_8
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to molecular markers for the content of alkyl resorcinol in wheat and their applications. Background Technology
[0002] Research on wheat quality traits is of great significance to the development of agriculture and the food industry. As a major global food crop, the quality characteristics of wheat are directly related to dietary structure and human health. Current research mainly focuses on nutrition-related indicators such as protein composition, dietary fiber, and functional active ingredients. These studies provide important theoretical basis for the breeding of high-nutritional-value wheat varieties.
[0003] Alkylresorcinol (ARs) content in wheat grains is one of the important indicators for evaluating the nutritional quality of wheat. Alkylresorcinols are a class of bioactive phenolic lipid compounds, mainly distributed in the aleurone layer and seed coat of wheat grains, and are functional components unique to whole grains. Their content level directly reflects the accumulation of functional nutrients in the outer tissues of wheat grains and is closely related to the nutritional value of wheat grains. In recent years, with the continuous deepening of research on whole grain diets and functional foods, alkylresorcinol content has gradually become a focus of wheat nutritional quality research. Currently, researchers mainly use analytical methods such as high-performance liquid chromatography (HPLC) to quantitatively determine alkylresorcinols in wheat grains, a method with high accuracy and repeatability. Existing studies have shown that alkylresorcinol content varies significantly among different wheat varieties and is mainly regulated by genetic factors. Systematic research on wheat alkylresorcinol content will help achieve scientific evaluation of wheat nutritional quality and provide important basis for the breeding of high-nutritional-value wheat varieties.
[0004] High-quality wheat breeding is a core approach to improving wheat yield and quality, aiming to select varieties with superior agronomic traits and processing quality through genetic improvement. In recent years, with the rapid development of molecular biology and genomics technologies, high-quality wheat breeding has shifted from traditional phenotypic selection to precision breeding at the molecular level. Genetic analysis techniques, such as QTL mapping and GWAS, have become the main means of identifying genes and QTLs related to superior traits. Furthermore, KASP (Kompetitive Allele-Specific PCR) markers, as an efficient, low-cost, and high-throughput molecular marker technology, have been widely used in high-quality wheat breeding. KASP markers can rapidly and accurately identify allelic variations of target genes, significantly improving the efficiency and precision of breeding selection. Through KASP marker-assisted selection, researchers have successfully bred several high-quality wheat varieties, which exhibit significant advantages in yield, stress resistance, and processing quality. The application of KASP markers has not only accelerated the process of high-quality wheat breeding but also provided strong technical support for wheat genetic improvement. Summary of the Invention
[0005] The problem to be solved by this invention is how to identify or assist in the identification of alkyl resorcinol content in wheat and to carry out wheat breeding.
[0006] To address the aforementioned technical problems, the first aspect of this invention provides the use of a substance for detecting the genotype of the SNP site AX-109949078 in the wheat genome in any of the following or in the preparation of a product having any of the following characteristics:
[0007] A1) Identification or auxiliary identification of alkyl resorcinol content in wheat grains; A2) Screening or assisted screening of wheat with high levels of alkyl resorcinol in the grains; A3) Selecting wheat varieties with high alkyl resorcinol content in their grains; A4) Wheat genetics and breeding; The SNP site AX-109949078 is the 81st position of SEQ ID NO: 4.
[0008] The genome sequence IWGSC_RefSeq_v1.0 of the common wheat variety Chinese Spring was used as the reference genome, and the SNP site was located at 573746956 bp on wheat chromosome 6B.
[0009] In the application described above, the SNP locus AX-109949078 has a genotype of CC or GG.
[0010] In the above-described application, the substance used to detect the genotype of SNP site AX-109949078 in the wheat genome can be reagents and / or instruments required to determine the polymorphism or genotype of the SNP site using at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarrays. The SNP microarrays include microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and microarrays based on fluorescent molecule-DNA binding reactions.
[0011] In the application described above, the substance used to detect the SNP locus AX-109949078 genotype in the wheat genome is either B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of primer 1 includes the sequence shown in positions 22-42 of SEQ ID NO: 1; The nucleotide sequence of primer 2 includes the sequence shown in positions 22-43 of SEQ ID NO: 2; The nucleotide sequence of primer 3 is SEQ ID NO: 3.
[0012] In the above applications, primers 1 and 2 may or may not be labeled. The label refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).
[0013] In some embodiments, the nucleotide sequence of primer 1 is SEQ ID NO: 1.
[0014] In some embodiments, the nucleotide sequence of primer 2 is SEQ ID NO: 2.
[0015] In a second aspect, the present invention provides any of the following substances: The primer set described in the first aspect; Alternatively, PCR reagents or kits containing the primer set described in the first aspect.
[0016] Thirdly, the present invention provides the use of the primer kits, PCR reagents, or kits described in the second aspect in any of the following, or in the preparation of products having any of the following characteristics: A1) Identification or auxiliary identification of alkyl resorcinol content in wheat grains; A2) Screening or assisted screening of wheat with high levels of alkyl resorcinol in the grains; A3) Selecting wheat varieties with high alkyl resorcinol content in their grains; A4) Wheat genetics and breeding.
[0017] Fourthly, the present invention provides a method for identifying or assisting in the identification of alkylresorcinol content in wheat grains, comprising the following steps: detecting whether the genotype of the SNP site AX-109949078 in the wheat genome described in the first aspect is CC or GG, wherein the alkylresorcinol content in the wheat grains of the test wheat with the genotype CC at the AX-109949078 site is greater than or candidate greater than that in the test wheat with the genotype GG at the AX-109949078 site.
[0018] The method described above, which involves detecting whether the genotype of SNP site AX-109949078 in the first aspect of the wheat genome is CC or GG, includes the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect to obtain the genotype.
[0019] Fifthly, the present invention provides a method for breeding wheat with high alkyl resorcinol content in its grains, comprising the following steps: breeding wheat with the CC genotype at the AX-109949078 locus described in the fourth aspect.
[0020] In a sixth aspect, the present invention provides a method for wheat breeding, comprising the following steps: detecting the genotype of the SNP locus AX-109949078 described in the first aspect in the wheat genome, and selecting wheat with the genotype CC at the AX-109949078 locus as a parent for breeding.
[0021] The method described above for detecting whether the genotype of SNP site AX-109949078 in the wheat genome is CC or GG includes the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect to obtain the genotype.
[0022] The above-mentioned method of obtaining genotypes involves reading the fluorescence data of the amplification products obtained from the KASP reaction and performing genotyping based on the fluorescence color.
[0023] In this document, the breeding objective may include developing wheat varieties with high resorcinol content in the grain. The wheat may be a pure line or an inbred line.
[0024] In this paper, the wheat used can be selected from the 173 wheat materials in Table 2.
[0025] This invention identifies a wheat alkyl resorcinol content site and its linked molecular marker, which is named... QARC.caas-6B It is located on chromosome 6B at approximately 572.5–573.9 Mb; its closely linked SNP marker is... AX- 109949078, In a BLUE environment, 3.9–9.7% of phenotypic variation can be explained. KASP primers were developed based on corresponding markers for marker-assisted screening of alkylresorcinol content. This invention is of great significance for breeding wheat varieties with increased alkylresorcinol content. Attached Figure Description
[0026] Figure 1 KASP tag K_AX-109949078 Genotyping results for 173 wheat varieties. Blue indicates the CC genotype (FAM primer), corresponding to high alkyl resorcinol content, while red indicates the GG genotype (HEX primer), corresponding to low alkyl resorcinol content. Detailed Implementation
[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0029] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0030] The following examples used statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was considered satisfactory. () indicates a significant difference, P < 0.01. () indicates a highly significant difference, P < 0.001. () indicates a highly significant difference.
[0031] Example 1: Discovery of SNP site AX-109949078 related to alkylresorcinol content and design of KASP-labeled primers I. SNP sites related to alkyl resorcinol content AX-109949078 The discovery A natural population consisting of 217 wheat materials was planted in Zibo, Shandong (ZNP2023) and Shijiazhuang, Hebei (GNP2023) in 2022-2023, and in Zibo, Shandong (ZNP2024) in 2023-2024.
[0032] The content of alkyl resorcinols (ARs) in the material under various environmental conditions was determined by high performance liquid chromatography (HPLC). The specific method is as follows: After field harvest, wheat grains (2g) were ground using a SPEX 2010 GenoGrinder high-throughput grinder to obtain whole wheat flour. Arsenic sulfoxides (ARs) in 1g of whole wheat flour were extracted with 30mL ethyl acetate at 25℃ for 12h with shaking. The extract was centrifuged at 3500rpm for 3min, and the supernatant was collected. The extract was dried by rotary evaporation, redissolved in 3mL of HPLC-grade methanol, and filtered through a 0.22μm filter into a chromatographic sample vial to obtain the sample extract. Sample extracts were analyzed using a Waters Corporation UPLC-PDA system (Waters Corporation, Milford, MA, USA). Mobile phase A consisted of chromatographic-grade ultrapure water containing 0.1% formic acid (FA), and mobile phase B consisted of chromatographic-grade ultrapure water containing 0.1% FA and methanol. The chromatographic column was an ACQUITYUPLC BEH C18 column (1.7 μm, 2.1 mm × 100 mm). The flow rate of the mobile phase was maintained at 0.4 mL / min, with mobile phase A accounting for 2% and mobile phase B for 98%. The sample injection volume was 0.8 μL, and the column temperature was maintained at 50 °C. Alkyl resorcinols (ARs) were determined by comparing their retention times with analytical standards, and alkyl resorcinols (ARs) were quantified using an external calibration curve of absorbance at 276 nm. Qualitative analysis was performed by comparing their retention times with those of the standards. The standards used included 5-n-heptadecylresorcinol (C17:0, CAS: 41442-57-3), 5-n-nonadecylresorcinol (C19:0, CAS: 35176-46-6), 5-n-heneicosylresorcinol (C21:0, CAS: 70110-59-7) and 5-n-tricosylresorcinol (C23:0, CAS: 70110-60-0), all purchased from Sigma-Aldrich (Merck, Darmstadt, Germany), with corresponding catalog numbers 97001 (C17:0), 57981 (C19:0), 50851 (C21:0) and 03422 (C23:0), respectively.
[0033] This study used a mixed linear model (MLM) in Tassel software for GWAS analysis of wheat. The GWAS analysis revealed a significant SNP locus associated with alkylresorcinol content within the 572.5–573.9 Mb (1.4 Mb) region on wheat chromosome 6B, named AX-109949078. The association between this locus and alkylresorcinol content was statistically significant, suggesting that it may play a role in the genetic control of this trait.
[0034] SNP AX-109949078 is located at 573746956 bp in the wheat reference genome (chromosome 6B) Chinese Spring RefSeqv1.0 (reference genome URL: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). [This information is related to...] QARC.caas-6B Closely linked markers AX-109949078 (The positive chain) is shown in SEQ ID No. 4 for the SNP variant and its surrounding nucleotides (S represents C or G).
[0035] SEQ ID No.4: 5'-AACCCTAGGCGAGGAGCATAGGGGAAAAAACTCCAATAAAAGGTAAAAATCTCCAATTTTGTACACGGTGGTAATCTTAGSTAACATTGACCATGAGGTCACTCCCTTTTTGGGGGTTACATTTCTTATAAAATTTATTTTCTGGCCGAGTTTTTATTATA-3'.
[0036] The AX-109949078 site is the 81st nucleotide of SEQ ID NO: 4, which is either C or G.
[0037] The alkylresorcinol content in wheat varieties with genotype CC at the AX-109949078 locus was higher than that in wheat varieties with genotype GG at the AX-109949078 locus (as shown in Table 1).
[0038] Table 1 shows the AX-109949078 locus and its characteristics.
[0039] II. Design of KASP primers for detecting SNP site AX-109949078 KASP marker primer sequences were designed based on the SNP site AX-109949078, as follows: Primer A: 5'-GAAGGTGACCAAGTTCATGCT gtacacggtggtaatcttagC-3' (SEQ ID No:1, the underlined part is the specific fluorescent tag sequence FAM); Primer B: 5'- GAAGGTCGGAGTCAACGGATT tgtacacggtggtaatcttagG-3' (SEQ ID No:2, the underlined part is the specific fluorescent tag sequence HEX); Primer C: 5'-aaaagggagtgacctcatgg-3' (SEQ ID No:3).
[0040] The amplification product showed the color of the FAM fluorescent tag (blue), corresponding to the genotype CC of wheat SNP site AX-109949078; The amplification product showed the color of the HEX fluorescent tag (red), corresponding to the wheat SNP site AX-109949078 with the genotype GG.
[0041] III. Establishment of a method for detecting SNP site AX-109949078 1. Extract genomic DNA from wheat leaves to be tested; 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers shown in SEQ ID NO: 1-3; (1) Preparation of KASP primer working solution First, dilute the three KASP primers shown in SEQ ID NO: 1-3 to 100 μM with ddH2O. Then, prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. Store at -20 ℃ for later use.
[0042] (2) KASP reaction system and procedure The KASP reaction system can be as follows: 2.0 μl KASP 2× Master Mix (LGC, catalog number: 13448166), 0.048 μl KASP primer working solution, 1.952 μl template DNA (50 ng / μl), and then add sterile ultrapure water to make up the reaction system to 5.0 μL.
[0043] KASP labeling can be performed on a standard PCR amplification instrument.
[0044] The reaction procedure for KASP labeling can be as follows: 94℃ for 15 min; 94℃ for 20 s, 63-55℃ for 1 min (decreasing by 1℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 32 cycles; extension at 72℃ for 3 min, storage at 4℃.
[0045] 3. Use an automated focusing fluorescence multi-functional microplate reader (PHERAstar Plus, BMG Labtech GmbH, Germany) to scan and read the fluorescence values using the FAM and HEX beams. (For FAM fluorescent tag sequences, the values are observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the signal is displayed in blue during interpretation. For HEX fluorescent tag sequences, the values are observed at an excitation wavelength of 528 nm and an emission wavelength of 560 nm, and the signal is displayed in red during interpretation.) Determine the genotype of the wheat SNP locus to be tested based on the fluorescence signal color.
[0046] If the fluorescence signal of the amplification product is FAM fluorescence signal (blue), then the genotype of the wheat SNP site AX-109949078 to be tested is CC; if the fluorescence signal of the amplification product is HEX fluorescence signal (red), then the genotype of the wheat SNP site AX-109949078 to be tested is GG.
[0047] The content of alkyl resorcinol in wheat with the SNP site AX-109949078 and genotype CC is greater than that in wheat with the SNP site AX-109949078 and genotype GG.
[0048] Genotype CC is a genotype with excellent alkyl resorcinol content, indicating that this marker can play an auxiliary selection role in wheat alkyl resorcinol content, providing a molecular-assisted selection method for breeding varieties with high alkyl resorcinol content.
[0049] Example 2: Application of SNP site AX-109949078 related to alkylresorcinol content The experimental materials consisted of 123 wheat varieties from the Huang-Huai region, as detailed in Table 2.
[0050] 1. Detection of Alkyl Resorcinol Content in Wheat The materials were planted in Zibo, Shandong and Shijiazhuang, Hebei in 2022-2023, and in Zibo, Shandong in 2023-2024. The alkyl resorcinol (ARs) content of the materials under each environment was determined by high performance liquid chromatography according to the method in Example 1. Each material was tested in triplicate, and the average value was taken. The results are shown in Table 2.
[0051] 2. SNP sites AX-109949078 Genotyping Genomic DNA was extracted from 173 family pedigree young leaves using a modified CTAB method as templates and amplified according to the method in Example 1, Section 3 to obtain the genotypes of each sample.
[0052] The results are shown in Table 2 and Figure 1As shown, among the 173 wheat varieties, 40 varieties exhibited the superior genotype CC (blue), with an average alkylresorcinol content of 743.1 μg / g; 133 varieties exhibited the GG genotype (red), with an average alkylresorcinol content of 632.2 μg / g; statistical tests showed... AX-109949078 The gene effects reached a significant difference ( P <0.001).
[0053] In conclusion, when breeding wheat varieties with high alkyl resorcinol content, SNP sites can be selected. AX- 109949078 Wheat with the CC genotype is used as a parent in breeding to accelerate the selection of high-quality varieties.
[0054] Table 2 shows the genotypes and alkyl resorcinol content detection results of 173 wheat varieties.
[0055] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of a substance for detecting the genotype of SNP locus AX-109949078 in the wheat genome in any of the following or in the preparation of a product having any of the following characteristics: A1) Identification or auxiliary identification of alkyl resorcinol content in wheat grains; A2) Screening or assisted screening of wheat with high levels of alkyl resorcinol in the grains; A3) Selecting wheat varieties with high alkyl resorcinol content in their grains; The SNP site AX-109949078 is the 81st position of SEQ ID NO: 4; The SNP locus AX-109949078 has a genotype of CC or GG. The content of alkyl resorcinol in the wheat grains of the tested wheat with the genotype CC at the SNP site AX-109949078 is greater than or can be greater than that of the tested wheat with the genotype GG at the SNP site AX-109949078.
2. The application according to claim 1, characterized in that: The substance used to detect the SNP locus AX-109949078 genotype in the wheat genome is either B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of primer 1 includes the sequence shown in positions 22-42 of SEQ ID NO: 1; The nucleotide sequence of primer 2 includes the sequence shown in positions 22-43 of SEQ ID NO: 2; The nucleotide sequence of primer 3 is SEQ ID NO:
3.
3. The application according to claim 2, characterized in that: The nucleotide sequence of primer 1 is SEQ ID NO: 1; The nucleotide sequence of primer 2 is SEQ ID NO:
2.
4. A method for identifying or assisting in the identification of alkylresorcinol content in wheat grains, comprising the following steps: detecting whether the genotype of the SNP site AX-109949078 in claim 1 in the wheat genome is CC or GG, wherein the alkylresorcinol content in the wheat grains of the test wheat with the genotype CC at the SNP site AX-109949078 is greater than or candidate greater than that in the test wheat with the genotype GG at the SNP site AX-109949078.
5. The method according to claim 4, characterized in that: The method for detecting whether the genotype of SNP site AX-109949078 in claim 1 of wheat genome is CC or GG includes the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 2 to obtain the genotype.
6. A method for breeding wheat with high alkyl resorcinol content in grains, comprising the following steps: breeding wheat with the genotype CC at the SNP site AX-109949078 as described in claim 4 or 5.
Citation Information
Patent Citations
Corn grain size and grain weight related protein as well as coding gene and application thereof
CN116003544A
Plants comprising wheat g-type cytoplasmic male sterility restorer genes, molecular markers and uses thereof
WO2018015403A1